농업생명과학연구 49(4) pp.65-72 Journal of Agriculture & Life Science 49(4) pp.65-72 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.65 Tomato ringspot virus 검역진단시스템개발 이시원 1 노재영 2 김재헌 2* 1 국립환경과학원환경기반연구부, 2 단국대학교미생물학과 접수일 (2015 년 5 월 14 일 ), 수정일 (2015 년 8 월 10 일 ), 게재확정일 (2015 년 8 월 4 일 ) Development of Diagnostic System for Detecting Tomato ringspot virus in Quarantine Siwon Lee 1 Jae-Young Rho 2 Jae-heon Kim * 1 Environmental Infrastructure Research Department, National Institute of Environmental Research, Incheon 22689, Korea 2 Department of Microbiology, College of Natural Sciences, Dankook University, Cheonan 31116, Korea Received: MAY. 14. 2015, Revised: AUG. 10. 2015, Accepted: AUG. 4. 2015 초록 Tomato ringspot virus (ToRSV) 는 Group IV(+) sense ssrna viruses, Nepovirus 속으로분류되며식물병원성을가진국내미보고관리급검역바이러스이다. 본연구에서는우리나라검역현장에서 ToRSV 를검사하기위한 reverse transctiption(rt)-polymerase chain reaction(pcr) 과 nested PCR 진단시스템을개발하였다. ToRSV 특이적으로진단할수있는 RT-PCR 은프라이머조합 9 (F120/R20, 549 bp) 와조합 31(F60/R80, 741 bp)] 이며, 각각의 nested PCR 결과 439 와 363 bp 를증폭할수있다. 한편, 본연구에서개발한유전자변형 - 양성대조구는실험실오염으로인한거짓양성반응을확인할수있다. 본연구에서개발한 ToRSV 검역진단시스템은향후식물검역에기여할것으로기대된다. 검색어 - 검역, Nested PCR, RT-PCR, Tomato ringspot virus, ToRSV ABSTRACT Tomato ringspot virus(torsv) is a regulated plant quarantine pathogen, belongs to genus Nepovirus, group IV(+) sense ssrna viruses. In this study, reverse transctiption(rt)-polymerase chain reaction(pcr) and nested PCR for diagnostic system of detecting ToRSV is development in quarantine. Two RT-PCR primer pairs[pair 9(F120/R20, 549 bp) and pair 31(F60/R80, 741bp) are selection for detecting ToRSV, and nested PCR products are amplification 439 and 363 bp from RT-PCR primer pair 9 and 31, respectively. In addition, modified-positive control plasmid is development. It is possible to proving laboratory contamination and false positive reactions for detecting ToRSV. The diagnostic system is expected to contributing to detecting ToRSV in plant quarantine. Key words - Nested PCR, Quarantine, RT-PCR, Tomato ringspot virus, ToRSV * Corresponding author: Jae-heon Kim Tel: +82-41-550-3452 Fax: +82-41-550-3450 E-mail: jaehkim1@dankook.ac.kr These authors are equally contributed to this work.
66 Journal of Agriculture & Life Science 49(4) Ⅰ. 서론 Tomato ringspot virus(torsv) 는 Group IV (+) sense ssrna viruses, Nepovirus속으로분류되는식물병원성바이러스로, 북미, 유럽, 아시아, 호주및남아프리카등에서보고되고있다 (Stace-smith, 1994). 유럽지중해식물보호단체 (EPPO) 에따르면 ToRSV는매우넓은기주범위 ( 토마토, 담배, 오이, 동부, 딸기, 나무딸기, 산딸기, 구즈베리, 포도, 복숭아, 체리, 살구속, 건포도, 제라늄, 수국, 글라디올러스및미국물푸레나무등 ) 를가지고있어위험한식물병으로분류하고있다 (OEPP/EPPO, 2005). ToRSV는현재국내미보고바이러스로국내유입시재배농가에직접적및경제적피해가예상되어국내에서도관리급검역바이러스로지정되었다 (Animal, Plant and Fisheries Quarantine and Inspection Agency, 2013). 국내검역현장에서는 ToRSV를진단하기위해 enzyme-linked immunosorbent assay(elisa) 를사용하였으나거짓양성반응및낮은검출감도 (Caruso et al., 2003; Shin, 2009) 로인하여, 많은연구가수행된안정적인 polymerase chain reaction(pcr) 기반의검사방법이검토되었다 (Shin, 2009). 또한많은연구자들에의해개발된다원화된 PCR 조건을하나로맞춘검사방법및유전자를삽입한유전자변형 -양성대조구플라스미드가개발 (Lee et al., 2013 a ; Lee & Shin, 2014; Lee et al., 2014) 되어현장에적용되고있으나 ToRSV 검역진단시스템은국내에서는아직까지보고되지않은실정이다. 따라서본연구에서는검역현장에서 ToRSV를검사하기위한 reverse transctiption (RT)-PCR, nested PCR 및유전자변형 -양성대조구플라스미드를개발하였다. Ⅱ. 재료및방법 2.1 시료수집및프라이머제작 ToRSV 와유연관계가있는바이러스 6종 [Arabis mosaic virus(armv), Cherry leaf roll virus(clrv), Grapevine fanleaf virus(gflv), Raspberry ringspot virus(rprsv), Tomato black ring virus(tbrv) 및 Tobacco ringspot virus(trsv)] 과동일한숙주에감염될가능성이있는참고바이러스 6종 [Broad bean wilt virus 2(BBWV2), Bean common mosaic virus(bcmv), Tomato black ring virus(tbrv), Tobacco ringspot virus(trsv), Tomato mosaic virus Fig. 1. Primers map for specific detection of ToRSV
Lee et al: Development of Diagnostic System for Detecting Tomato ringspot virus in Quarantine 67 (ToMV) 및 Tomato spotted wilt virus(tswv)] 의 RNA 및 cdna를식물바이러스은행과농촌진흥청농업과학원등유관기관을통해수집하였으며, 또는바이러스가 spiking 되어있는이병시료를 Bi-One Co.(Korea) 를통해 Adgen Co.(UK) 에서구매하였다. 한편프라이머제작을위하여, 미국국립생물정보센터로부터 ToRSV NC_003839(7,271bp) 를포함한 ToRSV strain 11종및 Comoviridae에속하는참고바이러스 3종의염기서열을수집하였다 (data not shown). 수집한염기서열을 DNAMAN DNA analysis software package(dnaman version 6.0; Lynnon Biosoft, Canada) 를사용하여, primer annealing 51-59 및 PCR 반응조건 55 로하는국내검역바이러스검사법 (Lee et al., 2015) 과동일한방법으로 ToRSV 특이프라이머를제작하였다 (Fig. 1). 2.2. 핵산추출및프라이머선발이병시료의총 RNA 추출, cdna 합성, RT-PCR 및 nested PCR의 Kit 사용, 조성및조건은모두이전에보고된식물검역바이러스 PCR 진단시스템과동일하게수행하였다 (Lee et al., 2013 b ). 또한프라이머선발은, 우선설계한 RT-PCR 프라이머를조합하여 PCR 증폭이가능한조합들을구성한후다음의선발방식을사용하였다. ⅰ) ToRSV 특이적분석을위하여, RT-PCR 프라이머조합들을대상으로 ToRSV의 RNA에특이적반응을확인하였고, ⅱ) 선발한 RT-PCR 프라이머조합을대상으로참고바이러스주 ( 유연관계및동일한숙주에감염될수있는바이러스 ) 에비특이적인반응을보이는프라이머조합을제외하였으며, ⅲ) 특이및비특이적으로선발한 RT-PCR 프라이머조합을대상으로, ToRSV RNA를 10-7 까지단계희석하여검출한계실험을수행하였다. ⅳ) 최종적으로 2개의 RT-PCR 조합을선발하였으며, 각각의 nested PCR을설계및선발하였다 (Shin & Rho, 2014; Lee et al., 2015). Fig. 2. Diagram of making for inserted positive control plasmid 2.3 유전자변형 - 양성대조구플라스미드 ToRSV 검정에양성대조구로활용될유전자변형 - 양성대조구플라스미드를제작하였다 (Fig. 2). 최종 적으로선발된 2 개의 RT-PCR 증폭영역을모두포 함하는 PCR 산물을증폭시킨후, 그것을삽입 DNA 로사용하여 pgem -T Easy Vector(Promega, USA) 에결합한뒤대장균에 transformation 하였다 (Lee & Rho, 2015). 이후선발한 2 개의 RT-PCR 프라이머조합들중검출감도가높은하나를선정하 여, 해당 nested PCR 조합의증폭영역의안쪽에 제한효소 BamHⅠ 이반응할수있는 6 개의염기서 열 (GGATCC) 삽입하였다 (Nelson & McClelland, 1992). 유전자십입은염기서열분석및 BamHⅠ 처리를 통해확인하였다. Ⅲ. 결과및고찰 3.1 RT-PCR 프라이머선발및검출감도 ToRSV 의특이적으로진단할수있는프라이머 정방향 13 개와역방향 12 개가제작되었으며 (Fig. 1), 175bp~1,197bp 의크기로 RT-PCR 증폭이가능한 55 개의조합이설계되었다 (data not shown). 총 55 개의조합을대상으로 ToRSV 의특이적분석을수
68 Journal of Agriculture & Life Science 49(4) Fig. 3. Specific detection of Tomato ringspot virus(torsv) by using RT-PCR Lane M, 100bp step DNA Ladder maker(genepia, Korea); lane 1-55, ToRSV specific RT-PCR primer pair number. 행한결과모든조합에서특이적밴드를형성하여 이중증폭된크기와위치를고려하여 10 개의조합 을선발하였다 (Fig. 3). 선발된 10개조합을대상으로 ToRSV의유연관계가있는바이러스 6종에비특이적선발을수행한결과조합 13, 19 및 39에서비특이적밴드가형성된반면나머지 7개의 RT-PCR 프라이머조합은비특이적밴드를형성하지않았다 (Fig. 4A). 또한선발된 7개 RT-PCR 프라이머조합을대상으로동일한숙주에감염될가능성이있는참고바이러스 6종에비특이적선발을수행한결과조합 23에서비특이적밴드가형성되어선발에서제외하였다 (Fig. 4B). 최종적으로선발된 6개의프라이머조합들중크기 (500-800bp) 와증폭되는부위를고려하여최종적으로 3개의프라이머조합 [ 조합 9(F120/R20, 549bp), 조합31(F60/R80, 741bp) 및조합48(F90/R48, 709bp) 을선발하였다. ToRSV 검정을위해선발된 3개의 RT-PCR 프라이머조합을대상으로검출감도를분석한결과조합 9, 31 및 48은각각 10 2, 10 4 및 10 1 의검출감도가분석되어상대적으로조합9와 31을최종 RT- (A) Fig. 4. Non-specific detection of related reference viruses (A) and host related viruses (B) by using RT-PCR Lane M, 100bp step DNA Ladder maker; lane +, positive control(torsv); lane A, Arabis mosaic virus; lane C, Cherry leaf roll virus; lane G, Grapevine fanleaf virus; lane R, Raspberry ringspot virus; lane TB, Tomato black ring virus; lane TR, Tobacco ringspot virus; BB, Broad bean wilt virus; lane BC, Bean common mosaic virus; lane TM, Tomato mosaic virus; lane TS, Tomato spotted wilt virus; dot, selective primer pair. (B)
Lee et al: Development of Diagnostic System for Detecting Tomato ringspot virus in Quarantine 69 Fig. 5. Sensitivity test of three selective RT-PCR primer pairs Lane M, 100bp step DNA Ladder maker; lane number, diluted value; lane 0, no dilution; dot, selective primer pair. PCR 프라이머조합으로선발하였다 (Fig. 5). 3.2 Nested PCR 프라이머선발 ToRSV의 nested PCR 프라이머를선발하기위하여 RT-PCR 조합9와 31로부터증폭할수있는조합 9-1(ToRSV F130/R30, 439bp), 조합9-2(ToRSV F130/R40, 389bp) 와조합31-1(ToRSV F90/R70, 363bp) 및조합31-2(ToRSV F100/R70, 312bp) 를설계하였으며, 분석결과모두특이적밴드가형성되었고강도도유사하여 (Fig. 6), 최종적으로염기서열분석시유리한크기가큰 ToRSV F130/R30 (439bp) 와 ToRSV F90/R70(363bp) 을최종 nested PCR 프라이머조합으로선발하였다. 따라서검역현장에서 ToRSV 를특이적으로진단할수있는 RT-PCR은프라이머조합9(F120/R20, 549bp) 와조합31(F60/R80, 741bp) 이며, nested PCR 결과각각 439와 363bp를증폭할수있다 (Table 1). 3.3 유전자변형 -양성대조구플라스미드검역현장에서 ToRSV를진단할때양성대조군으로활용할유전자변형 -양성대조구를제작하였다. RT-PCR 조합9와 31이포함된 F10/R20(2,474 bp) 를증폭후, 클로닝하였다 (data not shown). ToRSV 검정을위한 RT-PCR 조합9의 nested PCR 증폭부 Fig. 6. Result of nested PCR for detecting ToRSV Lane M, 100bp step DNA Ladder maker; lane 1, ToRSV-F130/R30(439bp); lane 2, ToRSV-F130/R40(389bp); lane 3, ToRSV-F90/R70(363bp); lane 4, ToRSV-F100/R70(312bp); circle, final selective nested PCR primer pair.
70 Journal of Agriculture & Life Science 49(4) Table 1. Information of finally selective RT-PCR and nested PCR primer pairs for detecting Tomato ringspot virus Pair No. PCR Primer Sequence Length (bp) 9 RT Nested ToRSV_F120 ToRSV_R20 ToRSV_F130 ToRSV_R30 TACCACGCCCCCTTGTA AAAATTTARCATCGGGCACATC AATTTCTATTAAGCCGGACACCA AGACCACGGCTTCCACTGAGAA 549 439 31 RT Nested ToRSV_F80 ToRSV_R60 ToRSV_F90 ToRSV_R70 ATGGCAGCGATTTTGGTT TGGTACGGTGATGCGATAAACA TCCTTTGCTTATTGGTATGGATGT CCACGCACGATAGWATGTTC 741 363 위 (439bp) 를선정하여 BamHⅠ 이반응할수있는 6 개의염기서열을삽입하였다. 그결과 GGATCC 가 포함된총 445bp 의염기서열이분석되었으며 (Fig. 7), 또한 BamHⅠ 제한효소를처리한결과 272 와 173bp 로두개의밴드가형성 (data not shown) 되 어염기서열삽입을확인할수있었다. Fig. 7. Sequence information of modified-positive control plasmids for detecting ToRSV in quarantine
Lee et al: Development of Diagnostic System for Detecting Tomato ringspot virus in Quarantine 71 3.4 ToRSV 검역본연구에서는검역현장에서 ToRSV 를신속, 정확하게진단할수있는검역진단시스템을개발하였다. 국내로 ToRSV 검사작물이유입되면식물체에서총 RNA를추출한뒤, 본연구에서개발한 RT-PCR, nested PCR 및유전자변형 -양성대조구를사용하여검사를수행한다. 만약검정에사용한유전자변형 - 양성대조구로부터실험실오염이일어나시료에서양성반응이나타난다면 RT-PCR 조합9의 nested PCR 증폭산물의염기서열분석결과인위적으로삽입한 6개의염기서열 (GGATCC) 이분석되거나 nested PCR 산물을 BamHⅠ 처리를하면두개의밴드로분리되어거짓양성반응을확인할수있다. 한편, Animal, Plant and Fisheries Quarantine and Inspection Agency(2013) 에따르면, 화물과휴대등으로국내유입되는다음의작물들에대해서 ToRSV 검사를수행한다. 나무딸기 (Rubus idaeus, Rubus occidentalis), 글라디올러스속 (Gladiolus spp.), 까치밥나무속 (Ribes spp.), 나무딸기속 (Rubus spp.), 난과 (Orchidaceae), 담배 (Nicotiana tabaccum), 딱총나무속 (Sambucus spp.), 딸기 (Fragaria ananassa), 벌노랑이 (Lotus corniculatus), 벚나무속 (Prunus spp.), 블루베리속 (Vaccinium spp.), 비취란속 (Vanda spp.), 사과나무속 (Malus spp.), 양벚 (Prunus avium, Prunus serotina), 제라늄속 (Pelargonium spp.), 토마토 (Lycopersicon esculentum) 및포도나무속 (Vitis spp.). 따라서본연구에서개발한 ToRSV 검역진단시스템은관련작물로부터신속한검정으로향후식물검역에기여할것이라고기대된다. Ⅴ. 감사의글 We are grateful to the editor for extensive comments and to two anonymous reviewers who helped to improve the manuscript. The present research was conducted with the support of Animal and Plant Quarantine Agency in 2011.» 참고문헌 Animal, Plant and Fisheries Quarantine and Inspection Agency. 2013. List of plant quarantine viruses in Korea in newly revised in 2013. Res. Plant Dis. 19: 67-75. Caruso P, Bertolini E, Cambra M and López MM. 2003. A new and sensitive co-operational polymerase chain reaction for rapid detection of Ralstonia solanacearum in water. J. Microbiol. Methods 55: 257-272. Lee S, Cha MJ, Kim SM, Heo NY, Shin YG and Lee SH. 2014. Development of nucleotide primers for dignostic RT-PCR and nested PCR detection of three seed-transmitted viruses(crlv, SpLV and WClMV) in quarantine. J. Agric. & Life Sci. 48: 75-83. Lee S, Kang EH, Heo NY, Kim SM, Kim YJ and Shin YG. 2013. Detection of Carnation necrotic fleck vrus and Carnation ringspot virus using RT-PCR. Res. Plant Dis. 19: 36-44 a. Lee S, Kang EH, Shin YG and Lee SH. 2013. Development of RT-PCR and nested PCR for detecting four quarantine plant viruses belonging to Nepovirus. Res. Plant Dis. 19: 220-225 b. Lee S, Lee JY, Shin YG, Lee SH and Ahn TY. 2015. Development and verification of nested PCR assay for detection of Tobacco rattle virus in plant quarantine. J. Bacteriol. Virol. 45: 54-61. Lee S. and Rho JY. In press. Development of a PCR diagnostic system for detecting Andean potato mottle virus associated with potato quarantine in Korea. American J. Potato Res. Lee S and Shin YG. 2014. Development and practical use of RT-PCR for seed-transmitted Prune
72 Journal of Agriculture & Life Science 49(4) dwarf virus in Quarantine. Plant Pathol. J. 30: 178-182. Nelson M and McClelland M. 1992. Use of DNA methyltransferase/endonuclease enzyme combinations for megabase mapping of chromosomes. Methods Enzymol. 216: 279-303. OEPP/EPPO. 2005. Tomato ringspot nepovirus. Bulletin OEPP/EPPO Bulletin 35: 313-318. Shin YG. 2009. An advanced quarantine system for the inspection of seed-borne viruses in Korea., Ph.D. Thesis, Kyungpook National University, Daegu, Gyeongsangbuk-do, Korea. Shin YG and Rho JY. 2014. Development of a PCR Diagnostic System for Iris yellow spot tospovirus in Quarantine. Plant Pathol. J. 30: 440-444. Stace-smith R. 1994. Tomato ringspot virus, no. 290. (no. 18 revised) in: Description of plant viruses. Commonw. Mycol. Inst. Assoc./Appl. Biol., Kew, England.