식물병연구 Research Article Open Access Res. Plant Dis. 21(4) : 315-320(2015) http://dx.doi.org/10.5423/rpd.2015.21.4.315 Reverse transcription Loop-mediated isothermal amplification Soybean mosaic virus Detection of Soybean mosaic virus by Reverse Transcription Loop-mediated Isothermal Amplification 1 2 2 1 1 1 Bishwo P. Mainali 1 1 2 * 1 1, 2 *Corresponding author Tel : +82-53-950-5763 Fax: +82-53-950-6758 E-mail: suheon@knu.ac.kr Yeong-Hoon Lee 1, Dae-Hyeon Bae 2, Bong-Sub Kim 2, Young-Nam Yoon 1, Soon-Do Bae 1, Hyun-Joo Kim 1, Bishwo P. Mainali 1, In-Hee Park 1, Su-Heon Lee 2 * and Hang-Won Kang 1 1 Crop Production Technology Research Division, National Institutes of Crop Science, Rural Development Administration, Miryang 627-803, Korea 2 School of Applied bioscience, Kyungpook National University, Daegu 702-701, Korea Received August 22, 2015 Revised October 17, 2015 Accepted November 12, 2015 Soybean mosaic virus (SMV) is a prevalent pathogen that causes significant yield reduction in soybean production worldwide. SMV belongs to potyvirus and causes typical symptoms such as mild mosaic, mosaic and necrosis. SMV is seed-borne and also transmitted by aphid. Eleven SMV strains, G1 to G7, G5H, G6H, G7H, and G7a were reported in soybean varieties in Korea. A reverse transcription loop-mediated isothermal amplification (RT-LAMP) method allowed one-step detection of gene amplification by simple procedure and needed only a simple incubator for isothermal template. This RT-LAMP method allowed direct detection of RNA from virus-infected plants without thermal cycling and gel electrophoresis. In this study, we designed RT-LAMP primers named SML-F3/B3/FIP/BIP from coat protein gene sequence of SMV. After the reaction of RT-LAMP, products were identified by electrophoresis and with the detective fluorescent dye, SYBR Green I under daylight and UV light. Optimal reaction condition was at 58 o C for 60 min and the primers of RT-LAMP showed the specificity for nine SMV strains tested in this study. Keywords : Detection, RT-LAMP, SMV, Soybean, Virus (Glycine max) (Rosales) (Leguminosae), 550 13,000, 36 92. Research in Plant Disease The Korean Society of Plant Pathology pissn 1598-2262, eissn 2233-9191, (Ann, 2012). (Soybean mosaic virus, SMV) Potyviridae, Potyvirus, 43%.,, (Domier, 2007, 2011). SMV 11 This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
316 Research in Plant Disease Vol. 21 No. 4, (Seo, 2009). Enzyme-Linked Immuno Sorbent Assay(ELISA) Reverse Transcription- Polymerase Chain Reaction(RT-PCR). ELISA (Lee, 2010). RT-PCR, (Li Mock, 2005).. Notomi (2000) strand displacement activity Bst polymerase loop Loop-mediated isothermal amplification(lamp). PCR 2 primer, LAMP 6 4 primer., template 1 10 9-10 10, DNA. PCR (denaturation), (annealing), (extention), (Blomstrom, 2008; Nagamine, 2002). RNA DNA., RT-LAMP LAMP RT LAMP RT- LAMP (Fukuta, 2003; Parida, 2004). heating block Thermocycler. SYBR Green I ethidium bromide(etbr),.,, RT-LAMP SMV. 시험재료. SMV 2013 9 SMV. (-70 o C). 전체 RNA 분리. 100 mg Lysis (intron bio., Korea). RNA 30 ml elution buffer RT-LAMP RT-PCR. RT-LAMP primer 제작. primer NCBI GeneBank SMV 11 G1(Accession no. FJ640977), G2(S42280), G3(FJ640978), G4(FJ640979), G5(AY294044), G6(FJ640980), G7(AY216010), G5H(FJ376388), G6H(FJ640981), G7A(FJ640982), G7H(AY294045) SMV TNP(HQ845735) DNASTAR(DNASTAR, Inc., USA). LAMP primer designing software Primer Explorer(http://primerexplorer.jp/e/index.html) RT-LAMP primer. 4 SMV RT-LAMP primer SML-FIP SML-BIP loop TTTT spacer 42 nt, SML-F3 SML-B3 inner primer 18 nt, 19 nt (Table 1). primer Bioneer(Daejeon, Korea), inner primer PAGE. 최적조건확립. RT-LAMP RT-LAMP kit(eiken Chemicals Co., Japan). RT-LAMP kit. total RNA 1 ml 40 pm inner primers, 5 pm outer primers, 8 U Bst DNA polymerase large fragment(new England Biolabs, USA), 1 Table 1. Specially designed set of four target-specific primers (F3, B3, FIP and BIP) Virus (NCBI No.) Primers Length Sequence (5 3 ) SMV (HQ845735) SML-F3 18 GACGATGAACAGATGGGC SML-B3 19 TCTCAGAGTTGGTTTTGCA SML-FIP 42 GCATCTGGAGATGTGCTTTTGTGGTTATGAATGGTTTCATGG SML-BIP 42 GCGTGTGGGTGATGATGGATTTTTTCGACAATGGGTTTCAGC
Research in Plant Disease Vol. 21 No. 4 317 ThermoPol Reaction Buffer [20 mm Tris-HCl, 10 mm KCl, 10 mm (NH 4 ) 2 SO 4, 2 mm MgSO 4, 0.1% Triton X-100, New England Biolabs, USA], 10 mm dntp, 5% DMSO, DW 20 ml. 48-66 o C, 10-120. 80 o C 10. LAMP 2% agarose gel (HOEFER, USA) EtBr. Primer 의특이성확인. primer. 6 SMV Soybean yellow mottle mosaic virus(symmv), Soybean yellow common mosaic virus(sycmv), Peanut stunt virus(psv), Bean common mosaic virus(bcmv) Peanut mottle virus(pemov). SMV 9 G1, G2, G3, G5, G5H, G6, G6H, G7 G7H., RT-LAMP primer primer. Fig. 1. Optimal reaction temperature of RT-LAMP. LAMP was performed under range of 48 to 66 o C. Lane M, 100 bp DNA ladder (Solgent, Korea); lanes 1-7 (48, 51, 54, 57, 60, 63 and 66 o C, respectively); lane 8, negative control. 민감도확인. RT-LAMP total RNA RNA mrna, SMV RT-LAMP DNA clone. DNA clone primer SM_LN2(5 -GTA CAA TGC AGT TAA AGA TGA ATA- 3 ) SM_LC2 (5 -TCT CAA ATT CCT CAG TAG TCC ATA 3 ). DNA clone 110 0 110-7 RT-LAMP RT-PCR. 기기에따른재현성확인. Thermocycler (Applied Biosystems, USA), (EYELA, Japan) heating block(seoulin Bio, Korea). 육안확인. SYBR Green I(Lonza, USA) tube., portable UV light(spectronic, USA), UV transilluminator(corebiosystem, Korea). RT-LAMP 48- Fig. 2. Optimal reaction time of RT-LAMP. LAMP was performed under range of 10 to 120 min. Lane M, 100 bp DNA ladder; lanes 1-8 (10, 20, 30, 40, 50, 60, 90 and 120 min, respectively); lane 9, negative control. 66 o C. 51 o C 63 o C, 57-60 o C (Fig. 1). 58 o C. 10, 20, 30, 40, 50, 60, 90, 120. 30, 60 (Fig. 2). 60. Primer 6 SMV SMV RT-LAMP primer (Fig. 3). SMV 9 G1, G2, G3, G5, G5H, G6, G6H, G7 G7H (Fig. 4). primer SMV
318 Research in Plant Disease Vol. 21 No. 4 Fig. 3. Specific reaction of primers for target virus. Lane M, 100 bp DNA ladder; lane 1, SMV; lane 2, SYMMV; lane 3, SYCMV; lane 4, PSV; lane 5, BCMV; lane 6, PeMoV; lane 7, negative control. Fig. 5. Requirements for four LAMP primers. Lane M, 100 bp DNA ladder; lane 1, negative control; lane 2, B+C+D; lane 3, A+C+D; lane 4, A+B+C+D lane 5, C+D; lane 6, A+B(A: FIP, B: BIP, C: F3, D: B3). Fig. 4. Specific reaction of primers for nine Soybean mosaic virus strains. Lane M, 100 bp DNA ladder; lanes 1-9 (SMV strain G1, G2, G3, G5, G5H, G6, G6H, G7 and G7H, respectively); lane 10, negative control.. SMV, 9. 4 SMV RT-LAMP primer primer 4 primer positive control. SMV RT-LAMP 4 primer (Fig. 5). RT-LAMP total RNA RNA mrna, SMV RT- LAMP DNA clone. DNA clone product size 295 bp, 147 ng/ul. DNA clone 110 0 110-7 RT-LAMP Fig. 6. Sensitivities of (A) RT-LAMP and (B) RT-PCR for detection of Soybean mosaic virus. LAMP was performed under 58 o C and 60 min. Lane M, 100 bp DNA ladder; lanes 1-8 (1 10 0,1 10-1,1 10-2,1 10-3, 1 10-4,1 10-5, 1 10-6 and 1 10-7, respectively). RT-PCR RT-LAMP 110-5 (Fig. 6A). RT-PCR 110-4 RT-LAMP 10 (Fig. 6B). RT-LAMP Thermocycler. heating block Thermocycler. 58 o C, 60 (Fig. 7)., SYBR Green I
Research in Plant Disease Vol. 21 No. 4 319 Fig. 7. Specific reaction of primers depends on using machine. The total RNA from infected plant by SMV and healthy plant were used as a positive and negative control, respectively. Lane M, 100 bp DNA ladder; lanes 1-2 (positive and negative control in Thermocycler machine); lanes 3-4 (positive and negative control in water bath); lanes 5-6 (positive and negative control in heating block). Soybean mosaic virus(smv) potyvirus,,, 11 (G1 to G7, G5H, G6H, G7H, G7a). Reverse transcription loop-mediated isothermal amplification(rt-lamp), PCR. RT-LAMP 58 o C, 60. SMV 9. SMV RT-LAMP primer, SMV. heating block Thermocycler. RT- LAMP, SYBR Green I UV.,, portable UV light UV transilluminator. Acknowledgement This study was carried out with the support of Research & Development Program (Project No. PJ01124902) of National Institute of Crop Science, RDA, Republic of Korea. References Fig. 8. Fluorescent dye mediated visual detection for RT-LAMP. The total RNA from infected plant by SMV and healthy plant were used as a positive and negative control, respectively. A: Fluorescent detection from positive (white, left) and negative (colorless, right) under UV transilluminator; B: Fluorescent detection from positive (green, left) and negative (colorless, right) under portable UV light; C: Naked-eye detection from positive (green, left) and negative (yellow, right) under normal light. tube., portable UV light UV transilluminator. portable UV light UV transilluminator (Fig. 8). viral RNA. Ann, Y. G. 2012. Jang(Fermented Soybean) in official and royal documents in Chosun dynasty period. Korea J. Food Nutr. 25: 368-382. Blomstrom, A. L., Hakhverdyan, M., Reid, S. M., Dukes, J. P., King, D. P., Belak, S. and Berg, M. 2008. A one-setpreverse transcriptase loop-mediated isothermal amplificationassay for simple and rapid detection of swimevesicular disease virus. J. Virol. Meth. 147: 188-193. Domier, L. L., Steinlage,T. A., Hobbs, H. A., Wang, Y., Herrera-Rodriguez, G., Haudenshield, J. S., McCoppin, N. K. and Hartman, G. L. 2007. Similarities in seed and aphid transmission among Soybean mosaic virus isolates. Plant Dis. 91: 546-550. Domier, L. L., Hobbs, H. A., McCoppin, N. K., Bowen, C. R., Steinlage, T. A., Chang, S. Y., Wang, Y. and Hartman, G. L. 2011. Multiple loci condition seed transmission of Soybeanmosaic virus (SMV) and SMV-induced seed coat mottling in soybean. Phytopathology 101: 750-756. Fukuta, S., Iida, T., Mizukami, Y., Ishida, A., Ueda, J., Kanbe, M. and Ishimoto, Y. 2003. Detection of Japanese yam mosaic virus by RT-
320 Research in Plant Disease Vol. 21 No. 4 LAMP. Arch Virol. 148: 1713-1720. Lee, H. I., Kim, J. H. and Yea, M. C. 2010. Immunocapture RT-PCR for detection of seed-borne viruses on cucurbitaceae crops. Res. Plant Dis. 16: 121-124. Li, R. and Mock, R. 2005. An imporved reverse transcription polymerase chain reaction(rt-pcr) assay for the detection of two cherry flexiviruses in Prunus spp. J. Virol. Meth. 129: 162-169. Nagamine, K., Hase, T. and Notomi, T. 2002. Accelerated reactionby loop-mediated isothermal amplification using loop primers. Mol. Cell. Probes. 16: 223-229. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N. and Hase, T. 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28: e63. Parida, M., Posadas, G., Inoue, S., Hasebe, F. and Morita, K. 2004. Real-time reverse transcription loop-mediated isothermal amplification for rapid detection of West Nile virus. J. Clin. Microbiol. 42: 257-263. Seo, J. K., Ohshima, K., Lee, H. G., Son, M., Choi, H. S., Lee, S. H., Sohn, S. H. and Kim, K. H. 2009. Molecular variability and genetic structure of the population of Soybean mosaic virus based on the analysis of complete genome sequences. Virol. J. 393: 91-103.