한수지 51(4), 397-403, 2018 Original Article Korean J Fish Aquat Sci 51(4),397-403,2018 제주지역양식넙치 (Paralichthys olivaceus) 에서분리한어병세균내 Erythromycin 내성유전자분석 이다원 전려진 김승민 1 정준범 * 제주대학교해양의생명과학부, 1 주식회사우진비앤지 Analysis of Erythromycin Resistance Gene in Pathogenic Bacteria Isolates from Cultured Olive flounder Paralichthys olivaceus in Jeju Da Won Lee, Lyu Jin Jun, Seung Min Kim 1 and Joon Bum Jeong* School of Marine Biomedical Sciences, Jeju National University, Jeju 63243, Korea 1 Central Research Institute, Woo Gene B&G, Hwaseong 48513, Korea We determined the resistance rates of pathogenic bacteria isolated from cultured olive flounder Paralichthys olivaceus to erythromycin (Em), antibiotic typically used in aquaculture and analyzed the genotypes of resistant bacteria using polymerase chain reaction (PCR). We isolated and utilized 160 isolates of Streptococcus parauberis, 1 of S. iniae, 66 of Edwardsiella tarda, 56 of Vibrio sp. and 23 of unidentified bacteria from presumed infected olive flounder from Jeju Island from March 2016 to October 2017. Of the 306 isolated strains, Em-resistant strains included 33 of S. parauberis, 39 of E. tarda and 2 of Vibrio sp. We conducted PCR to assess the resistance determination of Emresistant strains. Five different types of Em-resistance genes were detected in the 74 Em-resistant strains: erm (A), erm (B), erm (C), mef (A) and mef (E); erm (A) and erm (B) were detected in 1 (3%) and 24 (72.7%) S. parauberis isolates, respectively. In E. tarda, erm (B) was detected in five isolates (12.8 %) and no Em-resistance genes were detected in the two Vibrio sp. isolates. Key words: Erythromycin, Olive flounder, Resistance gene, Jeju, erm (B) 서론 1920,,., (Lee et al., 2010a),. Animal and Plant Quarantine Agency (APQA, 2009) erythromycin (Em) 6.3%, oxytetracycline. Em macrolide, 50S ribosome ribonucleic acid (RNA) (Hansen et al., 1999). Em,. methylase ribosome, erm (erythromycin ribosome methylation), efflux pump mef (A) (macrolide efflux), msr (A) (macrolide and streptogramine B), vag (virginiamycin factor) (Lee and Kim, 2013). Em rrna methylase erm (A), erm (B), erm (C), efflux mef (A) (Sapkota et al., 2006). macrolide https://doi.org/10.5657/kfas.2018.0397 Korean J Fish Aquat Sci 51(4) 397-403, August 2018 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial Licens (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Received 2 July 2018; Revised 5 August 2018; Accepted 14 August 2018 *Corresponding author: Tel: +82. 64. 754. 3426 Fax: +82. 64. 756. 3493 E-mail address: jeongjb@jejunu.ac.kr Copyright 2018 The Korean Society of Fisheries and Aquatic Science 397 pissn:0374-8111, eissn:2287-8815
398 이다원ㆍ전려진ㆍ김승민ㆍ정준범 (Lee and Kim, 2013)., Em (Lee et al., 2016). 2016 Korean statistical information service (KOSIS),,., Em (Han et al., 2012; Sung et al., 2013; Lee et al., 2016). macrolide Em,. 재료및방법 균주의채집및분리 2016 2017. tryptic soy agar (TSA, Difco., USA) brain heart infusion agar (BHIA, Difco., USA) thiosulfate citrate bile salts sucrose (TCBS) agar (Difco., USA), salmonella shigella (SS) agar (MB cell, Korea), glutamate starch phenol-red agar (GSP, Sigma-Aldrich, Korea), blood agar (KOMED, Korea), 27 18-24. -70. 균주의동정 SS Edwardsiella tarda, TCBS Vibrio sp.. Higene genemic DNA prep kit (BIO- FACT, Korea) genomic DNA, Table 1 primer sets PCR. Table 1. Primer sets used for the identification of bacteria in this study Target pathogen Oligonucleotide sequences (5'-3') Product size (bp) Reference Streptococcus iniae AAGAGACGCAGTGTCAAAAG CGTTTCTTATCTTGTTACTC 220 Streptococcus parauberis TCCAGTCTTTCGACCTTCTT CAAAGAGATGTTCGGCTTG 107 Woo et al., 2006 Lactococcus garvieae AAGCAGTCTTTTGATGCAAG ACTGTGCGCCCTTATTAACT 307 Edwardsiella tarda CGGTAAAGTTGAGTTTACGGGTG TGTAACCGTGTTGGCGTAAG 415 Sakai et al., 2007 Vibrio genus GTCARATTGAAAARCARTTYGGTAAAGG ACYTTRATRCGNGTTTCRTTRCC 689 Vibrio alginolyticus ACGGCATTGGAAATTGCGACTG Kim et al., 2015 199 TACCCGTCTCACGAGCCCAAG Vibrio anguillarum GTTCATAGCATCAATGAGGAG GAGCAGACAATATGTTGGATG 519 Demircan and Candan, 2006 Vibrio harveyi GTGATGAAGAAGCTTATCGCGATT CGCCTTCTTCAGTTAACGCAGGA 601 Kim et al., 2014 Vibrio parahaemolyticus AGCTTATTGGCGGTTTCTGTCGG CKCAACACCAAGAAAAGCCGTC 297 Kim et al., 2015 Pseudomonas anguilliseptica GACCTCGCGCCATTA CTCAGCAGTTTTGAAAG 438 Blanco et al., 2002 Flexibacter maritimus TGTAGCTTGCTACAGATGA AAATACCTACTCGTAGGTACG 400 Cepeda et al., 2003
Erythromycin 내성유전자분석 399 항생제감수성검사 Em, clinical and laboratory standards institute (CLSI, 2017),. tryptic soy broth (TSB, Difco., USA), 27 18-24. 10 5-10 6, mueller hinton agar (MHA, Difco., USA), 27 24. Liofilchem, amoxicillin (10 g, AML), amoxicillin/clavulanic acid (30 g, AUG), ampicillin (10 g, AMP), chloramphenicol (10 g, C), ciprofloxacin (5 g, CIP), doxycycline (30 g, DXT), enrofloxacin (5 g, ENR), erythromycin (15 g, E), gentamycin (10 g, CN), kanamycin (30 g, K), minocycline (30 g, MN), nalidixic acid (30 g, NA), neomycin (30 g, N), norfloxacin (10 g, NOR), ofloxacin (5 g, OFX), oxolinic acid (2 g, OA), oxytetracycline (30 g, OT), penicillin (10 g, P), streptomycin (10 g, S), sulfadiazine (300 g, SUZ), tetracycline (30 g, TE) 21,., Em broth dilution method minimum inhibitory concentration (MIC) test, Lee et al. (2010b). 100 g/ml 0.78 g/ml mueller hinton broth (MHB, Difco., USA) 1/2, 10 5-10 6. MIC plate 27 24. Erythromycin 내성유전자검출 Em erm (A), erm (B), erm (C), mef (A) mef (E) PCR, primer Table 2. PCR 1 µm primer, 2.5 µm dntp, 10x G-Taq Buffer, 2.5 U G-Taq DNA polymerase (Gene Pro Themal Cycler Cosmo) template DNA, distilled water PCR volume 20 L. PCR 94 3 pre-denaturation, 94 30 denaturation, 55 30 annealing, 72 30 extenstion 1 cycle 30 cycles, 72 7 post-extension. 1% agarose gel, UV (UVP, USA) band. 결과 세균의분리및동정 2016 3 2017 10 306. SS, TCBS, GSP, Blood agar, Streptococcus sp. 161, E. tarda 66, Vibrio sp. 56, 23. PCR, S. parauberis 160, S. iniae 1, Lactococcus garvieae. E. tarda SS 66, PCR. Vibrioceae PCR, 56 Vibrio sp. V. alginolyticus Table 2. Primers and expected sizes of PCR products of various erm / mef genes Gene Primer Oligonucleotide sequences (5 to 3 ) Product size (bp) Reference erm (A) Em (A)F GTTCAAGAACAATCAATACAGAG Em (A)R GCATCAGGAAAAGGACATTTTAC 421 erm (B) Em (B)F GAAAAGGTACTCAACCAAAT Em (B)R AGTAACGGTACTTAAATTGT 639 erm (C) Em (C)F GCTAATATTGTTTAAATCGTCAATTCC Em (C)R GGATCAGGAAAAGGACATTTTAC 572 Jun, 2010 mef (A) mef-f ATGGAAAAATACAACAATTGG mefa-r GTAGTACAGCCATTCCTTC 646 mef (E) mef-f ATGGAAAAATACAAACAATTGG mefe-r CCTATCAACATTCCAGATGC 812 PCR, polymerase chain reaction; erm, erythromycin ribosome methylation; mef, macrolide efflux.
400 이다원ㆍ전려진ㆍ김승민ㆍ정준범 100 Streptococcus parauberis (n=33) Edwardsiella tarda (n=39) Vibrio sp. (n=9) Rate of resistant isolates (%) 80 60 40 20 0 more than 100 50 25 less than 12.5 MIC value of erythromycin (µg/ml) Fig. 1. MIC value distribution of erythromycin against Streptococcus parauberis, Edwardsiella tarda, Vibrio sp. isolated from olive flounder Paralichthys olivaceus. 4, V. harveyi 2. 50 Vibrio primer sets V. alginolyticus, V. anguillarum, V. harveyi, V. parahaemolyticus Vibrio., 306 23 primer sets., (,,, ) 306 99, (,,, ) S. parauberis 119, S. iniae 1, E. tarda 46, Vibrio sp. 38, 3 207. Erythromycin 내성균주분리 Em Em. Em S. parauberis 33, E. tarda 39, Vibrio sp. 9.,,,, 99 S. parauberis 5, E. tarda 10, Vibrio sp. 1 16 (16.2%),,, 207 S. parauberis 28, E. tarda 29, Vibrio sp. 8 65 (31.4%),.,, 2016 163 49 (30.1%), 2017 143 32 (22.4%) Em. Minimum inhibitory concentration (MIC) Em 81 MIC test. S. parauberis 33 2 100 g/ml, 16 50 g/ml, 10 25 g/ml 5 12.5 g/ml MIC (Fig. 1). E. tarda 5 50 g/ml, 34 12.5 g/ml. Vibrio sp. 9 E. tarda 7 12.5 g/ml, 2 25 g/ml MIC. S. parauberis E. tarda, Vibrio sp., Em MIC. 약제감수성 S. parauberis, E. tarda Vibrio sp. macrolide penicillins, tetracyclines Table 3. S. parauberis quinolone (91.9%), sulfonamide (79.4%), tetracycline (50%), E. tarda penicillin (80.3%), tetracycline (75.8%), quinolone (54.5%), sulfonamide (45.5%)., Vibrio sp. penicillin
Erythromycin 내성유전자분석 401 고찰 Fig. 2. DNA amplification of erm gene in erythromycin resistant isolates of Streptococcus parauberis, Edwardsiella tarda and Vibrio sp. from cultured fish in Jeju. Lane 1, S. parauberis-erm (A); Lane 2-9, S. parauberis-erm (B); Lane 10-14, E. tarda- erm (B); Lane 15 and 16, Vibrio sp.-not detected; M, 100bp DNA ladder., chloramphenicol. Erythromycin 내성유전자분석 Em total nucleic acid, PCR Em. erm (A), erm (B), erm (C), mef (A) mef (E) PCR Jun (2010), S. parauberis 33 erm (B) 24 (72.7%), 1 (3%) erm (A) (Table 4, Fig. 2). Em E. tarda 39 5 (12.8%) erm (B),., Vibrio sp., 5 erm/mef.,,,,. Em 6.3% oxytetracycline (APQA, 2009). Em, PCR Em. 2016 2017 S. parauberis 160, S. iniae 1, E. tarda 66, Vibrio sp. 56 23 306. L. garvieae, S. parauberis, S. iniae, Enterococcus sp. (Domeenech et al., 1996; Eldar and Ghittino, 1999),, S. parauberis 160., S. iniae S. parauberis (Jeong et al., 2006) S. iniae S. parauberis., Thompson et al. (2004) 60,, TCBS, Demircan and Candan (2006), Kim et Table 3. Number of bacterial isolates from cultured fish against various antimicrobial agents Isolates Penicillins Antimicrobial agents Quinolones Tetracyclines Aminoglycosides Sulfonamides Chloramphenicols Streptococcus parauberis (n=160) 11 (6.9%) 80 (50%) 147 (91.9%) 70 (43.8%) 127 (79.4%) 4 (2.5%) Edwardsiella tarda (n=66) 53 (80.3%) 50 (75.8%) 36 (54.5%) 15 (22.7%) 30 (45.5%) 0 (0%) Vibrio sp. (n=56) 49 (87.5%) 15 (26.8%) 5 (8.9%) 10 (17.9%) 12 (21.4%) 3 (5.4%) Table 4. Detection of various erm / mef genes in erythromycin resistant isolates from cultured fish in Jeju Resistance isolates Genotypes of erythromycin resistance factor erm (A) erm (B) erm (C) mef (A) mef (E) Streptococcus parauberis (n=33) 1 24 0 0 0 Edwardsiella tarda (n=39) 0 5 0 0 0 Vibrio sp. (n=2) 0 0 0 0 0 erm, erythromycin ribosome methylation; mef, macrolide efflux.
402 이다원ㆍ전려진ㆍ김승민ㆍ정준범 al. (2014), Kim et al. (2015)., V. alginolyticus 4, V. harveyi 2. Vibrio sp., V. scophthalmi, V. harveyi, V. anguillarum, Photobacterium damselae (Jo, 2006). Em CLSI (2017) 13 mm. S. parauberis 33, E. tarda 39, Vibrio sp. 9 81. 2016 2017 47 (30.1%), 32 (22.4%) Em., E. tarda 2016 2017 42.9%, 56.3%, Vibrio sp. 10.2%, 12.5% E. tarda. S. parauberis 23 (46.9%), 10 (31.3%)., Em. Em MIC test, PCR. CLSI (>8 g/ml), Vibrio sp. Em 2, gene. Luna et al. (1999) Portillo et al. (2000) erm (B), erm (A). S. parauberis erm (B) 24, erm (A) 1. E. tarda Em,. E. tarda 39 Em erm (B) 5 (Fig. 2). E. tarda Vibrio sp. S. parauberis Em (Hiroshi, 1996)., erm mef, Lee et al. (2010a) Em erm mef msr, erm (B) mef (A). msr primer., mef mph (Nonaka et al., 2015).,. Em. 사사 2017. References APQA (Animal and Plant Quarantine Agency). 2009. National antibiotic use and monitoring of antimicrobial resistance in 2015 [Internet]. Retrieved from www.qia.go.kr on Jun 18, 2018. Blanco MM, Gibello A, Vela AI, Moreno MA, Dominguez L and Fernandez-Garayzabal JF. 2002. PCR detection and PFGE DNA macrorestriction analyses of clinical isolates of Pseudomonas anguilliseptica from winter disease outbreaks in sea bream Sparus aurata. Dis Aquat Org 50, 19-27. https://dx.doi.org/10.3354/dao050019. Cepeda C, Garcia-Marquez S and Santos Y. 2003. Detection of Flexibacter maritimus in fish tissue using nested PCR amplification. J Fish Dis 26, 65-70. https://dx.doi.org/10.1046/ j.1365-2761.2003.00431.x. CLSI (Clinical and Laboratory Standards Institute). 2017. Performance standards for antimicrobial susceptibility testing, 28th edition [Internet]. Retrieved from www.clsi.org on Jun 14, 2018. Demircan D and Candan A. 2006. Identification of Vibrio anguilliarum by PCR (rpon Gene) associated with Vibriosis in marine fish in Turkey. Turk J Vet Anim Sci 30, 305-310. Domeenech A, Derenaaandez-Garayzabal JF, Pascual C, Garcia JA, Cutuli MT, Moreno MA, Collins MD and Dominguez L. 1996. Streptococcosis in cultured turbot, Scopthalmus maximus, associated with Streptococcus parauberis. J Fish Dis 19, 33-38. https://dx.doi.org/10.1111/j.1365-2761.1996. tb00117.x. Eldar A and Ghittino C. 1999. Lactococcus garvieae and Streptococcus iniae infections in rainbow trout Oncorhynchus mykiss: similar, but different diseases. Dis Aquat Org 36,
Erythromycin 내성유전자분석 403 227-231. https://dx.doi.org/10.3354/dao36227. Han AR, Yoon YJ and Kim JW. 2012. Antibiotic Resistance and Plasmid Profile of Vibrio parahaemolyticus Strains Isolated from Kyunggi-Incheon Coastal Area. Kor J Microbiol 48, 22-28. https://dx.doi.org/10.7845/kjm.2012.48.1.022. Hansen LH, Mauvais P and Douthwaite S. 1999. The macrolide-ketolide antibiotic binding site is formed by structures in domains II and V of 23S ribosomal RNA. Mol Microbiol 31, 623-631. https://dx.doi.org/10.1046/j.1365-2958.1999.01202.x. Hiroshi N. 1996. Multidrug Efflux Pumps of Gram-Negative Bacteria. J Bacteriol 178, 5853-5859. Jeong YU, Kang CY, Kim MJ, Heo MS, Oh DC and Kang BJ. 2006. Characterization of Streptococcosis occurrence and molecular identification of the pathogens of cultured flounder in Jeju island. J Microbiol 42, 199-204. Jo MR. 2006. Rapid molecular identification and antibiotic resistance of Vibrio spp. Isolated from the farmed olive flounders in Jeju island, Korea. Master s Thesis, Jeju National University, Jeju, Korea. Jun LJ. 2010. Characterization of antibiotic resistant genes carried by fish pathogens in Korea. Ph. D. Thesis, Pukyong National University, Busan, Korea. Kim HJ, Ryu JO, Lee SY, Kim ES and Kim HY. 2015. Multiplex PCR for detection of the Vibrio genus and five pathogenic Vibrio species with primer sets designed using comparative genomics. BMC Microbiol 15, 239. https://dx.doi. org/10.1186/s12866-015--577-3. Kim MS, Cho JY and Choi HS. 2014. Identification of Vibrio harveyi, Vibrio ichthyoenteri and Photobacterium damselae isolated from olive flounder Paralichthys olivaceus in Korea by multiplex PCR developed using the rpob gene. J Fish Sci 80, 333-339. https://dx.doi.org/10.1007/s12562-014-0702-5. Lee SY and Kim YH. 2013. Incidence of Erythromycin Resistance Genes, erm(b) and mef(a), in Streptococci Isolated from Dental Plaques of Koreans. Int J Oral Biol 38, 61-65. https://dx.doi.org/ 10.11620/IJOB.2013.38.2.061. Lee DW, Jun LJ and Jeong JB. 2016. Distribution of Tetracycline Resistance Genes in Pathogenic Bacteria Isolated from Cultured Olive Flounder (Paralichthys olivaceus) in Jeju in 2016. JFMSE 29, 834-846. https://dx.doi.org/10.13000/ JFMSE.2017.29.3.834. Lee HI, Jung JH, Lee SJ and Choi SS. 2010a. Analysis of Genotype and Phenotype of Erythromycin Resistance in Enterococci spp. Isolated from Raw Milk Samples. Kor J Microbiol 46, 148-151. Lee HY, Lim JE, Kim SC, Kim KR, Lee SS, Kwon OK, Yang JE and Ok YS. 2010b. Environmental Monitoring of Selected Veterinary Antibiotics in Soils, Sediments and Water Adjacent to a Poultry Manure Composting Facility in Gangwon Province, Korea. J Korean Soc Environ Eng 32, 278-286. Luna VA, Coates P, Eady EA, Cove JH, Nguyen TH and Roberts MC. 1999. A variety of Gram-positive bacteria carry mobile mef genes. J Antimicro Chemother 44, 19-25. https://dx.doi. org/10.1093/jac/44.1.19. Nonaka L, Maruyama F, Suzuki S and Masuda M. 2015. Novel macrolide-resistance genes, mef (C) and mph (G), carried by plasmids from Vibrio and Photobacterium isolated from sediment and seawater of a coastal aquaculture site. Appl Microbiol 61, 1-6. https://onlinelibrary.wiley.com/doi/ abs/10.1111/lam.12414. Portillo A, Ruiz-Larrea F, Zarazaga M, Alonso A, Martinez JL and Torres C. 2000. Macrolide Resistance Genes in Enterococcus spp.. Antimicrob Agents Chemother 44, 967-971. https://dx.doi.org/10.1128/aac.44.4. Sakai T, Iida T, Osatomi K and Kanai K. 2007. Detection of type 1 fimbrial genes in fish pathogenic and non-pathogenic Edwardsiella tarda strains by PCR. Fish Pathol 42, 115-117. https://dx.doi.org/ 10.3147/jsfp.42.115. Sapkota AR, Ojo KK, Roberts MC and Schwab KJ. 2006. Antibiotic resistance genes in multidrug-resistant Enterococcus spp. And Streptococcus spp. Recovered from the indoor air of a large-scale swine-feeding operation. Lett Appl Microbiol 43, 534-540. https://dx.doi.org/10.1111/j.1472-765x. 2006.01996.x. Sung CH, Chon JW, Kwak HS, Kim HS and Seo KH. 2013. Prevalence and Antimicrobial Resistance of Enterococcus faecalis and Enterococcus faecium Isolated from Beef, Pork, Chicken and Sashimi. Korean J Food Sci 33, 133-138. https://dx.doi.org/ 10.5851/kosfa.2013.33.1.133. Thompson FL, Iida T and Swings J. 2004. Biodiversity of Vibrios. Microbiol Mol Biol Rev 68, 403-431. https://dx.doi. org/10.1128/mmbr.68.3. Woo SH, Kim HJ, Lee JS, Kim JW and Park SI. 2006. Pathogenicity and classification of streptococci isolated from cultured marine fishes. J Fish Pathol 19, 17-33.