일본 도쿄지역 3개 온실 식물원의 열대 및 아열대 약용식물 조사 연구
|
|
- 수향 기
- 6 years ago
- Views:
Transcription
1 일본도쿄지역 3개온실식물원의 열대및아열대약용식물조사연구 박종철교수 국립순천대학교생명산업과학대학한약자원개발학과및순천대한의약연구소 Study on the Tropical and Subtropical Plants of 3 Greenhouse Botanical Gardens in Tokyo Province of Japan Park, Jong Cheol Department of Oriental Medicine Resources and Research Institute of Korean Oriental Medicine, Sunchon National University Abstract From the greenhouses of Tokyo Metropolitan Medicinal Plants Garden, Medicinal Plant Garden of Hoshi University and Yumenoshima Tropical Greenhouse Dome in Tokyo Province of Japan, 311 tropical and subtropical plants were examined by photographing. From the greenhouse of Tokyo Metropolitan Medicinal Plants Garden, 152 species in 58 families of plants were investigated. Among the greenhouse of this botanic garden, the most dominant family was Apocynaceae with 13 species, followed by Leguminosae with 11 species, Malvaceae and Myrtaceae with 8 species, Solanaceae and Zingiberaceae 7 species, and Moraceae 6 species. From the greenhouse of Medicinal Plant Garden of Hoshi University, 103 species in 47 families of plants were studied. The most dominant families in the greenhouse of this botanic garden was Leguminosae with 19 species, followed by Apocynaceae with 7 species, Zingiberaceae with 6 species, and Moraceae 5 species. From the Yumenoshima Tropical Greenhouse Dome, 56 species in 31 families of plants were classified. Keywords: Medicinal Plant, Tropical Plant, Subtropical Plant, Tokyo Metropolitan Medicinal Plants Garden, Medicinal Plant Garden of Hoshi University, Yumenoshima Tropical Greenhouse Dome Correspondence: Park, Jong Cheol Dept. of Oriental Medicine Resources and Research Institute of Korean Oriental Medicine, Sunchon National Univ., 255 Jungang-ro, Suncheon, Jeonnam Republic of Korea flavonoid@empas.com Tel: Received , revised , accepted , available online doi: /khmi
2 박종철. 도쿄온실식물원의열대및아열대약용식물 서론 일본도쿄도( 東京都 ) 지역에있는도쿄도약용식물원( 東京都薬用植物園 ), 호시약과대학약용식물 원( 星藥科大學薬用植物園 ) 및유메노시마열대식물관( 夢の島熱帯植物館 ) 의각온실에서재배중인 열대및아열대약용식물을조사했다. 도쿄도약용식물원의정식명칭은도쿄도건강안전센터도쿄도 약용식물원이다 년설립한이래약무행정의하나로서약용식물을수집, 재배하고있으며공익사 단법인도쿄생약협회에서관리하고있다. 식물원은한방약원료식물, 제약원료식물, 민간약원료식물, 염료, 향료식물, 유용수목, 유독식물, 외국식물그리고아편등의구역으로구분되어있다. 온실은 정문근처에세워져있고약사자료관내에는한약전시실도갖추어놓았다 1). 호시약과대학약용식물원 은도쿄시내에있는대학의부속약용식물원이다. 대학약용식물원이지만시민들이무료로자유롭게 약용식물을둘러보고현장공부를할수있는유익한장소로알려져있다. 대학정문에있는안내실의 방명록에기재하고방문증을받으면누구나약용식물원에들어갈수있다 2). 유메노시마열대식물관은 도쿄시내의유메노시마공원안에있으며거대한온실로꾸며진약용식물원이다. 1 년내내기온이 높고비가많은열대우림의환경으로만들어놓았다 3). 3 곳식물원의온실에서사진촬영이가능한 열대및아열대약용식물의사진을확보한후이들학명을알파벳순과과명순으로정리하였다. 본 논문은일본식물원의온실에서식재중인식물을통해열대및아열대약용식물자원을연구하는데 유용한기초자료로활용될것이다. 촬영한식물사진은증거사진으로서저자의연구실에보관중이다. 본론 1) 조사방법 는 저자가방문조사한도쿄도약용식물원, 호시약과대학약용식물원및유메노시마열대식물관의정보 Table 1 과같다. 본논문에기재한식물은식물원의팻말에있는학명을기본으로하여 the Plant List 4), the International Plant Names Index 5), 국가생물종지식정보 6) 를통해이들학명을확인했다. 식물원팻말에서학명이이명으로표기된것은본문에함께제시하였다. 2) 결과및고찰 도쿄지역 3 곳식물원의온실에서 311 종의열대및아열대약용식물을촬영하여그학명을정리 분 석했다. 즉도쿄도약용식물원온실, 호시약과대학약초원온실및유메노시마열대식물관온실에서 각 152 종, 103 종및 56 종의약용식물을조사했다. 도쿄도약용식물원의온실에서 58 과 152 종식물을확인하였다(Fig. 1). 과( 科 ) 별로분석하면협죽도 과(Apocynaceae) 식물이 13 종으로가장많으며, 콩과(Leguminosae) 11 종, 아욱과(Malvaceae), 도금 양과(Myrtaceae) 식물이각 8 종, 가지과(Solanaceae), 생강과(Zingiberaceae) 식물이각 7 종, 뽕나무 과(Moraceae) 6 종, 대극과(Euphorbiaceae), 꿀풀과(Lamiaceae) 식물이각 5 종순으로분포하고있 다. 158
3 Table 1. Information on 3 botanical gardens in Tokyo Province of Japan Botanical Garden Name Tokyo Metropolitan Medicinal Plants Garden Location 21-1 Nakajimacho, Kodaira, Tokyo , Japan Created 1946 Tel Website Botanical Garden Name Medicinal Plant Garden of Hoshi University Location Ebara, Shinagawa ku, Tokyo Japan Created 1941 Tel Website Botanical Garden Name Yumenoshima Tropical Greenhouse Dome Location Yumenoshima, Koto, Tokyo , Japan Created 1988 Tel Website 이중협죽도과(Apocynaceae) 식물은 Carissa macrocarpa (Eckl.) A.DC., Cascabela thevetia (L.) Lippold, Catharanthus roseus (L.) G.Don, Ceropegia sandersonii Decne. ex Hook.f., Gymnema sylvestre (Retz.) R.Br. ex Sm., Marsdenia condurango Rchb.f., Marsdenia floribunda (Brongn.) Schltr., Melodinus cochinchinensis (Lour.) Merr., Rauvolfia serpentina (L.) Benth. ex Kurz, Rauvolfia verticillata (Lour.) Baill., Strophanthus divaricatus (Lour.) Hook. & Arn., Strophanthus gratus (Wall. & Hook.) Baill., Telosma cordata (Burm. f.) Merr. 이다. 도쿄도약용식물원온실의 약용식물을속( 屬 ) 별로다시정리하면, 배암차즈기속( Salvia) 식물이 5 종, 꽃양하속 (Alpinia) 과녹나무 속 (Cinnamomum) 식물이 고있다 (Table 2). 4 종, 무화과나무속(Ficus), 후추속 (Piper), Syzygium 속식물은 3 종이자라 도쿄도약용식물원의온실에는약용식물외에식용하는열대과일도많이심어져있다. 이들열대과일 은난초과(Orchidaceae) 인바닐라(Vanilla planifolia Jacks. ex Andrews), 뽕나무과(Moraceae) 인빵 나무 (Artocarpus altilis (Parkinson ex F.A.Zorn) Fosberg) 와큰빵나무(Artocarpus heterophyllus Lam.), 사포타과(Sapotaceae) 인사포딜라[Manilkara zapota (L.) P.Royen], 포포나무과(Annonaceae) 인슈가애플 (Annona squamosa L.) 과체리모야(Annona cherimola Mill.), 도금양과(Myrtaceae) 인스 트로베리구아바 (Psidium cattleianum Afzel. ex Sabine) 와자바애플[Syzygium samarangense (Blume) Merr. & L.M.Perry], 물푸레나무과(Oleaceae) 인올리브(Olea europaea L.), 시계꽃과 (Passifloraceae) 인패션프루트(Passiflora edulis Sims) 등이다. 159
4 박종철. 도쿄온실식물원의열대및아열대약용식물 Fig.1. Some medicinal plants in the greenhouse of Tokyo Metropolitan Medicinal Plant Garden 1 Alpinia oxyphylla Miq., 2 Artocarpus heterophyllus Lam., 3 Elettaria cardamomum (L.) Maton, 4 Piper methysticum G.Forst., 5 Rauvolfia verticillata (Lour.) Baill., 6 Tamarindus indica L. Table 2. List of 152 medicinal plants in the greenhouse of Tokyo Metropolitan Medicinal Plant Garden by family name Family name Acanthaceae Achariaceae Annonaceae Apocynaceae Scientific name Justicia brandegeeana Wassh. & L.B.Sm. Odontonema tubaeforme (Bertol.) Kuntze Perilepta dyeriana (Mast.) Bremek. Hydnocarpus anthelminthicus Pierre ex Laness. Annona cherimola Mill. Annona squamosa L. Artabotrys hexapetalus (L.f.) Bhandari Cananga odorata (Lam.) Hook.f. & Thomson Carissa macrocarpa (Eckl.) A.DC. Cascabela thevetia (L.) Lippold Catharanthus roseus (L.) G.Don Vinca rosea L. Ceropegia sandersonii Decne. ex Hook.f. Gymnema sylvestre (Retz.) R.Br. ex Sm. Marsdenia condurango Rchb.f. Marsdenia floribunda (Brongn.) Schltr. Melodinus cochinchinensis (Lour.) Merr. Rauvolfia serpentina (L.) Benth. ex Kurz Rauvolfia verticillata (Lour.) Baill. Synonym written on the name tag in the botanical garden Beloperone guttata Brandegee Odontonema strictum (Nees) Kuntze Artabotrys uncinatus (Lam.) Merr. Carissa grandiflora (E.Mey.) A.DC. Thevetia peruviana (Pers.) K.Schum. Stephanotis floribunda Brongn. Melodinus monogynus Roxb. ex Lindl. 160
5 Aquifoliaceae Araceae Aristolochiaceae Asparagaceae Aspleniaceae Begoniaceae Bignoniaceae Strophanthus divaricatus (Lour.) Hook. & Arn. Strophanthus gratus (Wall. & Hook.) Baill. Telosma cordata (Burm. f.) Merr. Ilex latifolia Thunb. Alocasia macrorrhizos (L.) G.Don Aristolochia shimadae Hayata Asparagus aethiopicus L. Aspidistra elatior Blume Dracaena surculosa Lindl. Drimia maritima (L.) Stearn Asplenium antiquum Makino Begonia erythrophylla Hérincq Begonia dregei Otto & Dietr. Handroanthus chrysotrichus (Mart. ex DC.) Mattos Jacaranda acutifolia Bonpl. Bixaceae Bixa orellana L. Bromeliaceae Burseraceae Cactaceae Campanulaceae Combretaceae Commelinaceae Costaceae Cyatheaceae Cyperaceae Euphorbiaceae Tillandsia cyanea Linden ex K.Koch Boswellia sacra Flueck. Canarium album (Lour.) DC. Epiphyllum oxypetalum (DC.) Haw. Hylocereus undatus (Haw.) Britton & Rose Hippobroma longiflora (L.) G.Don Asparagus sprengeri Regel Urginea maritima (L.) Baker Tabebuia chrysotricha (Mart. ex DC.) Standl. Boswellia carteri Birdw. Combretum indicum (L.) DeFilipps Quisqualis indica L. Terminalia catappa L. Dichorisandra thyrsiflora J.C.Mikan Costus spicatus (Jacq.) Sw. Cyathea lepifera (J. Sm. ex Hook.) Copel. Cyperus alternifolius L. Cyperus papyrus L. Acalypha wilkesiana Müll.Arg. Codiaeum variegatum (L.) Rumph. ex A.Juss. Croton tiglium L. Euphorbia milii var. splendens (Bojer ex Hook.) Ursch & Leandri Jatropha curcas L. Codiaeum variegatum var. pictum (Lodd.) Müll.Arg. Hypoxidaceae Molineria capitulata (Lour.) Herb. Curculigo capitulata (Lour.) Kuntze Iridaceae Trimezia spathata (Klatt) Baker Cypella coriifolia Baker Lamiaceae Salvia cacaliifolia Benth. Salvia discolor Kunth Salvia elegans Vahl 161
6 박종철. 도쿄온실식물원의열대및아열대약용식물 Lauraceae Leguminosae Lythraceae Malvaceae Menispermaceae Moraceae Salvia farinacea Benth. Salvia macrophylla Benth. Cinnamomum burmanni (Nees & T.Nees) Blume Cinnamomum daphnoides Siebold & Zucc. Cinnamomum iners Reinw. ex Blume Cinnamomum verum J.Presl Albizia saman (Jacq.) Merr. Bauhinia japonica Maxim. Caesalpinia pulcherrima (L.) Sw. Derris elliptica (Wall.) Benth. Erythrina variegata L. Hardenbergia violacea (Schneev.) Stearn Indigofera suffruticosa Mill. Leucaena leucocephala (Lam.) de Wit Saraca indica L. Strongylodon macrobotrys A.Gray Tamarindus indica L. Lagerstroemia speciosa (L.) Pers. Lawsonia inermis L. Abelmoschus moschatus Medik. Cola acuminata (P.Beauv.) Schott & Endl. Gossypium barbadense L. Heritiera littoralis Aiton Hibiscus tilliaceus L. Sterculia foetida L. Cinnamomum zeylanicum Blume Erythrina boninensis Tuyama Talipariti glabrum (Matsum. ex Nakai) Fryxell Hibiscus glaber Matsum. ex Nakai Theobroma cacao L. Stephania japonica (Thunb.) Miers Tinospora crispa (L.) Hook.f. & Thomson Antiaris toxicaria Lesch. Artocarpus altilis (Parkinson ex F.A.Zorn) Fosberg Artocarpus heterophyllus Lam. Ficus benghalensis L. Ficus lacor Buch.-Ham. Ficus religiosa L. Musaceae Musa paradisiaca L. Musa sapientum L. Myrtaceae Eugenia uniflora L. Myrtus communis L. Pimenta racemosa (Mill.) J.W.Moore Plinia cauliflora (Mart.) Kausel Eugenia michelii Lam. 162
7 Nepenthaceae Ochnaceae Oleaceae Orchidaceae Passifloraceae Phyllanthaceae Pinaceae Piperaceae Psidium cattleianum Afzel. ex Sabine Syzygium aromaticum (L.) Merr. & L.M.Perry Syzygium cumini (L.) Skeels Syzygium samarangense (Blume) Merr. & L.M.Perry Nepenthes hybrida H.J.Veitch ex Mast. Ochna kirkii Oliv. Ochna serrulata Walp. Jasminum nudiflorum Lindl. Olea europaea L. Vanilla planifolia Jacks. ex Andrews Passiflora citrina J.M.MacDougal Passiflora edulis Sims Sauropus androgynus (L.) Merr. Pinus densiflora Siebold & Zucc. Piper betle L. Piper methysticum G.Forst. Piper nigrum L. Eugenia cumini (L.) Druce Plumbaginaceae Plumbago auriculata Lam. Plumbago capensis Thunb. Poaceae Polygonaceae Primulaceae Proteaceae Rubiaceae Rutaceae Sapotaceae Schisandraceae Chrysopogon zizanioides (L.) Roberty Saccharum officinarum L. Homalocladium platycladum (F.Muell.) L.H.Bailey Lysimachia sikokiana Miq. Macadamia ternifolia F.Muell. Carapichea ipecacuanha (Brot.) L.Andersson Ixora chinensis Lam. Citrus aurantium L. Murraya koenigii (L.) Spreng. Murraya paniculata (L.) Jack Vetiveria zizanioides (L.) Nash Cephaelis ipecacuanha (Brot.) A.Rich. Manilkara zapota (L.) P.Royen Achras zapota L. Pouteria campechiana (Kunth) Baehni Synsepalum dulcificum (Schumach. & Thonn.) Daniell Illicium lanceolatum A.C. Sm. Simaroubaceae Quassia amara L. Smilacaceae Solanaceae Smilax glabra Roxb. Brugmansia candida Pers. Lucuma nervosa A.DC. Pouteria dulcifica (Schumach. & Thonn.) Baehni Brugmansia arborea (L.) Steud. Datura arborea L. Brunfelsia americana L. Cestrum aurantiacum Lindl. 163
8 박종철. 도쿄온실식물원의열대및아열대약용식물 Staphyleaceae Taxaceae Verbenaceae Xanthorrhoeaceae Zingiberaceae Cestrum nocturnum L. Iochroma australe Griseb. Nicotiana glauca Graham Turpinia ternata Nakai Taxus cuspidata Siebold & Zucc. Duranta erecta L. Duranta repens L. Phyla scaberrima (Juss. ex Pers.) Moldenke Stachytarpheta cayennensis (Rich.) Vahl Aloe arborescens Mill. Aloe ferox Mill. Dianella ensifolia (L.) DC. Alpinia galanga (L.) Willd. Alpinia nutans (L.) Roscoe Alpinia officinarum Hance Alpinia oxyphylla Miq. Elettaria cardamomum (L.) Maton Hedychium horsfieldii R.Br. ex Wall. Kaempferia galanga L. Lippia dulcis Trevir. Stachytarpheta dichotoma (Ruiz & Pav.) Vahl Brachychilum horsfieldii (R.Br. ex Wall.) Petersen 호시약과대학약용식물원의온실에서조사한열대및아열대약용식물은 47 과 103 종이다(Fig. 2). 이중가장많이재배되어있는식물의과( 科 ) 명은콩과(Leguminosae) 로서 19 종이다. 다음으로협죽 도과(Apocynaceae) 의 7 종식물, 생강과(Zingiberaceae) 의 6 종식물그리고뽕나무과(Moraceae) 의 5 종식물이그뒤를잇고있다. 콩과(Leguminosae) 식물은 Acacia decurrens Willd., A. senegal (L.) Willd., Adenanthera pavonina L., Albizia lebbeck (L.) Benth., Albizia saman (Jacq.) Merr., Archidendron jiringa (Jack) I.C.Nielsen, Archidendron pauciflorum (Benth.) I.C.Nielsen, Castanospermum australe A.Cunn. & C.Fraser, Dalbergia latifolia Roxb., Dalbergia odorifera T.C.Chen, Delonix regia (Hook.) Raf., Derris elliptica (Wall.) Benth., Leucaena leucocephala (Lam.) de Wit, Parkia speciosa Hassk., Peltophorum pterocarpum (DC.) K.Heyne, Pterocarpus indicus Willd., Saraca indica L., Tamarindus indica L., Uraria crinita (L.) DC. 이다. 이식물원온실에서 조사한식물을속( 屬 ) 별로분류하면알로에속( Aloe), 녹나무속 (Cinnamomum), 무화과나무속 (Ficus), 후추속 (Piper), Strophanthus 속식물이모두 3 종씩분포하고있다(Table 3). 164
9 Fig. 2. Some medicinal plants in the greenhouse of Medicinal Plant Garden of Hoshi University 1 Aquilaria sinensis (Lour.) Spreng., 2 Cinchona pubescens Vahl (=Cinchona succirubra Pav. ex Klotzsch), 3 Cinnamomum verum J.Presl (=Cinnamomum zeylanicum Blume), 4 Dalbergia latifolia Roxb., 5 Dalbergia odorifera T.C.Chen, 6 Pterocarpus indicus Willd. Table 3. List of 103 medicinal plants in the greenhouse of Medicinal Plant Garden of Hoshi University by family name Family name Acanthaceae Achariaceae Scientific name Strobilanthes cusia (Nees) Kuntze Anacardiaceae Mangifera indica L. Annonaceae Apocynaceae Araceae Arecaceae Asparagaceae Aspleniaceae Hydnocarpus anthelminthica Pierre ex Gagnep. Cananga odorata (Lam.) Hook.f. & Thomson Rauvolfia tetraphylla L. Rauvolfia verticillata (Lour.) Baill. Strophanthus divaricatus (Lour.) Hook. & Arn. Strophanthus gratus (Wall. & Hook.) Baill. Strophanthus hispidus DC. Tabernaemontana divaricata (L.) R.Br. ex Roem. & Schult. Thevetia neriifolia Juss. ex Steud. Xanthosoma sagittifolium (L.) Schott Phoenix dactylifera L. Salacca zalacca (Gaertn.) Voss Agave americana L. Drimia maritima (L.) Stearn Rohdea japonica (Thunb.) Roth Asplenium antiquum Makino Synonym written on the name tag in the botanical garden Rauvolfia tomentosa Jacq. Rauvolfia perakensis King & Gamble Ervatamia coronaria (Jacq.) Stapf Salacca edulis Reinw. Urginea scilla Steinh. 165
10 박종철. 도쿄온실식물원의열대및아열대약용식물 Berberidaceae Bignoniaceae Dysosma pleiantha (Hance) Woodson Crescentia cujete L. Parmentiera cereifera Seem. Bixaceae Bixa orellana L. Calophyllaceae Mesua ferrea L. Compositae Convolvulaceae Spathodea campanulata P.Beauv. Cynara scolymus L. Farfugium japonicum (L.) Kitam. Dilleniaceae Dillenia indica L. Ipomoea crassicaulis (Benth.) B.L. Rob. Dioscoreaceae Dioscorea mexicana Scheidw. Dioscorea macrostachya Benth. Dipterocarpaceae Ebenaceae Euphorbiaceae Hopea odorata Roxb. Shorea robusta Gaertn. Diospyros discolor Willd. Jatropha podagrica Hook. Gnetaceae Gnetum gnemon L. Goodeniaceae Hydrangeaceae Iridaceae Lauraceae Leguminosae Scaevola taccada (Gaertn.) Roxb. Dichroa febrifuga Lour. Crocus sativus L. Cypella herbertii (Lindl.) Herb. Cinnamomum burmanni (Nees & T.Nees) Blume Cinnamomum daphnoides Siebold & Zucc. Cinnamomum verum J.Presl Machilus thunbergii Siebold & Zucc. Acacia decurrens Willd. Acacia senegal (L.) Willd. Adenanthera pavonina L. Albizia lebbeck (L.) Benth. Albizia saman (Jacq.) Merr. Archidendron jiringa (Jack) I.C.Nielsen Archidendron pauciflorum (Benth.) I.C.Nielsen Castanospermum australe A.Cunn. & C.Fraser Dalbergia latifolia Roxb. Dalbergia odorifera T.C.Chen Delonix regia (Hook.) Raf. Derris elliptica (Wall.) Benth. Leucaena leucocephala (Lam.) de Wit Diospyros philippensis (Desr.) Gürke Scaevola frutescens var. sericea (Vahl) Merr. Cinnamomum zeylanicum Blume Samanea saman (Jacq.) Merr. Pithecellobium lobatum Benth. Leucaena glauca Benth. 166
11 Lythraceae Parkia speciosa Hassk. Peltophorum pterocarpum (DC.) K.Heyne Pterocarpus indicus Willd. Saraca indica L. Tamarindus indica L. Uraria crinita (L.) DC. Lagerstroemia speciosa (L.) Pers. Magnoliaceae Magnolia champaca (L.) Baill. ex Pierre Michelia champaca L. Malvaceae Marantaceae Menispermaceae Moraceae Myrtaceae Nephrolepidaceae Ceiba pentandra (L.) Gaertn. Durio zibethinus L. Theobroma cacao L. Thaumatococcus daniellii (Benn.) Benth. Tinospora crispa (L.) Hook. f. & Thomson Artocarpus altilis (Parkinson ex F.A.Zorn) Fosberg Artocarpus heterophyllus Lam. Ficus natalensis subsp. leprieurii (Miq.) C.C.Berg Ficus religiosa L. Ficus subpisocarpa Gagnep. Melaleuca leucadendra (L.) L. Syzygium aromaticum (L.) Merr. & L.M.Perry Nephrolepis auriculata Trimen Oxalidaceae Averrhoa carambola L. Phyllanthaceae Phyllanthus emblica L. Piperaceae Polygonaceae Rubiaceae Sapindaceae Sapotaceae Solanaceae Staphyleaceae Piper methysticum G.Forst. Piper retrofractum Vahl Piper sarmentosum Roxb. Antigonon leptopus Hook. & Arn. Coccoloba uvifera (L.) L. Carapichea ipecacuanha (Brot.) L.Andersson Cinchona pubescens Vahl Morinda citrifolia L. Litchi chinensis Sonn. Ficus triangularis Warb. Ficus superba var. japonica Miq. Cephaelis ipecacuanha (Brot.) A.Rich. Cinchona succirubra Pav. ex Klotzsch Manilkara zapota (L.) P.Royen Achras zapota L. Pouteria campechiana (Kunth) Baehni Brunfelsia australis Benth. Turpinia ternata Nakai 167
12 박종철. 도쿄온실식물원의열대및아열대약용식물 Thymelaeaceae Aquilaria sinensis (Lour.) Spreng. Aloe africana Mill. Xanthorrhoeaceae Aloe ferox Mill. Aloe vera (L.) Burm.f. Alpinia oxyphylla Miq. Elettaria cardamomum (L.) Maton Etlingera elatior (Jack) R.M.Sm. Zingiberaceae Hedychium coronarium J.Koenig Zingiber montanum (J.Koenig) Link ex A.Dietr. Zingiber spectabile Griff. Zygophyllaceae Guaiacum officinale L. Nicolaia elatior (Jack) Horan. Zingiber cassumunar Roxb. 유메노시마열대식물관의온실에서 31 과 56 종의열대및아열대약용식물을조사했다(Fig. 3). 많이 분포하는과( 科 ) 명은종려과(Arecaceae) 와뽕나무과(Moraceae) 식물로서각 5 종씩자라고있으며, 꽃양하속 (Alpinia ) 식물은 3 종이재배되고있다(Table 4). 이들전체의약용식물사진은저자의연구실 에증거사진으로보관중이다. Fig. 3. Some medicinal plants in the Yumenoshima Tropical Greenhouse Dome 1 Areca catechu L., 2 Pandanus boninensis Warb., 3 Combretum indicum (L.) DeFilipps (=Quisqualis indica L.), 4 Stachytarpheta jamaicensis (L.) Vahl, 5 Syzygium samarangense (Blume) Merr. & L.M.Perry, 6 Vanilla mexicana Mill. 168
13 Table 4. List of 56 medicinal plants in the Yumenoshima Tropical Greenhouse Dome by family name Family name Amaryllidaceae Anacardiaceae Mangifera indica L. Arecaceae Scientific name Eucharis grandiflora Planch. & Linden Areca catechu L. Chamaedorea metallica O.F.Cook ex H.E.Moore Licuala grandis H.Wendl. Livistona chinensis (Jacq.) R.Br. ex Mart. Rhapis humilis Blume Aspleniaceae Asplenium nidus L. Bromeliaceae Celastraceae Combretaceae Dipterocarpaceae Euphorbiaceae Heliconiaceae Lamiaceae Lauraceae Leguminosae Malvaceae Moraceae Myrtaceae Nyctaginaceae Ananas comosus (L.) Merr. Euonymus boninensis Koidz. Synonym written on the name tag in the botanical garden Combretum indicum (L.) DeFilipps Quisqualis indica L. Terminalia catappa L. Shorea robusta Gaertn. Hevea brasiliensis (Willd. ex A.Juss.) Müll.Arg. Heliconia bihai (L.) L. Heliconia psittacorum L.f. Karomia tettensis (Klotzsch) R.Fern. Cinnamomum tenuifolium (Makino) Sugim. Machilus kobu Maxim. Neolitsea gilva Koidz. Albizia lebbeck (L.) Benth. Saraca indica L. Malvaviscus arboreus Cav. Pachira aquatica Aubl. Theobroma cacao L. Artocarpus altilis (Parkinson ex F.A.Zorn) Fosberg Artocarpus heterophyllus Lam. Ficus nishimurae Koidz. Ficus religiosa L. Morus boninensis Koidz. Rhodomyrtus tomentosa (Aiton) Hassk. Syzygium buxifolium Hook. & Arn. Syzygium samarangense (Blume) Merr. & L.M.Perry Pisonia grandis R.Br. Holmskioldia tettensis (Klotzsch) Vatke Cinnamomum brevifolium Miq. 169
14 박종철. 도쿄온실식물원의열대및아열대약용식물 Orchidaceae Dendrobium bigibbum Lindl. Vanilla mexicana Mill. Oxalidaceae Averrhoa carambola L. Pandanaceae Pittosporaceae Plumbaginaceae Poaceae Primulaceae Rosaceae Rubiaceae Rutaceae Sapotaceae Strelitziaceae Verbenaceae Zingiberaceae Pandanus boninensis Warb. Pittosporum beecheyi Tuyama Pittosporum boninense Koidz. Plumbago auriculata Lam. Bambusa vulgaris Schrad. Dendrocalamus giganteus Munro Ardisia elliptica Thunb. Osteomeles schwerinae C.K.Schneid. Rhaphiolepis indica var. umbellata (Thunb.) H.Ohashi Ixora chinensis Lam. Tarenna subsessilis (A.Gray) Ito Murraya paniculata (L.) Jack Manilkara zapota (L.) P.Royen Ravenala madagascariensis Sonn. Stachytarpheta jamaicensis (L.) Vahl Alpinia bilamellata Makino Alpinia oxyphylla Miq. Alpinia zerumbet (Pers.) B.L.Burtt & R.M.Sm. Etlingera elatior (Jack) R.M.Sm. Dendrobium phalaenopsis Fitzg. Bambusa vulgaris var. striata (Lodd. ex Lindl.) Gamble Osteomeles boninensis (Decne.) Nakai Rhaphiolepis wrightiana Maxim. 결론 도쿄도에소재하는도쿄도약용식물원온실, 호시약과대학약초원온실및유메노시마열대식물관 온실에서각 58 과 152 종, 47 과 103 종및 31 과 56 종의약용식물을조사했다. 도쿄도약용식물원의 온실에서가장많이분포하는식물의과명은협죽도과(Apocynaceae) 이며다음으로콩과 (Leguminosae), 아욱과(Malvaceae), 도금양과(Myrtaceae), 가지과(Solanaceae), 생강과 (Zingiberaceae), 뽕나무과(Moraceae) 순이었다. 속( 屬 ) 은배암차즈기속( Salvia), 꽃양하속 (Alpinia), 녹나무속 (Cinnamomum), 무화과나무속(Ficus), 후추속 (Piper), Syzygium 속순으로자라고있다. 호 시약과대학약용식물원의온실에서가장많이자라는식물의과명은콩과(Leguminosae), 협죽도과 (Apocynaceae), 생강과(Zingiberaceae), 뽕나무과(Moraceae) 의순이며, 속( 屬 ) 으로는알로에속( Aloe), 녹나무속 (Cinnamomum), 무화과나무속 (Ficus), 후추속 (Piper), Strophanthus 속순으로자라고있다. 유메노시마열대식물관의온실에서많이분포하는식물은종려과(Arecaceae) 와뽕나무과(Moraceae) 이며꽃양하속 (Alpinia) 식물도 3 종이분포하고있다. 170
15 감사의글 자료정리를위해수고해준남민우학부생( 순천대), 박성민前연구보조원( 순천대한의약연구소) 에 게감사드린다. 참고문헌 1. Tokyo Metropolitan Medicinal Plants Garden. Published on the Internet; iken.go.jp/lb_iyaku/plant (accessed ). 2. Medicinal Plant Garden of Hoshi University. Published on the Internet; shi.ac.jp/yakusoen_new/index.html (accessed ). 3. Yumenoshima Tropical Greenhouse Dome. Published on the Internet; ma.jp (accessed ). 4. The Plant List (2013). Version 1.1. Published on the Internet; (ac cessed ). 5. The International Plant Names Index (2012). Published on the Internet; (accessed ). 6. 국립수목원. 국가표준식물목록. Published on the Internet; x.do (accessed ). c The Author(s) 2018, khmi.or.kr 171
인도네시아 보고르와 반둥 지역의 약용식물 조사 연구
韓藥情報硏究會誌 (Korean Herb. Med. Inf.) 2018;6(2):145-156. pissn 2288-5161 / eissn 2288-5293 인도네시아보고르와반둥지역의약용식물조사연구 박종철교수 국립순천대학교생명산업과학대학한약자원개발학과및순천대한의약연구소 Study on Medicinal Plants of 3 Botanical Gardens in
More information도감본문(수정)~10p
두번째이야기 덩굴나무 두번째이야기덩굴나무 6 00 Pinus densiflora Siebold & Zucc. 4 5 6 6 5 4 7 8 9 P. densiflora P. densiflora for. multicaulis P. densiflora for. erecta 0 6 산에서자주만나는큰키나무 덩굴나무 8 산에서자주만나는큰키나무 덩굴나무 덩굴나무차례 9
More information13-ºÎ·Ï¸ðÀ½-0312
Pinus thunbergii Parlatore Abies holophylla Maximowicz Pinus densiflora Siebold et Zuccarini Juniperus chinesis Linnaeus Pinus densiflora for. erecta Uyeki Juglans mandshurica Maximowicz Ginkgo biloba
More information함동호외. 한반도난온대지역전남대학교내한약자원및상록활엽식물 최근우리나라는한약자원의해외의존도를줄이기위해대량증식을목적으로하는몇몇기초조사형태의연구가활발히진행중에있다 3). 또한전세계적으로각국가마다생물자원을환경생태보호의목적뿐만아니라산업적인목적으로적극적으로조사및관리하는추세에있다
한반도난온대지역전남대학교내한약자원및상록활엽식물 함동호 1, 김원호 1, 이지윤 1, 이준성 1, 한은경 2, 조원범 2, 이정현 2* 1. 전남대학교과학영재교육원 2. 전남대학교사범대학생물교육과 The medicinal and evergreen broad leaved plants in Chonnam national university on warm-temperate
More information358051_마상_식물상_종목록.xlsx
2014년전국자연환경조사-식물-고성철과명출현종영문한글학명국명 특이사항 도엽명 SOLANACEAE 가지과 Solanum nigrum var. nigrum L. 까마중 마상 (358051) RHAMNACEAE 갈매나무과 Rhamnus yoshinoi Makino 짝자래나무 마상 (358051) EBENACEAE 감나무과 Diospyros lotus L. 고욤나무
More information소비형태보고서.PDF
A0063-65610-57-0109 A Study on the Consumption Pattern and Pricing Structure of Major Oriental Medicines in Korea 2001. 5 : . 2001. 5. : : ( ) : ( ) : ( ) : ( ) : ( ) : ( ) : ( ) : ( ) : ( ) : ( ) : (
More informationBMYIHXZUOVDO.xls
1 좌사일대의식물 좌사일대의식물 - 154.5고지 - 도재화 국립환경과학원 김용현 경원대학교 요약 1 조사지역내에자생하는관속식물은 34목 63 과, 142 속, 139 종, 24 변종, 1 품종, 1잡 종의총 168 분류군으로나타났다. 2 식물구계학적특정식물종 IV등급종은비진도콩 1 분류군, III등급종까마귀쪽나무등 6 분류군, II등급종층꽃나무등 1 분류군,
More information7(3)-03.fm
w» wz, 7«3y(2005) Korean Journal of Agricultural and Forest Meteorology, Vol. 7, No. 3, (2005), pp. 201~210 ½ 1 Á v 2 Á 2 Á 1 Á Ÿ 1 Á½ y 2 1 w ù, 2 w w (2005 2 15 ; 2005 8 19 ) The Vegetation Structure
More information2(2): 87~97, JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN Flora around Gudeok Campsite, Busan Metropolitan City, Korea Yo
2(2): 87~97, 2016. 12. JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN 2465-8146 Flora around Gudeok Campsite, Busan Metropolitan City, Korea You, Ju-Han ABSTRACT 국문초록 Corresponding author: You,
More information268-278 (037 김진숙).fm
생 약 학 회 지 Kor. J. Pharmacogn. 46(3) : 268 278 (20) 베트남 약용식물의 최종당화산물 생성저해활성 검색(XIV) 최소진 김영숙 김주환 2 Tran The Bach 3 김진숙 * 한국한의학연구원 한의약융합연구부, 2 가천대학교 생명과학과, 3 베트남과학기술원 생태생물자원연구소 식물학과 Screening of Herbal Medicines
More informationuntitled
11-1400119-000205-01 THE FOREST EDUCATION PROGRAM THE FOREST EDUCATION PROGRAM 93520 9 788997 450602 ISBN 978-89-97450-60-2 THE FOREST EDUCATION PROGRAM 20149 031-540-2000 415 aplan Tomorrow FOUR SEASONS
More information발간등록번호
-1-03 소나무[松] 옛 기술 및 지혜 중국의 대표적 고대 농서인 ꡔ민요술ꡕ이나 ꡔ농상집요ꡕ에 소나무의 재배생산에 관한 기술이 소개되어 있으나 을 위한 껍질이나 솔잎에 관한 내용은 보이질 않는다. 우리나라의 고대 서에는 곡이나 방의 재료로서 소나무에 대한 처방이 1) 격적으로 나타난다. 최초의 방 문헌인 ꡔ충주촬요ꡕ(1541) 에는 오늘날 절간 의 중들은
More information이웅빈 A Flora of Mt. Umyeon Department of Biological Science, Yongin University Mt. Umyeon is located between Seocho-gu in Seoul and Gwacheon-si in Gyeo
이웅빈 A Flora of Mt. Umyeon Department of Biological Science, Yongin University Mt. Umyeon is located between Seocho-gu in Seoul and Gwacheon-si in Gyeonggi-do. The investigated vascular plants consist of
More information< FBDC4B9B05FC1BEB8F1B7CF2E786C73>
목명과명출현종추자 (336021) 도엽특이사항영문한글영문한글학명국명 E1 E2 E5 E6 Selaginellales 부처손목 Selaginellaceae 부처손과 Selaginella involvens 바위손 Ophioglossales 고사리삼목 Ophioglossaceae 고사리삼과 Botrychium virginianum 늦고사리삼 식물구계학적등급 (Ⅰ)
More information< FBDC4B9B05FC1BEB8F1B7CF2E786C73>
도엽별출현종 _ 통계 - 2012년전국자연환경조사 - 식물 - 손현덕 - 완도 목명과명출현종완도 (346114) 도엽특이사항영문한글영문한글학명국명 E2 Ophioglossales 고사리삼목 Ophioglossaceae 고사리삼과 Botrychium ternatum 고사리삼 Filicales 고사리목 Osmundaceae 고비과 Osmunda japonica
More informationcmt kor 1-20
말레이시아 상용 목재 기계적 성질 종 정지 굴곡 (MPa) 탄성 계수 파열 계수 미국 적색 단풍 9,790 미국 서부 헴록 압축 강도 (MPa) 전단 강도 (MPa) 결과 수직 방향 결 방향 54 3.6 17 7.5 8,200 76 4.7 43 5.6 미국 떡갈나무 8,620 101 9.1 48 51 13.5 발라우 20,100 142 9.8 76 15.0
More information< FBDC4B9B05FC1BEB8F1B7CF2E786C73>
도엽별출현종 _ 통계 - 2012 년전국자연환경조사 - 식물 - 이두범 - 경주 목명과명출현종경주 (359014) 도엽특이사항영문한글영문한글학명국명 E7 Selaginellales 부처손목 Selaginellaceae 부처손과 Selaginella tamariscina 부처손 Equisetales 속새목 Equisetaceae 속새과 Equisetum arvense
More information정규영 서정수 * 박명순 이선희 최하나 정수영 Flora of Vascular Plants on Mt. Kookmang(Chungju, Chungbuk) School of Bioresource Science, Andong National University *The K
정규영 서정수 * 박명순 이선희 최하나 정수영 Flora of Vascular Plants on Mt. Kookmang(Chungju, Chungbuk) School of Bioresource Science, Andong National University *The Korean Association for Conservation of Nature This survey
More information유주한 홍광표 : 부산광역시 해운정사의 조경식물과 식재특성 분석 Ⅰ. 서론 우리나라의 사찰은 산지, 마을, 도심 등 다양한 지역에 위치 하고, 이 중 전통사찰은 불상 등 불교 신앙의 대상을 봉안하고 승려의 수행활동, 신도 교화를 위한 건립, 축조된 건조물로 경 내지,
1(2): 96~104, 2015. 12. JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN 2465-8146 Analysis on Planting Characteristics and Landscape Plants in Haeunjeongsa Temple, Busan Metropolitan City You, Ju-Han
More informationμ μ μ matk_193f trnk_670f matk_520r matk_1246r rbcl accd matk matk trnk (5 ) trnk (3 ) trnk_670f CTGTATCGCACTATGTATC matk_193f GTTATTCGAATGTATCAACAG matk_520r CTCATGCTTGCATTTATTACG matk_1246r CTTTCTCATTATTACAGCGG
More informationfm
Vascular plant diversity and vegetation of Yokjido Island 97 Appendix 1. List of vascular plants investigated on Yokjido Island. Taxa / Collection number Selaginellaceae 부처손과 1. Selaginella rossii (Baker)
More information중국 신장위구르자치구, 간쑤성, 산시성의 약용식물 조사 연구
중국신장위구르자치구, 간쑤성, 산시성의약용식물조사연구 박종철교수 국립순천대학교생명산업과학대학한약자원개발학과및순천대한의약연구소 Study on Medicinal Plants of Xinjiang Uyghur Autonomous Region, Gansu Province and Shaanxi Province in China Park, Jong Cheol Department
More information<C3D6C1BEBAB8B0EDBCAD5FC7A5C1F62E687770>
훼손된 자연생태계 복원기술 Restoration Technology of Damaged Ecosystem 도시녹지공간의 생태 corridor 설계기법 Development of Design Technology for the Eco-corridor in Urban Area 고려대학교 환 경 부 보고서 초록 연구과제명 코드번호 (국문) 도시녹지공간의 생태 corridor
More information401.fm
Journal of Korean Nature Vol. 3, No. 4 199-211, 2010 Classification Type of Vascular Plants in Yeohangsan, Muhaksan and Palyongsan, Masan Hyun-Kyung Oh 1 *, Hyun-Mi Kang 2 and Song-Hyun Choi 2 1 Department
More information외떡잎식물 Monocotyledoneae
외떡잎식물 Monocotyledoneae 8 붓과 Iridaceae 등심붓 S E Sisyrinchium angustifolium Mill. Blue-eyed Grass 80 열매 높이 0~0cm 원산지 북아메리카 개화기 4~6월 결실기 5~7월 분포 제주도 다년생. 줄기는 모여나며 좁은 날개가 있다. 잎은 선형으 로 칼 모양이다. 은 지름 cm 내외이며 청자색이고
More information조경식물학 - 활엽수 계열(2) -
조경식물학 - 상록활엽수외 - 1. 녹나무 내한성 : 약함 음양성 : 중용수 녹나무 Cinnamomum camphora 성상 : 상록활엽교목 수형 : 타원형 분포 : 난온대지역 이식 : 어려움 번식 : 실생 / 삽목 대기정화능력우수, 환경정화수 기조, 녹음, 가로수, 방풍, 방화식재 2. 생달나무 내한성 : 약함 음양성 : 음수 생달나무 Cinnamomum
More information슬라이드 1
십자화과 Cruciferae 겨자 Brassica juncea 중국원산, 종자를개자 흑겨자 (sinigrin), 백겨자 (sinalbin) 자극성의 allylisothiocyanate 함유 피부자극제, 신경통, 토제, 향신료 H 2 C C H H 2 C C sinigrin S N Glc myrosinase S 3 K H 2 H 2 C C C N C S H allylisothiocyanate
More informationDBPIA-NURIMEDIA
Korean J. Plant Res. 27(2):133-154(2014) http://dx.doi.org/10.7732/kjpr.2014.27.2.133 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article 여서도의관속식물상 김선유 1, 윤종학 2, 김진석 1, 김중현 1 * 1 국립생물자원관식물자원과,
More information[00]_목차.hwp
Korean J. Plant Res. 27(5):518-533(2014) http://dx.doi.org/10.7732/kjpr.2014.27.5.518 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article 장창석 1, 양선규 1, 장현도 1, 이로영 2, 박민수 3, 김기홍 1, 오병운
More information도엽별출현종 _ 통계 년전국자연환경조사 - 식물 - 박재홍 - 남원 목명과명출현종남원 (357102) 도엽특이사항영문한글영문한글학명국명 E2 SELAGINELLALES 부처손목 SELAGINELLACEAE 부처손과 Selaginella involvens 바
도엽별출현종 _ 통계 - 2013 년전국자연환경조사 - 식물 - 박재홍 - 남원 목명과명출현종남원 (357102) 도엽특이사항영문한글영문한글학명국명 E2 SELAGINELLALES 부처손목 SELAGINELLACEAE 부처손과 Selaginella involvens 바위손 식물구계학적등급 (Ⅲ) OPHIOGLOSSALES 고사리삼목 OPHIOGLOSSACEAE
More information<30322E20BABBB9AEC0FCC3BC2E687770>
Korean Journal of Environmental Agriculture Korean J Environ Agric. 2014;33(2):86-102. Korean Online ISSN: 2233-4173 Published online 2014 June 17. http://dx.doi.org/10.5338/kjea.2014.33.2.86 Print ISSN:
More information17(2)-08.fm
ª Ÿ (Korean J. Medicinal Crop Sci.) 17(2) : 125 132 (2009) ù k p ¼ÁÁÁkÁÁÁ½y w ww Ecological Characteristics of the Asparagus cochinchinensis (Lour.) Merr. Population in South Korea Byung Kil Choo, Yunui
More information< FBDC4B9B05FC1BEB8F1B7CF2E786C73>
도엽별출현종 _ 통계 - 2012년전국자연환경조사 - 식물 - 안진갑 - 진도 목명과명출현종진도 (346101) 도엽특이사항영문한글영문한글학명국명 E2 Selaginellales 부처손목 Selaginellaceae 부처손과 Selaginella tamariscina 부처손 Ophioglossales 고사리삼목 Ophioglossaceae 고사리삼과 Botrychium
More information<30322D31312DB1E8B8EDC7F BFCFB7E1295F E31C4AEB6F328BFCF292E687770>
Korean Journal of Environmental Agriculture Korean J Environ Agric. 2015;34(2):77-90. Korean Online ISSN: 2233-4173 Published online 2015 March 23. http://dx.doi.org/10.5338/kjea.2015.34.2.11 Print ISSN:
More information< FBDC4B9B05FC1BEB8F1B7CF2E786C73>
도엽별출현종 _ 통계 - 2012년전국자연환경조사 - 식물 - 심정기 - 도곡 목명과명출현종도곡 (377162) 도엽특이사항영문한글영문한글학명국명 E1 E2 E4 E5 Equisetales 속새목 Equisetaceae 속새과 Equisetum arvense 쇠뜨기 Filicales 고사리목 Aspleniaceae 꼬리고사리과 Athyrium iseanum
More information(044 김진숙).fm
생약학회지 Kor. J. Pharmacogn. 45(4) : 354 358 (2014) 한국약용식물추출물의알도즈환원효소억제효능검색 (IX) 최소진 1 김영숙 1 김주환 2 김진숙 1 * 1 한국한의학연구원한약연구본부한의신약연구그룹, 2 가천대학교생명과학과 Screening of Korean Herbal Medicines with Inhibitory Effect
More information2_11_24 김준수.hwp
농업생명과학연구 45(3) pp.9-18 Journal of Agriculture & Life Science 45(3) pp.9-18 비룡산 신갈나무림의 식물 다양성 김준수 1 홍진기 1 김경수 1 조용찬 2 배관호 3* 1 경북대학교 과학기술대학원 산림환경자원학과, 2 국립수목원, 3 경북대학교 생태환경시스템학부 접수일(2011년 03월 04일), 수정일(2011년
More information< D FBDC3C7E8BFACB1B8BAB8B0EDBCAD E687770>
어젠다코드 1-7 - 22 구 분 세부완결 기술분야코드 V1 기술유형코드 S04 작목구분코드 PG-03-PG31 과제종류 기관고유 세세부사업 - 연구과제및세부과제 수행기간 과제책임자및세부책임자 자생식물자원화기반구축 09~ 13 농식품연구소 김희연 식물기원추출물은행및생리활성 library 작성 09~ 13 농식품연구소 김희연 색인용어 자원식물, 추출물 ABSTRACT
More information3(1): 21~33, JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN Vascular Plants around Tongdosa(Temple) in Gajisan Provincial Pa
3(1): 21~33, 2017. 6. JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN 2465-8146 Vascular Plants around Tongdosa(Temple) in Gajisan Provincial Park Oh, Hyun-Kyung* Choi, Yoon-Ho** You, Ju-Han*** ABSTRACT
More information<38392D B1E8BBF3C5C22E666D>
한국자연보호학회지, 제 10 권제 2 호 (2016) Korean Journal of Nature Conservation Vol. 10, No. 2, pp. 89-100 ISSN (Pring) 1976-6769 ISSN (Online) 2287-8122 https://doi.org/10.11624/kjnc.2016.10.2.089 DNA 보존을위한 FTA 카드의관속식물분류군별적용성조사
More informationA Study on the Flora of 15 Islands in the Western Sea of Jeollanamdo Province, Korea
Journal of Asia-Pacific Biodiversity Vol. 6, No. 2 281-310, 2013 http://dx.doi.org/10.7229/jkn.2013.6.2.281 A Study on the Flora of 15 Islands in the Western Sea of Jeollanamdo Province, Korea Hee-Suk
More informationhwp
습지유형분류및기능평가의배경 / 목적 이론적고찰 습지의개념및정의습지지표습지의생성및발달 습지의유형및특성습지의기능, 이용습지의관리및복원 물영아리오름습지의유형분류기능평가 유형분류기능평가 HGM 습지분류체계 람사습지분류체계 습지분류의재구성 물영아리오름습지유형분류 기능평가모델구축 평가변수 / 지표설정 현장조사 물영아리오름습지평가항목별평가 관리전략기본방향설정 *
More information09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
More information박선주.fm
자연보존 173 : 22-33 ; 2016 년 5 월 운문산생태 경관보전지역의특정식물및귀화식물연구 1) 박선주 송임근 2) 영남대학교생명과학과 서론 운문산은가지산 (1,240 m), 천황산 (1,189 m), 재약산 (1,108 m) 등과더불어해발 1,000 m 이상의고봉에둘러싸여있고, 영남의 7산중의하나이며, 경상남 북도의경계를이루는성현산맥 ( 省峴山脈 )
More information천연물로부터티로시나제활성억제물질외탐색 457 lin \ tyrosinase 당쇄수식에의한성숙과정의저해 (glucosamin, tunicamycin) 이. 세포득성 (hydroquinone 등각종 phenol, catechol 유도체 ) 파^작용으로대별된다. 이처럼 me
약학회지제 41 권제 4 호 456~461(1997) Yakhak Hoeji Vol. 41. No. 4 고등식물로부터퍼부엘라닌생성에관여하는티로시나제활성억제물질의탐색 이승호 * 박지수 김소영 김진준 정시련 영남대학교약학대학 (Received Ju ly 15, 1997) T h e S c r e e n i n g o f t h e I n h i b i t o r
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information01-Megascolex(dh)
Journal of Species Research 2(2):203-222, 2013 A floristic study of Donggeom-do (Isl.), Ganghwa-gun, Korea Sun-Yu Kim, Byoung Yoon Lee and Jung-Hyun Kim* Division of Plant Resources, National Institute
More information조경식재학 - 식재재료(2) -
조경식재설계 2 - 조경식물 ( 목본 )- 1. 자작나무 음양성 : 양수 건습성 : 건조 자작나무 Betula platyphylla var. japonica 번식 : 실생, 삽목 성상 : 낙엽활엽교목 수형 : 원추형 백색의수피, 황색단풍 강조, 유도, 차폐, 녹음식재 2. 서어나무 음양성 : 음수 생장속도 : 중간 건습성 : 건조 서어나무 Carpinus laxiflora
More informationfm
Floristic study of Jogyesan Mt. 339 Appendix 1. List of vascular plants distributed in Jogyesan Mt. Lycopodiaceae 석송과 Huperzia serrata (Thunb.) Trevis. 뱀톱 P 150635 Equisetaceae 속새과 Equisetum arvense L.
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More information고당질 특수미 활용 식미 증진 연구
천연물질산업화기술개발 신물질연구소 1) 자생식물표준추출물 D/B 구축 Key word : tyrosinase inhibitory activity, whitening effect Melanin은동물, 식물및미생물에널리존재하는페놀성화합물로자외선, 건조, 극한온동등에대한생존능력을높여주지만, 과도한 melanin 생성은인체에기미, 주근깨, 검버섯을형성하는역할을하기도한다.
More informationuntitled
CNIC94-01 1 行 94 年 1 1 94 年 12 31 95 年 02 27 1 老 行 不 利 酪 力 DPPH TEAC 利 MPA580 料 行 類 參 年 量 利 領 歷 理 來 易 度 易 理 來 更 力 了 歷 數 更 年 更 爲 便 更 2 老 留 識 流 列 流 識 來 來 陸 Hu, G. (Chrysanthemum ramat) (Crocus sativus L)
More information<30342E20B1E8C7F6BFEC2C20B1E8C8A3C1D82C20B9DABFB5C8B82E687770>
교통사고환자에서의외상후스트레스장애에대한문헌고찰 東醫寶鑑을중심으로 Review of Post Traumatic Stress Disorder(PTSD) Symptoms in Traffic Accident Patients. Hyun-Woo Kim, O.M.D., Ho-Jun Kim, O.M.D., Young-Hoi Park, O.M.D., Dong-Ho Keum,
More information12이문규
Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental
More informationuntitled
CANCER PREVENTION RESEARCH ORIGINAL ARTICLE 우리나라자생민속식물의항산화효과와위암에대한보호효과 1 부산대학교식품영양학과및노인생활환경연구소, 2 중앙대학교식물시스템과학과, 3 국립수목원산림자원보존과 최지명 1 ㆍ최지연 1 ㆍ김혜민 2 ㆍ최경 3 ㆍ구자정 3 ㆍ박광우 3 ㆍ이상현 2 ㆍ조은주 1 Antioxidative Activity
More informationSW 2015. 02 5-1 89
SW 2015. 02 88 SW 2015. 02 5-1 89 SW 2015. 02 5-2 5-3 90 SW 2015. 02 5-4 91 SW 2015. 02 5-5 5-6 92 5-7 SW 2015. 02 93 SW 2015. 02 5-8 5-1 94 SW 2015. 02 5-9 95 SW 2015. 02 5-10 5-2 96 SW 2015. 02 5-11
More information1 SW 2015. 02 26
02 1 SW 2015. 02 26 2-1 SW 2015. 02 27 SW 2015. 02 2-1 28 SW 2015. 02 29 2 SW 2015. 02 2-2 30 2-2 SW 2015. 02 31 SW 2015. 02 32 2-3 SW 2015. 02 33 3 SW 2015. 02 2-3 34 2-4 SW 2015. 02 35 4 SW 2015. 02
More information이상훈 심재국 Vegetation of Mt. Yeonin Provincial Park Department of Life Science, Chung-Ang University The forest vegetation of Mt. Yeonin Provincial Park
이상훈 심재국 Vegetation of Mt. Yeonin Provincial Park Department of Life Science, Chung-Ang University The forest vegetation of Mt. Yeonin Provincial Park was surveyed from August 2016 to October 2016. The
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More informationMSYDWHWGQGCB.hwp
욕지일대의식물 욕지일대의식물 - 50고지 - 도재화 국립환경과학원 김용현 경원대학교 요약 조사지역내에자생하는관속식물은 5목 0 과, 6 속, 0 종, 아종, 5변종 8품 종, 총 08 분류군으로나타났다. 환경부지정멸종위기종 II 급식물인고란초와애기등이생육하고있음을확인하였다. 이지역내에서식하는식물구계학적특정식물종은 V 등급종은고란초, 약모밀, 애 기등등 분류군,
More informationfm
Korean endemic plants 283 Appendix 2. List of excluded taxa from KFS (2012) and NIBR (2013). The information is listed as follow; scientific and vernacular names, reference and note. PTERIOPHYTA 양치식물문
More information韓藥情報硏究會誌 (Korean Herb. Med. Inf.) 2019;7(2): pissn / eissn 체코의카렐대학교식물원및프라하시립식물원의약용식물조사 박종철교수 국립순천대학교생명산업과학대학한약자원개발학과및순천대한의
韓藥情報硏究會誌 (Korean Herb. Med. Inf.) 2019;7(2):159-168. pissn 2288-5161 / eissn 2288-5293 체코의카렐대학교식물원및프라하시립식물원의약용식물조사 박종철교수 국립순천대학교생명산업과학대학한약자원개발학과및순천대한의약연구소 Medicinal Plants of Botanical Garden of Charles
More information< FBDC4B9B05FC1BEB8F1B7CF2E786C73>
도엽별출현종 _ 통계 - 2012 년전국자연환경조사 - 식물 - 유기억 - 영월 목명과명출현종영월 (378142) 도엽특이사항영문한글영문한글학명국명 E6 Equisetales 속새목 Equisetaceae 속새과 Equisetum arvense 쇠뜨기 Filicales 고사리목 Dennstaedtiaceae 잔고사리과 Dennstaedtia wilfordii
More information84 Journal of Agriculture & Life Science 47(5) Cheonbu-ri Buk-myeon, while there was the least number of 10 individuals(0.4%) in the newly found habit
농업생명과학연구 47(5) pp.83-94 Journal of Agriculture & Life Science 47(5) pp.83-94 울릉도섬현삼의새로운자생지보고및현지내 외보전전략 김수승 1 강기호 2 강신구 1 신현탁 3 조경호 2 김윤영 2 이명섭 2 양병훈 1* 1 산림청, 2 기청산식물원, 3 국립수목원 접수일 (2013 년 7 월 8 일 ), 수정일
More information< 표지설명 > 한라산에자생하는왕벚나무와이나무의염색체.
연구보고 발 간 등 록 번 연구보고 호 11-01 11-1400377-000436-01 11 01 제주지역 산림유전자원의 수집 및 보존연구 제주지역 산림유전자원의 수집 및 보존연구 김찬수 김수영 변광옥 국립산림과학원 국립산림과학원 KOREA FOREST RESERCH INSTITUTE < 표지설명 > 한라산에자생하는왕벚나무와이나무의염색체. 제주지역산림유전자원의
More information08(김익휘)p fm
Asian J. Turfgrass Sci. 26(1):60~66, 2012 Print ISSN 1229-3253 Research Articles Open Access Asian Journal of Turfgrass Science The Turfgrass Society of Korea 잔디밭잡초바랭이와민들레방제를위한살초활성약용식물의탐색 김대호 강재영 김인섭 전민구
More informationStudy on the Vascular Plants Found in Nearby Island Regions of Ganghwado
Journal of Korean Nature Vol. 3, No. 2 83-101, 2010 Study on the Vascular Plants Found in Nearby Island Regions of Ganghwado You-Mi Lee, Su-Hyun Park, Su-Young Jung, and Jong-Cheol Yang Korea National
More informationMicrosoft PowerPoint - Week1-basics
과목소개및주의사항 주교재식물분류학 계통적접근제 3판박기룡외 8인역도서출판신일사이언스 - Plant Systematics-A Phylogenetic Approach (3rd ed.) Judd et al., Sinauer ( 원서 ) 수업에관련된모든자료는다음웹사이트에게시됨 http://210.125.94.63/~apple/ 게시되어있는 ppt 자료들은항상수업전업데이트되니수업후다시다운받아공부할것.
More informationfm
Korean J. Pl. Taxon. 48(4): 331 356 (2018) https://doi.org/10.11110/kjpt.2018.48.4.331 RESEARCH ARTICLE pissn 1225-8318 eissn 2466-1546 Korean Journal of Plant Taxonomy Floristic study of Jogyesan Mt.
More informationuntitled
1 2 3 4 5 006 009 020 024 028 032 036 040 044 050 056 064 070 086 090 188 192 195 199 202 205 209 212 214 219 102 110 224 6 7 6 008 9 8 9 9 10 10 11 11 12 12 13 13 14 14 15 15 16 16 17 17 18 19 파주 20 1)
More informationMethod Country Vegetation type Reference AA Japan Quercus-mixed Kirita(1971) Japan Quercus-mixed Nakane(1975) CC China glassland Jia et al.(2006) Japan deciduous forest Hirano e tal.(2003) USA hardwood
More information101.fm
Journal of Korean Nature Vol. 3, No. 1 1-10, 2010 Dispersion of Vascular Plant in Mt. Huiyangsan, Korea Hyun-Tak Shin 1, Sung-Tae Yoo 2, Byung-Do Kim 2, and Myung-Hoon YI 3 * 1 Gyeongsangnam-do Forest
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More information고련피 227 A 878 B Melia azedarach Linne 멀구슬나무의나무껍질또는뿌리껍질 고목 31 A 856 B Picrasma quassioides Bennet 소태나무의심재 고본 224 A 582 B Angelica tenuissima Nakai 고본의뿌
한약재명 코드명 ( 효소 ) 코드명 ( 효소 ) 학명 기원식물 가바쌀 844 B 984 A Oryza Sativa L. 벼과인현미를물에불려싹을틔워다시건조 가자 14 A 586 B Terminalia chebula Retzins 가자의잘익은열매 가지 933 B 964 A Solanum melongena L. 쌍떡잎식물통화식물목가지과의한해살이풀 갈근 13 A 865
More informationArctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard by Yoo Kyung Lee, Gyu Lee, Eun Ju Lee 다산과학기지 주변에서 볼 수 있는 북극 식물 Arctic Plants living in N
다산과학기지 주변에서 볼 수 있는북극 식물 Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard 북극식물-본문p001-019(0409).indd 1 2012-04-10 오후 4:36: Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard by Yoo
More information<30302E20B8F1C2F72E666D>
Korean J. Pl. Taxon. 44(3): 222-232 (2014) http://dx.doi.org/10.11110/kjpt.2014.44.3.222 ISSN 1225-8318 Korean Journal of Plant Taxonomy Flora of Sumeunmulbaengdui wetland in Jeju-do, Korea Sung Chul Ko*,
More information04조남훈
Received : 2011. 11. 16 Reviewed : 2011. 11. 25 Accpeted : 2011. 12. 5 A Case Report of Prescribing Yanghyeolgeopung-tang(yangxuequfeng-tang) to Two Patients with Cervical Disc Herniation and Headache
More information1 1 10-0767050 2 10-1166045 3 10-0895586 4- - 10 4 10-1616887 11 5 10-1358259 12 6 10-0775080 7 10-0973839 8 10-1165269 15 9 10-1056952 16 10 10-1551559 11 10-1179175 12 10-1179177 19 13 10-1136822 20
More information1
1 Body,, 1920 1970,, 100, Biosales@biolandkoreacom, wwwbiolandkoreacom 1,, 2,, 2 2 2,,, 2 ( ) ( ),, 2,,,,,,,, Biosales@biolandkoreacom, wwwbiolandkoreacom 2), 3), 4) 5) 10; 13 ( ) 2 10, 20; 30; 30 20 40;
More information<4D F736F F D20C8ADC0E5C7B0BCD2C0E7B7D02E646F63>
제 2 장유성원료 1. 유지류 (Fat and Oil) 유지는기름및지방류를간략화한명칭으로화학구조상지방산 (Fatty Acid) 과 3가알코올인글리세린 (Glycerin) 의에스테르 (Glyceride: 글리세라이드 ) 형태로서화학구조는그림과같습니다. CH 2 CH CH 3 OH OH OH O R C OH 글리세린 : Glycerin 지방산 : Fatty Acid
More informationePapyrus PDF Document
정상철 *, 이은숙 **, 이준원 ***, 김진희 ** 요약 천연물로부터비만치료에효능이있는물질을선별하고자, 우리나라에서민간의약으로사용되어온한국전통약용식물로부터췌장의지질분해효소인리파제 (lipase) 의활성을저해시키는약용식물을탐색하였다. 131 종의전통약용식물로부터 33 종의약용식물추출물들이 in vitro 상에서유의적으로췌장리파제활성을저해시키는효과를나타내었다.
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More information05(김창석)p fm
Weed Turf. Sci. 3(4):284~291 http://dx.doi.org/10.5660/wts.2014.3.4.284 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was renamed from both
More information한실정이며, 초화류생육및식재후관리에관한연구또한옥상녹화, 실내조경등인공토양환경에서의연구가주를이루고있다. 외부공간에서의초화류생육에관한연구로는아파트단지내식재된지피식물의생육환경및관리현황 (Lee, 2006) 과상록성지피식물의이용확대를위한환경조건에따른생육비교 (Kim, 2010
J. Korean Soc. People Plants Environ. Vol. 18 No. 4: 257-263, August 2015 http://dx.doi.org/10.11628/ksppe.2015.18.4.257 ISSN 1226-9778(Print) ISSN 2287-8238(Online) 박은희 정명일 한승원 정나라 김재순 * 국립원예특작과학원원예작물부도시농업연구팀
More information서울大學敎樹木園硏究報告 27: (2009) Bull. Seoul Natl. Univ. Arbor. 27: (2009) 2009 년도중국섬서와사천의식물표본탐사 김휘 1, 임효인 2, 장계선 2, 장진성 2, 전정일 3 1 목포대학교응용생명공학부한
서울大學敎樹木園硏究報告 27: 90-119 (2009) Bull. Seoul Natl. Univ. Arbor. 27: 90-119 (2009) 2009 년도중국섬서와사천의식물표본탐사 김휘 1, 임효인 2, 장계선 2, 장진성 2, 전정일 3 1 목포대학교응용생명공학부한약자원전공, 2 서울대학교농업생명과학대학산림과학부및 수목원, 3 신구대학교원예디자인과 Plant
More information디지털포렌식학회 논문양식
ISSN : 1976-5304 http://www.kdfs.or.kr Virtual Online Game(VOG) 환경에서의 디지털 증거수집 방법 연구 이 흥 복, 정 관 모, 김 선 영 * 대전지방경찰청 Evidence Collection Process According to the Way VOG Configuration Heung-Bok Lee, Kwan-Mo
More information<32B1B32D3320B2C9C2F7BFEB28C7D1BFB5BCF7292E687770>
KOREAN J. FOOD COOKERY SCI. Vol. 27, No. 3 June, 2011 꽃차용꽃추출물의구강위생균에대한항균특성 한영숙 ¹ 강소진 ¹ 박세아 ¹ 이선숙 ² 송희자 ³ ¹ 성신여자대학교식품영양학과, ² 목원대학교건강관리학과, ³ 머루랑다래랑 Antibacterial Activities of Flower Tea Extracts against
More information(056 김진숙).fm
생약학회지 Kor. J. Pharmacogn. 44(4) : 372 378 (2013) 한국약용식물의최종당화산물생성저해활성검색 (XI) 최소진 1 김영숙 1 송유진 1 김주환 2 김진숙 1 * 1 한국한의학연구원한약연구본부한의신약개발그룹, 2 가천대학교생명과학과 Screening of Korean Herbal Medicines with Inhibitory Activity
More information[10_ 최종]JPR15-17(김현준_덕적도(옹진군) 및 인근 도서지역의).hwp
Korean J. Plant Res. 28(4):487-510(2015) http://dx.doi.org/10.7732/kjpr.2015.28.4.487 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article 덕적도 ( 옹진군 ) 및인근도서지역의관속식물상 김현준, 지성진, 정수영, 박수현,
More information세종로 공영주차장 서울특별시 종로구 세종대로 189, 지하주차장 4층 D구역 계단실 앞 (서울특별시 종로구 세종로 80-1, 지하주차장 4층 D구역 계단실 앞) 종묘 공영주차장 서울특별시 종로구 종로 157, 지하주차장 4층 하층 T구역 (서울특별시 종로구 훈정동 1-
전국 급속충전소 위치 및 이용시간 안내 지역 충전소명 위치 충전타입 이용시간 GS칼텍스 삼성로점 서울특별시 강남구 삼성로 563, GS칼텍스 주유소 입구 우측 (서울특별시 강남구 삼성2동 119-18, GS칼텍스 주유소 입구 우측) 개포동공원 공영주차장 서울특별시 강남구 개포로 509, 지하주차장 1층 8구역 (서울특별시 강남구 개포동 183-2, 지하주차장
More information<31335FB1C7B0E6C7CABFDC2E687770>
에너지기후변화교육 4(2):203~211(2014) 203 초등학교 교과서 에너지 단원의 탐구활동과 시각자료 기능 분석 사례 연구 신명경 권경필 * 경인교육대학교 Abstract : This study aimed to analyze energy related inquiry activity and visual materials in elementary textbook.
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More information유기억.fm
54 Jong-Soo Kang, Jun-Soo Han, Kyeong-Sik Cheon, Kyung-Ah Kim,Yong-Ho ark and Ki-ug Yoo Appendix 1. List of vascular plants of t. Hanseok. Scientific name / Korean name / Voucher number Selaginellaceae
More information12.077~081(A12_이종국).fm
J. of Advanced Engineering and Technology Vol. 1, No. 1 (2008) pp. 77-81 y w» e wx Á w œw Fabrication of Ceramic Batch Composition for Porcelain by Using Recycled Waste Ceramic Powder Hyun Guen Han, and
More information韓資植誌 Korean J. Plant Res. 28(4) : 511~525(2015) 소, 기암 10개소, 계곡 4개소, 해변 1개소등 26개소의경관자원이있으며, 공원깃대종은소나무와원앙이다 (Korea National Park Service, 2013). 경주국립공원의
Korean J. Plant Res. 28(4):511-525(2015) http://dx.doi.org/10.7732/kjpr.2015.28.4.511 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article 경주국립공원구미산지구에분포하는관속식물상 유주한 1 *, 권순영 2 1 동국대학교경주캠퍼스조경학과,
More informationKOREA INSTITUTE OF PATENT INFORMATION w w w. k i p i. o r. k r K O R E A I N S T I T U T E O F P A T E N T I N F O R M A T I O N C ONTENTS Patent 21 Patent 21 Patent 21 Patent 21 Patent 21 Patent 21
More information제출문 농림축산식품부장관귀하 이보고서를 허브산업기반활용뷰티산업소재 제품개발및특화산업육성기획 과제의 보고서로제출합니다 년 5 월 16 일 주관연구기관명 :( 주 ) 하이솔 주관연구책임자 : 김광상 세부연구책임자 : 김광상 연 구 원 : 박이경 연 구 원 : 최
제출문 농림축산식품부장관귀하 이보고서를 허브산업기반활용뷰티산업소재 제품개발및특화산업육성기획 과제의 보고서로제출합니다. 2017 년 5 월 16 일 주관연구기관명 :( 주 ) 하이솔 주관연구책임자 : 김광상 세부연구책임자 : 김광상 연 구 원 : 박이경 연 구 원 : 최담선 연 구 원 : 김민숙 연 구 원 : 김민지 협동연구기관명 : ( 재 ) 남원시화장품산업지원센터
More information15(2)-02(문현식).fm
한국농림기상학회지, 제15권 제2호(2013) (pissn 1229-5671, eissn 2288-1859) Korean Journal of Agricultural and Forest Meteorology, Vol. 15, No. 2, (2013), pp. 67~75 DOI: 10.5532/KJAFM.2013.15.2.067 c Author(s) 2013.
More information???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
More information