J Korean Soc Food Sci Nutr 한국식품영양과학회지 39(4), 595~601(2010) DOI: 10.3746/jkfn.2010.39.4.595 Multiplex Polymerase Chain Reaction(PCR) 법을이용한 Staphylococcus aureus, Salmonella enterica subsp., Vibrio parahaemolyticus 의다중동시검출 정유석 1 정희경 1 전원배 2 서화정 2 홍주헌 3 1 ( 재 ) 대구테크노파크바이오산업지원센터 2 대구경북과학기술원 3 대구가톨릭대학교외식식품산업학부 Simultaneous Detection of Staphylococcus aureus, Salmonella enterica subsp., Vibrio parahaemolyticus by Multiplex Polymerase Chain Reaction Yoo Seok Jeong 1, Hee Kyoung Jung 1, WonBae Jeon 2, HwaJung Seo 2, and JooHeon Hong 3 1 Bio Industry Center, Daegu Technopark, Daegu 704801, Korea 2 Daegu Gyeongbuk Institute of Science & Technology, Daegu 704230, Korea 3 Dept. of Food Science and Technology, Catholic University of Daegu, Gyeongbuk 712702, Korea Abstract This study was conducted to detect and identify Staphylococcus aureus, Vibrio parahaemolyticus, and Salmonella enterica subsp. using simultaneous multiplex polymerase chain reaction (multiplex PCR) assay. 23S rrna partial gene (S. aureus), tox R gene (V. parahaemolyticus), and inv A gene (S. enterica subsp.) as diagnostic marker gene were suggested, and their amplicon sizes were 482 bp, 368 bp, and 284 bp, respectively. Non specific amplicons by STA5F/STA5R primer, ToxRF/ToxRR primer, and 139/141 primer were not observed in genomic DNA of pathogen bacteria as Bacillus cereus, Listeria monocytogenes, Escherichia coli, Proteus vulgaris, Streptococcus pyogenes, Candida albicans, and Shigella sonnei. The extracted crude DNA of targeted bacteria was detected as PCR template successfully. The detection limits were 10 5 ~10 4 CFU/mL and 10 pg of purified genomic DNA of S. aureus, V. parahaemolyticus, and S. enterica subsp. by using simultaneous multiplex PCR. Key words: Staphylococcus aureus, Vibrio parahaemolyticus, Salmonella enterica subsp., multiplex PCR 서론사람이식품에오염된화학적독소, 자연적독소및위해미생물을섭취함으로써발생하는질병을식중독이라하는데국내식중독사고는 1990년대비 2006년에환자수는 618 명에서 10,833명으로 16년사이 17배가증가하였으며, 식중독사고 1건당환자의발생비율도 41명으로약 2.16배가증가하였다 (1). 또한단체급식의증가와외식산업의발달로식중독발생건당그규모가커지고발생건수에서도증감을반복하며지속적으로발생하고있다. 이에따라먹거리에대한국민의불안감이고조되고건강한삶의영위를위해식품으로부터오는위해를사전에예방하거나최소화하는등식품의안전성확보에대한중요성이높아졌다. 국내식중독현황을보면, 발생되는 80~90% 가세균성식중독이차지하고있으며 Salmonella, Vibrio parahaemolyticus, Staphylococcus aureus 균의순서로발생하고있다. Staphylococcus aureus는병원내감염의주요원인균외에 도사람과동물의화농성상처를통해서식품으로오염되는대표적인독소형식중독균으로알려져있으며 (24), Salmonella는급성패혈증, 심한위장염증상과발열, 구토를동반하는식중독균으로유제품이나가금류, 즉석식품등에서발생되며국내외에서식중독을일으키는가장큰주요원인균으로알려져있다 (58). 국내수산물에의한위장염의 30% 를차지하고있는 Vibrio parahaemolyticus는해수온도가상승하면균수가급격히증가하며여름철해수에서빈번히분리되어지고있다 (9,10). 지구온난화로인하여계절에관계없이연중식중독이발생할뿐만아니라 (11), 농 축산물원료및가공식품의수출입자유화에따른국제간의교류확대및식생활패턴변화에의한단체급식, 가공식품, 냉장및냉동식품, 즉석식품등의소비증가가다발적인집단식중독발생증가의주요요인이되고있다 (12). 식품으로부터경제적, 사회적으로문제가되는병원성세균검출을위한노력들이시도되었으며, 생화학적특성을이용한전통적분석방법에서부터최근에는분자생물학적 Corresponding author. Email: jhhong@cu.ac.kr Phone: 82538503218, Fax: 82538503218
596 정유석 정희경 전원배 서화정 홍주헌 방법까지다양하게개발되어졌다 (13). 전통적인식중독균검사방법은장기적인시간과많은노동력등이요구되어늘어나는검사수요를감당할수없을뿐만아니라신속성이낮아조기발견으로의역할은미비하다. 최근의분자생물학중심으로연구되어진병원성세균검출법을살펴보면, 항체를이용하여균주의특이적항원을측정하는면역학적방법으로면역크로마토그래피 (14), 면역리포좀 (15) 등이개발되었다. 또한유전학적방법으로일반적으로 Polymerase Chain Reaction(oly) 을이용하여균주의특정 DNA 서열을증폭시켜진단하는것으로대상유전자들은주로병원성균주의독소유전자 (1618) 나병원균에서발현하는고유단백질유전자, 원시핵세포의 genome상에간헐적으로분산되어있는반복적인 DNA sequence를 16S rrna 유전자등을사용한연구도있다 (19,20). 개발되어진유전학적검출법은오판정확률과미량검출이어렵다는이유등으로산업적으로활성화가미약하며, 따라서시장에서는검출결과의정확성및검출비용의절감과함께새로운검출법요구가지속적으로이루어지고있다. 본연구에서는국내식중독주요원인균으로보고되어지고있는 Staphylococcus aureus, Salmonella enterica subsp., Vibrio parahaemolyticus의검사시간및비용절감을통해국내식품업계의경제적인식중독검출을위한기반을마련하고자 PCR을이용한다중동시검출에대해조사하였다. 재료및방법사용균주및배양조건식중독주요원인균인 Staphylococcus aureus(s. aureus), Salmonella enterica subsp.(s. enterica subsp.), Vibrio parahaemolyticus(v. parahaemolyticus) 에대한검출의지표가되는바이오마커유전자검출을위해본연구에서사용되어진균주들은한국생명공학연구원생물자원센터 (KCTC) 와한국미생물보존센터 (KCCM) 에서분양받아사용하였다. 사용된균주와배양조건은 Table 1과같다. Genomic DNA 및 crude DNA 추출사용되어진균주들로부터정제된 genomic DNA와 crude DNA를추출하여 PCR을위한 template로써사용하였다. 각균주의배양액을 5 ml씩취하여 12,000 rpm으로원심분리한후상층액을제거하고회수한균체를 1 ml의멸균증류수로현탁시킨후자동핵산추출기 (Magtration system 6GC, PSS, Chiba, Japan) 를사용하여 genomic DNA를추출및정제하였다. 각균주의 genomic DNA는 Nanodrop(ND1000, Thermo, Waltham, USA) 을이용하여 260 nm에서정량하였으며, 10배단계희석을통해 10 ng/μl에서 1 pg/μl 농도까지 PCR 반응으로검출한계를확인하였다. 즉, spectrophotometer(secomam, UVIKON, Leeds, UK) 를이용하여흡광도 600 nm에서 0.666의각균주배양액 ( 10 8 CFU/mL) 을 10배단계희석을통해 10 6 ~10 2 CFU/mL로준비하였으며각균액 100 μl를 Fig. 1과같은방법으로 crude DNA를추출하여 PCR을위한 template로사용하였다. 동일부피의희석되어진균액을고체배지에도말하여 plate counting 방법으로균수를개수하여 CFU/mL 값으로검출한계를확인하였다. Harvest of Bacteria (12000 rpm, 20 min, cfg) Washing with 2.5% NaCl (12,000 rpm, 20 min, cfg) Treatment of achromopeptidase (250 U/mL) 55 o C, 30 min Treatment of proteinase K and 10% Chelex 60 o C, 30 min 95 o C 10 min Ice 2 min 8,000 rpm, 2 min, cfg Supernant (=crude DNA sample) 3 repeat Fig. 1. Extraction of crude DNA as template. Table 1. Pathogenic bacteria and media used for experiments Strain Media Incubation temperature Staphylococcus aureus subsp. aureus (KCTC 1621) Vibrio parahaemolyticus (KCTC 2471) Salmonella enterica subsp. (KCTC 2514) Bacillus cereus (KCTC 1012) Proteus vulgaris (KCTC 2433) Escherichia coli (KCTC 2593) Listeria monocytogenes (KCTC 3569) Streptococcus pyogenes (KCTC 3096) Candida albicans (KCTC 7965) Shigella sonnei (KCCM 41282) Trypticase soy media Marine media Brain heart in fusion media Brain heart in fusion media Yeast mold media 30 o C 30 o C 25 o C
PCR 법을이용한 St. aureus, Sal. enterica subsp., V. parahaemolyticus 의다중동시검출 597 Table 2. Oligonucleotide primer sequences used in this study Strain Gene (PCR product size) Primer DNA sequence (5'3') Temp. ( o C) Staphylococcus aureus Vibrio parahaemolyticus Salmonella enterica subsp. 23s rrna (482 bp) toxr (368 bp) inva (284 bp) STA5F (forward primer) STA5R (reverse primer) TOXF (forward primer) TOXR (reverse primer) 139 (forward primer) 141 (reverse primer) TGGATTGCACGTCTAAGCAG TTACCCGACAAGGAATTTCG GTCTTCTGACGCAATCGTTG ATACGAGTGGTTGCTGTCATG GTGAAATTATCGCCACGTTCGGGCAA TCATCGCACCGTCAAAGGAACC 52 50 52 52 60 57 Primer set 식중독주요원인균인 S. aureus, S. enterica subsp., V. parahaemolyticus를검출하고자선별되어진특이적 primer set은 Table 2와같다. V. parahaemolyticus는 TOXF/ TOXR primer set(21), S. enterica subsp. 는 139/141 primer set(22) 를사용하여특이적검출을위해유전자를증폭하고자하였다. S. aureus는 23S rrna gene의특이적부분을증폭시킬수있는유전자로본연구에서신규디자인하였으며사용되어진 primer는 Bioneer(Daejeon, Korea) 에합성을의뢰하여사용하였다. PCR 조건 Singleplex PCR의조성은 0.2 ml tube에 template DNA 1 μl, 각 forward와 reverse primer(10 pmol/μl) 1 μl씩, 2 Taq premix(solgent, Daejeon, Korea) 12.5 μl와최종반응액이 25 μl가되도록멸균 3차증류수를첨가하여 iq5 system(biorad, Chicago, USA) 을이용하여표적유전자를증폭시켰으며검출한계및비특이적 PCR반응을조사하였다. S. aureus, S. enterica subsp., V. parahaemolyticus 균주들의다중동시검출을위한 simultaneous multiplex PCR의조성은각균주의 template DNA 1 μl씩, 각 3개의 forward와 reverse primer set(10 pmol/μl) 1 μl씩, 2 Taq premix(solgent) 12.5 μl와최종반응액이 25 μl가되도록멸균 3차증류수를첨가하여검출한계를알아보았다. PCR 반응조건은 95 o C에서 3분 predenaturation 후 95 o C 1분, 61 o C 30초, 72 o C 30초를 1 cycle로하여총 30 cycle 반응후, 마지막으로 72 o C에서 50초수행하였다. PCR 산물들은 ethidium bromide를포함한 1.8% agarose gel에서각균주표적유전자의예상되어진 size를확인하였다. 또한증폭되어진 PCR products를 Tvector(Promega Co., Madison, USA) 에클로닝하여 sequencing 의뢰 (Solgent) 를통해염기 서열을분석한결과를 NCBI의 blast search(http://ncbi.nlm. nih.gov/) 의표적유전자염기서열과의비교하여확인하였다. 결과및고찰 S. aureus, S. enterica subsp., V. parahaemolyticus 의다중동시검출을위한 primer set 구성 PCR 방법에의하여 S. aureus, S. enterica subsp., V. parahaemolyticus를다중동시검출하고자각각식중독원인균주의특이적유전자를조사하였다. 따라서바이오마커용유전자의검출을위한 primer set을구축하고자하였으며, S. enterica subsp의경우, 균침입성인자관련유전자인 inva 유전자부위를증폭시킬수있는 139/141 primer를 V. parahaemolyticus는독소유전자인 toxr 유전자부위를증폭시킬수있는 ToxRF/ToxRR primer를각균의검출을위한 primer로선정하였다. 또한 S. aureus에서는 23S rrna gene의특이적유전자를증폭시킬수있는 STA5F/ STA5R primer를본연구에서신규로디자인하여선정하였다. PCR 증폭을통해각균주 genomic DNA로부터특이적으로증폭되어진바이오마커유전자, 즉각기다른 size의예상되어진 PCR 산물들을 agarose gel 상에서 284 bp(s. enterica subsp.), 368 bp(v. parahaemolyticus), 482 bp(s. aureus) 로확인하였다. Tvector에클로닝되어진각 PCR 산물의 sequencing을통한염기서열분석으로표적유전자임을확인하였으며, 또한각 primer set들은해당균주외다른두식중독원인균에대하여비특이적인교차반응이일어나지않음을확인하였다 (Fig. 2). S. aureus, S. enterica subsp., V. parahaemolyticus 검출 primer set의특이성구축되어진 primer set의특이성을확인하고자타병원성균주인 Bacillus cereus, Listeria monocytogenes, Escherichia Fig. 2. Agarose gel electrophoresis of PCR fragment generated by PCR amplification with STA5F/STA 5R, 139/141 and TOXF/TOXR primer. Lane 1: STA5F/STA5R primer, lane 2: ToxRF/ToxRR primer, lane 3: 139/141 primer, lane M: 100 bp ladder. A: a PCR fragment generated by PCR amplification from genomic DNA of S. aureus, V. parahaemolyticus and S. enterica subsp. with primer. B: a nonspecific PCR products of S. aurues, V. parahaemolyticus and S. enterica subsp. with each non targeted primer set.
598 정유석 정희경 전원배 서화정 홍주헌 Fig. 3. Agarose gel electrophoresis of PCR fragment generated by PCR amplification with STA5F/STA5R, 139/141, and TOXF/ TOXR primer. Lane 1: Bacillus cereus (KCTC 1012), lane 2: Listeria monocytogenes (KCTC 3569), lane 3: Escherichia coli, lane 4: Proteus vulgaris (KCTC 2433), lane 5: Streptococcus pyogenes (KCTC 3096), lane 6: Candida albicans (KCTC 7965), lane 7: Shigella sonnei (KCCM 41282), lane M: 100 bp ladder. Table 3. Singleplex PCR for detection of specific gene in various bacteria strain Strain Staphylococcus aureus subsp. aureus (KCTC 1621) Vibrio parahaemolyticus (KCTC 2471) Salmonella enterica subsp. (KCTC 2514) Bacillus cereus (KCTC 1012) Listeria monocytogenes (KCTC 3569) Escherichia coli (KCTC 2593) Proteus vulgaris (KCTC 2433) Streptococcus pyogenes (KCTC 3096) Candida albicans (KCTC 7965) Shigella sonnei (KCCM 41282) 1) STA5F (forward)/sta5r (reverse) primer. Target gene 23S rrna 1) toxr 2) inva 3) + 2) ToxRF (forward)/toxrr (reverse) primer. 3) 139 (forward)/141 (reverse) primer. + + coli, Proteus vulgaricus, Streptococcus pyogenes, Candida albicans, Shigella sonnei의 genomic DNA를주형으로 PCR 을통해확인한결과, 각 primer set들은타병원성균주에대한비특이적반응을일으키지않았다 (Fig. 3, Table 3). S. aureus, S. enterica subsp., V. parahaemolyticus의 multiplex PCR법에의한다중동시검출에있어서는 template DNA 또는 primer set들이혼합된상태에서정확한검출과동정이이루어져야한다. 따라서 primer set들간의비특이적인유전자증폭반응과 template DNA 간에비특이적유전자증폭반응에대하여조사하였으며, simultaneous multiplex PCR 방법으로재현성과정확성에대해조사하였다. 그결과, 각 primer set들간에그리고각균주의 genomic DNA 간에비특이적인유전자증폭반응이발생하지않음을확인하였으며 (Fig. 4, lane 1, 2), 세종류의 primer set와한균주의 genomic DNA의 PCR 반응시표적되는유전자를특이적으로각각예상되어지는유전자크기로써증폭하였으며균종을검출및동정할수있었다 (Fig. 4, lane 3~5). 또한세균주의 genomic DNA와각각한종류의 primer set 반응시표적되는유전자를특이적으로각각예상되어지는유전자크기로써증폭하였으며균종을검출및동정할수있었다 (Fig. 4, lane 6~8). S. aureus, S. enterica subsp., V. parahaemolyticus 세균주의 genomic DNA mixture와 3종류의 primer set mixture를이용한 simultaneous multiplex PCR을수행하였으며, 주형과 primer set 간에유전자증폭이경쟁적으로일어나거나다량의유전자증폭에의하여 multiplex PCR 반응의저해가우려되었다. 하지만각각식중독균의바이오마커유전자, 즉 S. aureus의 23S rrna Fig. 4. Agarose gel electrophoresis of specific PCR fragment generated by multiplex PCR amplification with STA5F/ STA5R, 139/141 and TOXF/TOXR primer. Lane M: 100 bp ladder, lane 1: STA5F/STA5R, 139/141 and ToxRF/ ToxRR primer, lane 2: Genomic DNA of S. aereus V. parahaemolyticus, and S. enterica subsp., lane 3: Genomic DNA of S. aereus with STA5F/STA5R, 139/141 and ToxRF/ToxRR primer, lane 4: Genomic DNA of V. parahaemolyticus with STA5F/STA5R, 139/141 and ToxRF/ToxRR primer, lane 5: Genomic DNA of S. enterica subsp. by STA5F/STA5R, 139/141 and ToxRF/ToxRR primer, lane 6: Genomic DNA of S. aereus V. parahaemolyticus, and S. enterica subsp. with STA5F/STA5R primer, lane 7: Genomic DNA of S. aereus V. parahaemolyticus, and S. enterica subsp. with ToxRF/ToxRR primer, lane 8: Genomic DNA of S. aereus, V. parahaemolyticus, and S. enterica subsp. with 139/141 primer, lane 9: Genomic DNA of S. aereus, V. parahaemolyticus, and S. enterica subsp. with STA5F/STA5R, 139/141 and ToxRF/ToxRR primer. partial gene(482 bp), V. parahaemolyticus의 toxr gene(368 bp), S. enterica subsp. inva gene(284 bp) 의특이적 size를가지는 PCR 산물을성공적으로증폭시켰다 (Fig. 4, lane 9). 따라서본연구에서구축되어진 ToxRF/ToxRR, STA 5F/STA5R, 139/141 primer는 S. aureus, S. enterica subsp., V. parahaemolyticus의다중동시검출을위한적합한 pri
PCR 법을이용한 St. aureus, Sal. enterica subsp., V. parahaemolyticus 의다중동시검출 599 mer set 구성임을확인할수있었다. Singleplex 및 multiplex PCR 방법에의한 genomic DNA 의검출한계 S. aureus, S. enterica subsp., V. parahaemolyticus 세식중독원인균주에서분리정제되어진 genomic DNA의농도에따른검출한계를확인하고자정제되어진 DNA를 10배단계희석하여 singleplex PCR 반응결과를조사하였다. 그결과, S. aureus, S. enterica subsp., V. parahaemolyticus의 genomic DNA를 10 pg까지검출할수있었다. 또한희석되어진 genomic DNA 혼합액을 template로 multiplex PCR법으로유전자를증폭시킨결과, singleplex PCR에서보인동일한검출한계즉, 10 pg genomic DNA를다중동시검출을할수있었다. 약 800 bp size의비특이적유전자증폭이발생하였으나이는표적되어지는 PCR products의크기에해당되지않으며 singleplex와 multiplex PCR에서검출되어지는한계의동일성으로검출및동정에영향을주지않는것으로사료된다 (Fig. 5). Jeong 등 (18) 은 Salmonella의 PCR 검출시 genomic DNA 1 pg까지검출이가능하다고하였는데본연구에서는세균주모두 single 및 multiplex PCR법에의해 10 pg까지의낮은검출능을나타내었다. 이는 simultaneous multiplex PCR 반응시비특이적반응발생을방지하고자설정되어진본연구에서사용되어진 PCR 조건중증폭 cycle 수등의요인에의한것으로생각되며, 따라서 cycle 수와최적 primer 농도설정에따라그검출한계를높일수있을것이라사료된다. 생균수와 singleplex 및 multiplex PCR 방법의검출한계본연구에서는 S. aureus, S. enterica subsp., V. parahaemolyticus 의검출을위하여상업적 kit 및전통적인방법에의한 DNA 추출및정제방법이아닌 crude DNA 추출을통해비용절감과함께 PCR 검출한계를알아보고자하였다. 검출하고자하는식중독원인균중그람양성균인 S. aureus 를고려하여 achromopeptidase 처리를통해균량에비례되는 crude DNA를안정적으로추출하였다. 상업적 kit 사용에의한 DNA 추출과본연구에서사용되어진 DNA 추출프로토콜에의한시간적소비는큰차이를보이지않았으며, 비용면에서절감할수있었다. 추출되어진 crude DNA는 PCR 반응을위한 template로써성공적으로사용되어졌다. 각표적식중독원인균의희석배양액으로부터 plate counting 방법을통해얻어진생균수 (CFU/mL) 에대한검출한계를조사하였다. 그결과, S. aureus는 6.0 10 1 CFU/reaction 즉, 6.0 10 4 CFU/mL까지검출확인이가능하였으며, V. parahaemolyticus는 6.1 10 2 CFU/reaction 즉, 6.1 10 5 CFU/ ml까지검출이가능하였다. S. enterica subsp. 는 9.5 10 1 CFU/reaction 즉, 9.5 10 4 CFU/mL까지검출이가능하였다. Simultaneous multiplex PCR법으로유전자를증폭시킨결과, singleplex PCR에서나타난각검출한계와동일하게다중동시검출되었다 (Fig. 6). Yoon 등 (22) 의 multiplex PCR 연구와비교시 Salmonella spp., S. aureus에있어생균수검출한계가 1 log 차이의낮은검출한계를보였다. PCR에의한검출한계및검출정확성은 Fig. 5. Detection limits for genomic DNA of S. aureus, V. parahaemolyticus and S. enterica subsp. by singleplex and multiplex PCR assay. Lane 1: 10 ng genomic DNA, lane 2: 1 ng genomic DNA, lane 3: 100 pg genomic DNA, lane 4: 10 pg genomic DNA, lane 5: 1 pg genomic DNA, lane M: 100 bp ladder. Fig. 6. Detection limits for viable count of S. aureus, V. parahaemolyticus and S. enterica sbusp. by singleplex and mutiplex PCR assay. Lane 1: 10 6 CFU/mL, lane 2: 10 5 CFU/mL, lane 3: 10 4 CFU/mL, lane 4: 10 3 CFU/mL, lane 5: 10 2 CFU/mL, lane M: 100 bp ladder.
600 정유석 정희경 전원배 서화정 홍주헌 PCR 조건에의해서도많은영향을받을수있으며, primer 사용농도, annealing 온도등에대한최적화로검출민감도를향상시킬수있을것이다. Lim 등 (17) 은혈청형별 E. coil O157:H7의동시검출최적화설정에있어 gradient PCR로최적 annealing 온도를선발하였으며, Park 등 (23) 은 multiplex PCR의각 primer의최적농도를다르게하여 multiplex PCR을수행하기도하였다. 본연구결과 PCR 조건최적화및시료부피보다농축된 crude DNA 추출로검출한계를향상시킬수있을것이라사료된다. 요 본연구는국내주요식중독원인균인 Staphylococcus aureus, Salmonella enterica subsp., Vibrio parahaemolyticus를동시에검출및동정할수있는 simultaneous multiplex PCR방법을개발하고자하였다. S. aureus 의 23s rrna 유전자 (482 bp), V. Parahaemolyticus의 toxr 유전자 (368 bp), S. enterica subsp. 의 inva 유전자 (284 bp) 를특이적으로검출및동정할수있는 3개 primer set 즉, STA5F/STA5R, ToxRF/ToxRR, 139/141을구축하였으며, 그결과정제되어진각식중독원인균의 genomic DNA를 template로하여세균주모두 10 pg까지다중동시검출이가능하였다. 생균수 (CFU) 와상응되는검출한계결과로써 10 1 ~10 2 CFU/reaction의검출한계를보였으며이는즉, S. aureus 6.0 10 4 CFU/mL, S. enterica subsp. 9.5 10 4 CFU/mL, V. parahaemolyticus 6.1 10 5 CFU/mL의검출한계를나타내었다. 균체회수부터 agarose gel 상에서검출및동정까지 3~4 hr의시간소요로 single tube 반응으로세식중독원인균의다중동시검출이가능하였다. 또한추가적인연구를통하여세식중독원인균주의검출을위한향상된민감도를가지는 multiplex PCR법및 real time PCR을이용한다중동시검출법개발을위한기초자료로서활용가능할것이라사료된다. 약 감사의글 본연구는대구경북과학기술원 (Daegu Gyeongbuk Institute of Science & Technology) 의연구비지원에의해이루어진연구결과의일부로이에감사드립니다. 문 1. Lee HJ. 2008. Pathogenic agents and outbreak of foodborne diseases at home and abroad. Kor J Vet Publ Hlth 32: 8189. 2. Jung HJ, Cho JI, Park SH, Ha SD, Lee KH, Kim CH, Song ES, Chung DH, Kim MG, Kim KY, Kim KS. 2005. Genotype and phenotype characteristics of Staphylococcus aureus isolates from lettuces and raw milk. Korean J Food Sci Technol 37: 134141. 헌 3. Ingeborg H, Angelika L, Petra R, Kurt K, Ernst B, Marti W. 2001. Comparison of different approaches to quantify Staphylococcus aureus cells by realtime PCR and quantitative PCR and application of this technique for examination of cheese. Appl Environ Microbiol 67: 31223126. 4. Le Loir Y, Baron F, Gautier M. 2003. Staphylococcus aureus and food poisoning. Genet Mol Res 2: 6376. 5. Yeh KS, Chen TH, Liao CW, Chang CS, Lo HC. 2002. PCR amplification of the Salmonella typhimurium fim Y gene sequence to detect the Salmonella species. Int J Food Microbiol 78: 227234. 6. Chiu TH, Chen TR, Hwang WZ, Tsen HY. 2005. Sequencing of an internal transcribed spacer region of 16S23S rrna gene and designing of PCR primers for the detection of Salmonella spp. in food. Int J Food Microbiol 97: 259265. 7. Jung SJ, Kim HJ, Kim HY. 2005. Quantitative detection of Samonella typhimurium contamination in milk, using real time PCR. J Microbiol Biotechnol 15: 13531358. 8. Park HJ, Kim HH, Park SH, Shin EG, Kim JH, Kim HY. 2008. Direct and quantitative analysis of Salmonella enterica serovar typhimurium using real time PCR from artificially contaminated chicken meat. J Microbiol Biotechnol 18: 14531458. 9. Oh EK, Yu HS, Shin SB, Son KR, Park KB, Kwon JY, Lee TS, Lee HJ. 2008. Trimethoprim resistance of Vibrio parahaemolyticus isolated from the fish farm. J Kor Fish Soc 41: 324329. 10. di Pinto A, Ciccarese G, de Corato R, Novello L, Terio V. 2008. Detection of pathogenic Vibrio parahaemolyticus in southern Italian shelfish. Food Control 19: 10371041. 11. Kim MM, Oh MH, Lee GY, Hwang IG, Kwak HS, Kang YS, Koh YH, Jun HK, Kwong KS. 2008. Analysis of major food borne pathogens in various foods in Korea. Food Sci Biotechnol 17: 483488. 12. Choi KY, Kim BS, Bae WS, Jung WS, Cho YJ. 2008. Developing the index of foodborne disease occurrence. Korean J Appl Statist 21: 649658. 13. Adndreja R, Benaissa EM, Mieke U, Philippe B, Willy Z, Ernst H, Ellen F, Johan D. 2006. Immunoquantitative real time PCR for detection and quantification of Staphylococcus aureus enterotoxin B in foods. Appl Environ Mircobiol 72: 1659316599. 14. Kwak HS, Lee DH, Moon HS, Park JS, Woo GJ, Kim CM. 2003. Evaluation of the efficiency of E. coli O157:H7 rapid detection kit using immunochromatography. J Fd Hyg Safety 18: 118124. 15. Kim MH, Kim WJ, Sin WS, Son DH, Cha SG. 2003. Feasibility study on the use of liposomes for detecting foodborne pathogenic bacteria. Korean J Food Sci Ani Resour 23: 278283. 16. Jung HJ, Cho JI, Song ES, Kim JJ, Kim KS. 2005. PCR detection of virulence genes encoding coagulase and other toxins among clinical methicillinresistant Staphylococcus aureus isolates. Kor J Microbiol Biotechnol 33: 207214. 17. Lim JS, Yoon JH, Min BK, Hong KW. 2008. Detection and identification of shigalike toxin producing Escherichia coli O157:H7 by multiplex PCR. Food Eng Prog 12: 814. 18. Jeong SH, Kim MY, Kim HJ, Kim TU, Yu SL, Kim HY. 2003. Rapid detection of Salmonella species in foods using PCR. J Korean Soc Agric Chem Biotechnol 46: 225228. 19. Han KH, Lee CW, Lee YS, Yang OS, Lim YK, Yoon BS. 2001. Application of multiplex PCR using Lismix primers in food test and specific detection of Listeria ivanovii. J Fd Hyg Safety 16: 251257.
PCR 법을이용한 St. aureus, Sal. enterica subsp., V. parahaemolyticus 의다중동시검출 601 20. Seo HA, Park SH, Kim GS. 2003. Optimization of the concentrations of ERICPCR components to simultaneously differentiate five foodborne pathogenic bacterial genera. J Fd Hyg Safety 18: 229236. 21. Kim SS, Lee HM, Lee JB. 2003. Molecular epidemiological characteristics of Vibrio parahaemolyticus as recently wildespreaded in Korea. Korean J Biotechnol Bioeng 18: 522528. 22. Yoon JH, Lee SJ. Hong KW. 2008. A multiplex PCR Assay for the direct detection of Salmonella spp., Yersinia enterocolitica, and Staphylococcus aureus in Food. Food Eng Prog 12: 2431. 23. Park SH, Kim HJ, Kim HY. 2006. Simultaneous detection of Yersinia enterocolitica, Staphylococcus aureus, and Shigella spp. in lettuce using multiplex PCR method. J Microbiol Biotechnol 16: 13011305. (2009 년 11 월 9 일접수 ; 2010 년 3 월 16 일채택 )