untitled
|
|
- 유석 사
- 5 years ago
- Views:
Transcription
1 대한수혈학회지 : 제 29 권제 1 호, 2018 The Korean Journal of Blood Transfusion Vol. 29, No. 1, 33-40, April pissn eissn Original Article 실험실에서자체설계한 HTLV PCR 에서의내부정도관리물질제조및적용 강정원 1 ㆍ신선미 1 ㆍ강재원 1 ㆍ서영익 1 ㆍ민혁기 1 ㆍ허광 2 대한적십자사혈액수혈연구원 1, 대한적십자사남부혈액검사센터 2 Construction and Application of Internal Control for Laboratory-Developed HTLV PCR Jungwon Kang 1, Sun-Mi Shin 1, Jae-Won Kang 1, Young Ik Seo 1, Hyukki Min 1, Kwang Huh 2 Blood Transfusion Research Institute, Korean Red Cross 1, Wonju, Nambu Blood Laboratory Center, Korean Red Cross 2, Busan, Korea Background: For donor samples showing reactive results in a human T-cell lymphotropic virus (HTLV) antibody test along with indeterminate results in Western blot assay, HTLV nucleic acid amplification test using laboratory-developed polymerase chain reaction (PCR) was performed. It is necessary to construct an adequate internal control (IC) to evaluate the accuracy of the results since we did not use an IC in the laboratory-developed PCR. Methods: As a competitive IC, plasmid DNA containing the primer recognition sequence for amplification of the HTLV px region was constructed. We determined the adequate concentration of the IC, which was added to the samples to evaluate the accuracy of the test results. Results: When the plasmid DNA was added to the HTLV-positive samples, the amplified product of IC (400 bp) was detected with the HTLV gene (230 bp). The adequate concentration of plasmid DNA added as an IC was 1 pg. Conclusion: The construction of plasmid DNA as a competitive IC is an efficient method to evaluate accuracy of the test results. However, the production process for the competitive IC must be further developed. Therefore, it is necessary to compare with the performance of a non-competitive IC. (Korean J Blood Transfus 2018;29:33-40) Key words: HTLV, Laboratory-developed PCR, Internal control 서론 대한적십자사에서는 2009 년 4 월부터혈장성분 헌혈자를제외한모든헌혈자에대하여사람 T림프구영양성바이러스 (human T-cell lymphotropic virus, HTLV) 에대한선별검사를실시하고있다. 선 Received on February 9, Revised on March 23, Accepted on April 2, 2018 Correspondence to: Jae-Won Kang Blood Transfusion Research Institute, Korean Red Cross, 50 Hyeoksin-ro, Wonju 26465, Korea Tel: , Fax: , kangjaewon@redcross.or.kr, ORCID: This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Copyright C 2018 The Korean Society of Blood Transfusion
2 Korean J Blood Transfus Vol. 29, No. 1, 33-40, Apr 별검사는화학발광면역법을이용한 HTLV-I/II 항체검사 (HTLV-I/II antibody, anti-htlv-i/ii) 를실시하며, anti-htlv-i/ii에서양성결과를보인경우웨스턴블롯에의한확인검사를실시하고있다 [1]. 웨스턴블롯결과양성을보인경우헌혈이영구적으로보류되며, 음성을보인경우에는 6개월이상경과후선별검사에적용한방법과동일한방법의 anti-htlv-i/ii를실시하여그결과에따라헌혈가능여부가결정된다. 2015년까지는확인검사로핵산증폭검사도같이실시하였으나, 그동안의검사결과및운영상의효율성을고려하여 [2] 2016년부터는웨스턴블롯미결정결과를보인경우에만핵산증폭검사를실시하고있다. 이검사에서양성결과를보일경우에는헌혈이영구보류, 음성일경우에는이후안전성검사결과에따라헌혈가능여부가결정된다. 혈액을시료로하는핵산증폭검사시혈액내에존재하는물질중항응고제로사용되는 EDTA 또는 heparin, 적혈구의 hemoglobin, 혈장에포함된 IgG, lactoterrin 등이핵산증폭반응을저해하는저해제로작용할가능성이있다 [3-9]. 이들이저해제로작용할경우양성검체임에도불구하고불완전한반응으로인한위음성결과를보일가능성이있다. 따라서 international standard organization 의가이드라인에서는이들저해제로인한위음성결과의여부를확인하기위하여내부정도관리물질 (internal control, IC) 을채택할것을권고하고있다 [10]. 현재 HBV, HCV 및 HIV에대한헌혈자선별검사에적용하는핵산증폭검사의경우에는상용화된검사시약을사용하고있으며, 이에는합성 oligonucleotide로제조된 IC가포함되어있어, 검사시각각의개별검체에 IC를첨가하도록되어있으며, 음성결과를보일경우 IC에대한값이양성이어야유효한것으로판정된다 [11]. HTLV 검사를위한핵산증폭검사는현재공인 기관의인가를받은상용화시약이존재하지않아, 현재 HTLV 헌혈자선별검사양성검체에대한확인검사로적용하고있는핵산증폭검사는실험실에서자체적으로설계한중합효소연쇄반응 (laboratory developed polymerase chain reaction, laboratory-developed PCR) 에의한방법을채택하고있다. 따라서, 상용화된검사시약에일반적으로포함되어있는 IC를사용하고있지않기때문에, 음성결과의경우병원체미존재로인한음성결과인지, 불완전한반응으로인한음성결과인지에대한검증이부족하다고여겨질수있다. 이에본연구에서는 laboratory-developed PCR에적용이가능한 IC를제조하였으며, 이의적용가능성과적절한적용방법을검토하였다. 재료및방법 1. HTLV 양성및음성검체본연구에사용된검체는대한적십자사혈액검사센터로부터본원으로확인검사가의뢰된헌혈자전혈검체중양성으로판정된검체와음성으로판정된검체를대한적십자사혈액관리본부의생명윤리심의위원회를득한후사용하였다. 2. HTLV Nested PCR의조건핵산추출은 MagNa Pure DNA isolation kit (Roche Diagnostics GmbH, Mannheim, Germany) 를이용하였으며, HTLV 감염의확인을위한유전자증폭은 Matsumoto C 등의방법을적용하여 HTLV의 px 영역의 230 bp를표적으로한 nested PCR을채용하였으며, 이에사용한 primer는 Table 1과같다 [12]. 1차 PCR 반응액은 AmpliTaq Gold 360 Master Mix (Applied Biosystems, CA, USA) 와 external primer set (Bioneer, Deajeon, Korea) 을사용
3 강정원외 : 실험실에서자체설계한 HTLV PCR 에서의내부정도관리물질제조및적용 하여총 25 L에맞추었고, 핵산증폭은 C1000 Thermal cycler (Bio-rad, CA, USA) 를이용하여 95 o C에서 2분간변성시킨후 95 o C 에서 30초, 61 o C에서 30초, 72 o C에서 1분으로 30회반복후 72 o C에서 5분간항온하였다. 2차 PCR 반응액은 external primer set 대신에 internal primer set를사용한것이외에는 1차 PCR과동일하게진행하였다. 증폭산물의확인을위한전기영동은 Lab Chip GX (Caliper Life Science, MA, USA) 을이용하였다. 3. IC의제조 IC는 Fig. 1과같이 HTLV 표적부위증폭에사용하는 primer 염기서열을양단에포함하면서증폭산물의크기와내부의염기서열이다른재조합플라스미드를제조하였다. px1과 px2를이용한 external fragment는 600 bp, px3과 px4를이용한 internal fragment는 400 bp가되도록 pbha 플라스미드에삽입하였다. 이 100 ng, 10 ng, 1 ng, 0.1 ng, 0.01 ng이되도록하였다. 이에 IC의농도를마찬가지로 200 ng/ L stock을 50 ng/ L로조정하여, 1/10로계대희석한후, 2 L씩처리하여각각의 IC양이 100 ng, 10 ng, 1 ng, 0.1 ng, 0.01 ng, ng, ng이되도록조절한후첨가하여 HTLV의유전자증폭산물과 IC가모두정확하게나타나는농도를설정하였다. 5. IC 적용및미적용시의 HTLV PCR 검출한계농도확인 HTLV PCR 검출한계농도를확인하기위해서 HTLV 양성검체의핵산을 0.5 ng/ L로조정하여, 4. IC 적용을위한최적조건확인 IC 적용을위한최적조건확인은 Abdulmawjood A 등의방법을적용하였다 [13]. HTLV 양성전혈검체의핵산을추출하여 ND-1000 Spectrophotometer (NanoDrop Technologies, DE, USA) 를이용하여정량하였다. 양성검체의핵산은 50 ng/ L 로조정하여, 1/10로계대희석한후, PCR 반응시희석한 DNA를 2 L씩처리하여각각의 DNA양 Fig. 1. Internal control for the determination of HTLV. Table 1. HTLV-I in laboratory-developed PCR (nested PCR) primer set Target Primer Sequence (5 3 ) Amplicon size (bp) External px1 AGGGTTTGGACAGAGTCTT px2 AAGGACCTTGAGGGTCTTAG Internal px3 CTTTTCGGATACCCAGTCYAC 230 px4 GGTTCTCTGGGTGGGGAAGGAG
4 Korean J Blood Transfus Vol. 29, No. 1, 33-40, Apr /10씩계대희석한후, PCR 반응시희석한 DNA 를 2 L씩처리하여각각의 template DNA양이 1 ng 부터 ng 이되도록하여 HTLV nested PCR을수행하였다. 결과 1. 재조합플라스미드의확인제조된재조합플라스미드에대하여 nested PCR 실시결과 400 bp의최종증폭산물이확인되어, HTLV 유전자증폭시사용되는 primer 인식부위를포함하면서크기가다른유전자증폭산물이포함된플라스미드 DNA가적합하게제조되었음을확인하였다 (Fig. 2). 2. IC 효과확인 HTLV 양성및음성검체에플라스미드 DNA 를첨가후증폭반응을한결과양성검체에서는 400 bp의플라스미드증폭산물과 230 bp의 HTLV 유전자증폭산물이검출되고, 음성검체에서는플라스미드의증폭산물만검출되어제조된플라스미드 DNA가 IC로서의역할을할수있음을확인하였다 (Fig. 3). 3. 적정 IC 첨가농도확인 HTLV PCR 양성검체와내부정도관리물질을각각계대희석하여혼합한검체에대한증폭반응결과양성검체및내부정도관리물질이모두정확하게검출되는농도는내부정도관리물질의농도가 1 pg일때로나타났다 (Fig. 4). 4. IC 적용및미적용시의 HTLV PCR 검출한계농도확인 HTLV PCR 검출한계농도를확인하기위해서 HTLV 양성전혈검체의 DNA를 ND-1000 Spectrophotometer (NanoDrop Technologies, DE, USA) 를 Fig. 2. Electrophoresis of PCR product of plasmid DNA as an internal control. Lane M, DNA ladder; Lane 1, Amplified product of plasmid DNA for internal control. Fig. 3. Electrophoresis of PCR product of plasmid DNA as an internal control in the HTLV positive and negative sample. Lane M, DNA ladder; Lane 1, HTLV positive sample without internal control; Lane 2, HTLV negative sample without internal control; Lane 3, HTLV positive sample with internal control; Lane 4, HTLV negative sample with internal control
5 강정원외 : 실험실에서자체설계한 HTLV PCR 에서의내부정도관리물질제조및적용 이용하여정량하였다. 양성검체의핵산은 0.5 ng/ L로조정하여, 1/10씩계대희석한후, PCR 반응시희석한 DNA를 2 L씩처리하여각각의 template DNA양이 1 ng부터 ng이되도록하여 HTLV nested PCR을수행하였다. 그결과 0.1 ng이검출한계농도인것으로나타났으며, 해당농도에서 IC를적용할때도양성인결과를나타냈다 (Fig. 5). Fig. 4. Determination of adequate concentration of plasmid DNA for the application of internal control in HTLV nested PCR. Lane M, DNA ladder; Lane 1, 100 ng of plasmid DNA addition; Lane 2, 10 ng of plasmid DNA addition; Lane 3, 1 ng of plasmid DNA addition; Lane 4, 100 pg of plasmid DNA addition; Lane 5, 10 pg of plasmid DNA addition; Lane 6, 1 pg of plasmid DNA addition. 결론본연구는본원에서자체적으로설계하여실시하고있는 HTLV nested PCR에적용이가능한 IC 의제조를위하여 HTLV 유전자증폭에사용되는 primer와동일한염기서열을포함하면서증폭산물의크기가다른재조합플라스미드를제조하여이를검체에첨가후표적이되는병원체와같이 Fig. 5. Determination of detection limit in the laboratory developed HTLV PCR with IC and without IC. (A) Electrophoresis of PCR products of HTLV positive samples which were amplified with IC. (B) Electrophoresis of PCR products of HTLV positive samples which were amplified without IC. Lane M, DNA ladder; Lane 1, PCR product of 1 ng of template DNA; Lane 2, PCR product of ng of template DNA; Lane 3, PCR product of ng of template DNA; Lane 4, PCR product of ng of template DNA; Lane 5, PCR product of ng of template DNA; Lane 6, PCR product of ng of template DNA; Lane 7, PCR product of ng of template DNA; Lane 8, PCR product of ng of template DNA; Lane 9, PCR product of ng of template DNA; Lane 10, PCR product of ng of template DNA. Abbreviation: IC, internal control
6 Korean J Blood Transfus Vol. 29, No. 1, 33-40, Apr 증폭이될수있도록하였다. 따라서 IC의증폭이없는경우에는음성결과라할지라도증폭반응의불완전으로인한음성결과임을알수있도록하였다. 병원체검출을위한핵산증폭검사시상용화된검사시약의경우는 IC가포함되어있으나, 실험실또는검사실에서자체적으로설계한 PCR의경우는 IC를적용하지않는경우가많다. 그러나검사결과의보증, 특히음성검체에대한검증을위하여는실험실에서자체설계한 PCR이라하더라도 IC의적용이필요하다. 이러한 PCR로의적용을위한 IC로는본연구에서제작한것과같이표적이되는유전자의증폭을위한 primer와동일한염기서열을포함하는합성 oligonucleotie를이용하는 competitive IC와 universal 또는 housekeeping gene을표적대상유전자와같이증폭을하는 noncompetitive IC가있다 [14,15]. 일반적으로사용하는 noncompetitive IC는 beta-2-microglobulin, Glyceraldehyde 3-phosphate dehydrogenase, 18S ribosomal RNA 또는 albumin을 coding하는 house-keeping 유전자영역을증폭대상으로하며별도의 IC제조를위한단계가필요하지않다는장점이있다 [16]. 그러나 Noncompetitive IC는서로다른염기서열의 primer를첨가하여증폭반응을일으키기때문에이로인한간섭반응과비특이적반응이발생할수있는문제점이있다 [10,17]. Competitive IC의농도가높을경우표적이되는병원체유전자의증폭을위하여결합하여야하는 primer 가 IC에주로결합하여결과적으로표적이되는병원체유전자의증폭을방해할수있기때문에 [17] competitive IC를적용할경우적절한 IC 첨가농도를설정해주어야하며, 본연구에서도 IC를 100 ng 첨가했을때에는 HTLV 양성검체에서도 HTLV 유전자의증폭산물을확인할수없었고, 0.1 ng 정도첨가하였을때에 IC와 HTLV 유전자 가모두증폭됨을확인하였다. 효과적인운영을위해서는 noncompetitive IC에대한적용효과의비교가필요할것으로사료되었다. 일반적인헌혈자선별검사로적용하는 HBV, HCV 및 HIV에대한핵산증폭검사의경우공인기관의인증을받은상용화시약이존재하며, 검사결과를보증할수있는체계가갖추어져있지만, 일부국가또는기관에서적용하는병원체유전자검사의경우에는대부분실험실내에서설계하여적용하여야할때가많다. 특히수혈매개가능신종감염병병원체에대한유전자검사필요시에는대부분실험실에서자체적으로설계한방법을활용해야될경우가많을것으로사료되었다. 이러한경우에도검사결과의보증을위한체계구비를위하여이와같은 IC의적용을고려할수있을것으로판단되었다. 요약배경 : HTLV 항체선별검사에서양성결과를보이면서웨스턴블롯에서미결정결과를보인헌혈자검체에대하여자체적으로설계한연쇄중합효소반응 (PCR) 을이용하여 HTLV 핵산증폭검사를실시하고있다. 그러나자체설계한 PCR에서는내부정도관리물질을사용하고있지않아, 검사결과를보증할수있는내부정도관리물질의구축이필요한것으로판단되었다. 방법 : 경쟁적내부정도관리물질로 HTLV의 px 영역증폭에사용하는 primer 인식부위를포함하는플라스미드 DNA를제조하였다. 그리고검사결과의보증을위하여검체에첨가되는내부정도관리물질의적절한농도를설정하였다. 결과 : 플라스미드 DNA를 HTLV 양성검체에첨가시, 400 bp의내부정도관리물질증폭산물이 230 bp의 HTLV 유전자와같이검출되었다. 내부
7 강정원외 : 실험실에서자체설계한 HTLV PCR 에서의내부정도관리물질제조및적용 정도관리물질로서의플라스미드 DNA의적절한첨가농도는 1 pg으로나타났다. 결론 : 경쟁적내부정도관리물질로서의플라스미드 DNA의제조는검사결과보증에효과적인것으로여겨졌다. 그러나경쟁적내부정도관리물질의경우별도의제조과정을거쳐야하므로, 별도의제조과정이필요없는비경쟁적내부정도관리물질의성능과비교할필요도있을것으로사료되었다. References 1. Kwon SY, Lim AH, Park JY, Han SH, Cho NS. Seroprevalence of human T-lymphotropic virus type 1 and 2 in Korean blood donors. J Med Virol 2008;80: Youn KW, Kang JW, Kwon SY, Oh DJ. Consideration of the improvement of the confirmatory assay for the anti-htlv positive blood donation. Korean J Blood Transfus 2015;26: Promega corporation. An introduction to PCR inhibitors. files/resources/profiles-in-dna/1001/an-intro duction-to-pcr-inhibitors.pdf?la=es-es [Online] (last visited on 23 March 2018) 4. Pallen MJ, Puckey LH, Wren BW. A rapid, simple method for detecting PCR failure. PCR Methods Appl 1992;2: Al-Soud WA, Rådström P. Purification and characterization of PCR-inhibitory components in blood cells. J Clin Microbiol 2001;39: Beutler E, Gelbart T, Kuhl W. Interference of heparin with the polymerase chain reaction. Biotechniques 1990;9: Holodniy M, Kim S, Katzenstein D, Konrad M, Groves E, Merigan TC. Inhibition of human immunodeficiency virus gene amplification by heparin. J Clin Microbiol 1991;29: Ijzerman MM, Dahling DR, Fout GS. A method to remove environmental inhibitors prior to the detection of waterborne enteric viruses by reverse transcription-polymerase chain reaction. J Virol Methods 1997;63: Kreader CA. Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein. Appl Environ Microbiol 1996;62: Hoorfar J, Malorny B, Abdulmawjood A, Cook N, Wagner M, Fach P. Practical considerations in design of internal amplification controls for diagnostic PCR assays. J Clin Microbiol 2004; 42: U.S. Food and Drug Administration. Procleix Ultrio Plus assay. loads/scienceresearch/fieldscience/ucm [Online] (last visited on 23 March 2018) 12. Matsumoto C, Mitsunaga S, Oguchi T, Mitomi Y, Shimada T, Ichikawa A, et al. Detection of human T-cell leukemia virus type I (HTLV-I) provirus in an infected cell line and in peripheral mononuclear cells of blood donors by the nested double polymerase chain reaction method: comparison with HTLV-I antibody tests. J Virol 1990;64: Abdulmawjood A, Roth S, Bülte M. Two methods for construction of internal amplification controls for the detection of Escherichia coli O157 by polymerase chain reaction. Mol Cell Probes 2002;16: Murphy NM, McLauchlin J, Ohai C, Grant KA. Construction and evaluation of a microbiological positive process internal control for PCR-based examination of food samples for Listeria monocytogenes and Salmonella enterica. Int J Food Microbiol 2007;120: Sohni Y, Kanjilal S, Kapur V. Cloning and development of synthetic internal amplifi
8 Korean J Blood Transfus Vol. 29, No. 1, 33-40, Apr cation control for Bacillus anthracis real-time polymerase chain reaction assays. Diagn Microbiol Infect Dis 2008;61: Ullmannová V, Haskovec C. The use of housekeeping genes (HKG) as an internal control for the detection of gene expression by quantitative real-time RT-PCR. Folia Biol (Praha) 2003; 49: Majidzadeh K, Mohseni A, Soleimani M. Construction and evaluation of a novel internal positive control (IPC) for detection of coxiella burnetii by PCR. Jundishapur J Microbiol 2014;7:e
l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More informationuntitled
대한수혈학회지 : 제 27 권제 3 호, 2016 The Korean Journal of Blood Transfusion Vol. 27, No. 3, 274-284, December 2016 https://doi.org/10.17945/kjbt.2016.27.3.274 pissn 1226-9336 eissn 2383-6881 Original Article HCV
More informationuntitled
대한수혈학회지 : 제 23 권제 3 호, 2012 The Korean Journal of Blood Transfusion Vol. 23, No. 3, 210-216, December 2012 ISSN 1226-9336 Original Article 국내헌혈혈액에서의 HIV-1 Subtype 분석 조연정 1 ㆍ김명한 1 ㆍ권소영 2 ㆍ조남선 2 ㆍ윤경원 1 ㆍ지용훈
More informationuntitled
대한수혈학회지 : 제 20 권제 2 호, 2009 B 형간염표면항원양성헌혈유보군의해제검사결과분석 강재원ㆍ전성욱ㆍ권소영ㆍ오덕자 = Abstract = 대한적십자사혈액수혈연구원 Analysis of the Reentry Test Results of the Deferred Donors with Hepatitis B Surface Antigen Reactivity
More information<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한
More informationDBPIA-NURIMEDIA
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More information( )Kjbt018.hwp
대한수혈학회지 : 제 18 권제 3 호, 2007 핵산증폭검사에서 Human Immunodeficiency Virus Type 1 양성결과를보인헌혈자의특성 이재숙 1 ㆍ윤만정 1 ㆍ강재원 1 ㆍ김지연 1 ㆍ서동희 2 ㆍ박규은 3 ㆍ조남선 1 대한적십자사중앙혈액검사센터 1, 랩지노믹스진단검사의학과의원 2, 대한적십자사혈액관리본부 3 = Abstract = Characteristics
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More information뉴스레터6호F?2??訝
February 2009 No.06 Roche Diagnostics Korea Co., Ltd. Focus Tech EDITORIAL February 2009 No.06 Contents Editorial 03 Focus 04 Product 10 Talk 12 Tech 14 Activity 19 Style 22 February 2009 No.06 02 03 FOCUS
More informationuntitled
대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran
More information???? 1
The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con
Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More informationÆ÷Àå82š
Lee, Kyungbae (E-mail : kblee6078@ex.co.kr) Lee, Jaehoon (E-mail : ranian74@ex.co.kr) Sohn, Duecksu (E-mail : mgsds@ex.co.kr) Kwon, Soonmin (E-mail : soonmini2@ex.co.kr) ABSTRACT PURPOSES : The purpose
More information목차 Ⅰ. 개요 1 Ⅱ. 용어의정의 4 Ⅲ. 관련규정 13 Ⅳ. 신청서기재항목및기술문서제출자료 14 Ⅴ. 제조 수입허가신청서기재항목 15
체외진단용의료기기 ( 인플루엔자바이러스및 A형간염바이러스 ) 의허가 심사가이드라인 2015. 2. 의료기기심사부체외진단기기과 - 1 - 목차 Ⅰ. 개요 1 Ⅱ. 용어의정의 4 Ⅲ. 관련규정 13 Ⅳ. 신청서기재항목및기술문서제출자료 14 Ⅴ. 제조 수입허가신청서기재항목 15 Ⅵ. 기술문서등의심사를위한제출자료 37 Ⅶ. 성능시험에대한상세사항 44 Ⅷ. 참고문헌
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More information<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770>
J of Korean Tunn Undergr Sp Assoc 15(5)497-504(2013) eissn: 2287-4747 http://dx.doi.org/10.9711/ktaj.2013.15.5.497 pissn: 2233-8292 도로터널의 갱구부 경관설계가 터널 내부조명에 미치는 영향에 관한 연구 이미애 1 ㆍ이동희 2 * 1 아이라이트 대표이사 2
More information석사논문.PDF
ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More informationuntitled
대한수혈학회지 : 제 22 권제 1 호, 2011 헌혈혈액에대한검사에서의 Blotting 검사의유용성분석 오덕자ㆍ강재원 1 ㆍ박윤미 = Abstract = 대한적십자사중앙혈액검사센터, 대한적십자사혈액수혈연구원 1 Analysis of the Effectiveness of Blotting Assays for Donor Blood Screening Deok Ja
More information조사연구 권 호 연구논문 한국노동패널조사자료의분석을위한패널가중치산출및사용방안사례연구 A Case Study on Construction and Use of Longitudinal Weights for Korea Labor Income Panel Survey 2)3) a
조사연구 권 호 연구논문 한국노동패널조사자료의분석을위한패널가중치산출및사용방안사례연구 A Case Study on Construction and Use of Longitudinal Weights for Korea Labor Income Panel Survey 2)3) a) b) 조사연구 주제어 패널조사 횡단면가중치 종단면가중치 선형혼합모형 일반화선형혼 합모형
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More information08김현휘_ok.hwp
(Regular Paper) 21 3, 2016 5 (JBE Vol. 21, No. 3, May 2016) http://dx.doi.org/10.5909/jbe.2016.21.3.369 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a), a) An Audio Coding Technique Employing the Inter-channel
More informationAnalysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
More informationuntitled
대한수혈학회지 : 제 25 권제 3 호, 2014 The Korean Journal of Blood Transfusion Vol. 25, No. 3, 226-234, December 2014 ISSN 1226-9336 Original Article 헌혈자에서의자동화 Treponema pallidum Latex Agglutination, Rapid Plasma
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More information환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
More informationmau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
More information<32382DC3BBB0A2C0E5BED6C0DA2E687770>
논문접수일 : 2014.12.20 심사일 : 2015.01.06 게재확정일 : 2015.01.27 청각 장애자들을 위한 보급형 휴대폰 액세서리 디자인 프로토타입 개발 Development Prototype of Low-end Mobile Phone Accessory Design for Hearing-impaired Person 주저자 : 윤수인 서경대학교 예술대학
More informationISO17025.PDF
ISO/IEC 17025 1999-12-15 1 2 3 4 41 42 43 44, 45 / 46 47 48 49 / 410 411 412 413 414 5 51 52 53 54 / 55 56 57 58 / 59 / 510 A( ) ISO/IEC 17025 ISO 9001:1994 ISO 9002:1994 B( ) 1 11 /, / 12 / 1, 2, 3/ (
More informationDBPIA-NURIMEDIA
Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun
More informationCloning
Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More information미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
More information서론 C형간염바이러스 (hepatitis C virus, HCV) 는만성간질환을일으키는주요원인중의하나로, 세계적으로는매년 3-4백만명이 HCV에감염되어 1억 5천만가량의인구가 HCV에의한만성간질환을앓고있으며매년 35만명이 HCV에의한간질환으로사망한다 [1]. C형간염은
ORIGINAL ARTICLE Comparison of COBAS AmpliPrep/COBAS TaqMan HCV Qualitative Test v2.0 with COBAS AMPLICOR Hepatitis C Virus Test v2.0 for the Qualitative Detection of Hepatitis C Virus RNA in Korean Clinical
More information04-다시_고속철도61~80p
Approach for Value Improvement to Increase High-speed Railway Speed An effective way to develop a highly competitive system is to create a new market place that can create new values. Creating tools and
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education
More informationuntitled
대한수혈학회지 : 제 27 권제 2 호, 2016 The Korean Journal of Blood Transfusion Vol. 27, No. 2, 169-173, August 2016 http://dx.doi.org/10.17945/kjbt.2016.27.2.169 pissn 1226-9336 eissn 2383-6881 Case Report RHD (c.1227g>a)
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 6, Jun Rate). STAP(Space-Time Adaptive Processing)., -
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Jun.; 29(6), 457463. http://dx.doi.org/10.5515/kjkiees.2018.29.6.457 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Sigma-Delta
More information목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적
用 役 指 名 願 금번 貴 社 에서 실시하고자 하는 用 役 에 참여하고자 當 社 의 指 名 願 을 提 出 하오니 審 査 하시고 指 名 하여 주시면 감사하겠습니다. 2014년 (주)하우드 엔지니어링 종합건축사사무소 대표이사 문 홍 길 대표이사 채 희 대표이사 이 재 규 대표이사 김 성 우 SUBMISSION We are submitting our brochure
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:3~20 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/27, Published: 2016/12/30 [ABSTRACT] This study aims to comprehensively analyze
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2019 Sep.; 30(9), 712 717. http://dx.doi.org/10.5515/kjkiees.2019.30.9.712 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) MOS
More informationDBPIA-NURIMEDIA
박건수 *, 서태영 **, 김종욱 *** ". 요약 Abstract The induction melting furnace using electric generator has been introduced since 1920s, and it began to be widely applied to industrial applications due to increasing
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More informationStatistical Data of Dementia.
Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.
More information2019_2nd_guide_kr_0619.indd
CONTENTS 2019 Good Design Award 2 2 2 2 01 02 04 05 06 08 GOOD DESIGN AWARD 2019 Schedule Entry First screening period April 3 Open for Entries May 23 Entry Deadline / Due Date of submission for Application
More information학습영역의 Taxonomy에 기초한 CD-ROM Title의 효과분석
,, Even the short history of the Web system, the techniques related to the Web system have b een developed rapidly. Yet, the quality of the Webbased application software has not improved. For this reason,
More informationDBPIA-NURIMEDIA
무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 901 무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 (A Effective Sinkhole Attack Detection Mechanism for LQI based Routing in WSN) 최병구 조응준 (Byung
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More information주간건강과질병 제 8 권제 42 호 B 형간염바이러스잠재감염헌혈자및헌혈혈액특성분석 Analysis of Characteristics of Blood Donors with Occult Hepatitis B Virus Infection Abstract Background:
주간건강과질병 제 8 권제 4 호 B 형간염바이러스잠재감염헌혈자및헌혈혈액특성분석 Analysis of Characteristics of Blood Donors with Occult Hepatitis B Virus Infection Abstract Background: Since June 0, HBV Nucleic Acid Amplification test (NAT)
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Dec.; 27(12), 1036 1043. http://dx.doi.org/10.5515/kjkiees.2016.27.12.1036 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)
More informationÆ÷Àå½Ã¼³94š
Cho, Mun Jin (E-mail: mjcho@ex.co.kr) ABSTRACT PURPOSES : The performance of tack coat, commonly used for layer interface bonding, is affected by application rate and curing time. In this study, bonding
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More information,,,,,,,, (), BOD,,,,,,,,,
- 1 - ,,,,,,,, (), BOD,,,,,,,,, - 2 - - 3 - 3) 4) 5) 6) 7) - 4 - - 5 - (Analytical Spectrum) 1 Biosensors 2 Electro Analysis 3 Environmental 4 Drug Discovery 5 Food Quality and Safety 6 Gas and Liquid-phase
More information( )Kju225.hwp
비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More informationuntitled
대한수혈학회지 : 제 29 권제 2 호, 2018 The Korean Journal of Blood Transfusion Vol. 29, No. 2, 182-187, August 2018 https://doi.org/10.17945/kjbt.2018.29.2.182 pissn 1226-9336 eissn 2383-6881 Original Article 한국인헌혈자에서의
More information09구자용(489~500)
The Study on the Grid Size Regarding Spatial Interpolation for Local Climate Maps* Cha Yong Ku** Young Ho Shin*** Jae-Won Lee**** Hee-Soo Kim*****.,...,,,, Abstract : Recent global warming and abnormal
More information06_ÀÌÀçÈÆ¿Ü0926
182 183 184 / 1) IT 2) 3) IT Video Cassette Recorder VCR Personal Video Recorder PVR VCR 4) 185 5) 6) 7) Cloud Computing 8) 186 VCR P P Torrent 9) avi wmv 10) VCR 187 VCR 11) 12) VCR 13) 14) 188 VTR %
More information10(3)-09.fm
w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½
More information6À嵶¼º¿¬±¸ºÐ¾ß
Korea Food & Drug Administration 6 01 K o r e a F o o d & D r u g A d m i n i s t r a t i o n 504 505 년들도 친숙하게 독성물질에 대한 정보들에 접근할 수 있도록 하였다. 그림6-1-3 국립독성연구원 홈페이지 K o r e a F o o d & D r u g A d m i n i
More information< D C8ABBFB5C1D828B1E8B9CEB1E2292E687770>
임상검사와정도관리 : 제 3 권제 2 호 2009 J Lab Med Qual Assur 2009; 3:275-9 275 SLAN real-time PCR 장비를이용한 Artus HBV LC PCR kit 의평가 김민기 이동영 장윤환 이진경 홍석일 홍영준 원자력병원진단검사의학과 Evaluation of Artus HBV LC PCR kit using SLAN
More informationhttp://www.kbc.go.kr/pds/2.html Abstract Exploring the Relationship Between the Traditional Media Use and the Internet Use Mee-Eun Kang This study examines the relationship between
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales
More informationKorean J Lab Med 2010;30: DOI /kjlm Original Article Clinical Microbiology Evaluation of the Efficacies of Rapid Antigen Te
Korean J Lab Med 2010;30:147-52 DOI 10.3343/kjlm.2010.30.2.147 Original Article Clinical Microbiology Evaluation of the Efficacies of Rapid Antigen Test, Multiplex PCR, and Real-time PCR for the Detection
More information03-16-김용일.indd
Journal of the Korean Society of Surveying, Geodesy, Photogrammetry and Cartography Vol. 33, No. 2, 95-101, 2015 http://dx.doi.org/10.7848/ksgpc.2015.33.2.95 ISSN 1598-4850(Print) ISSN 2288-260X(Online)
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More informationPJTROHMPCJPS.hwp
제 출 문 농림수산식품부장관 귀하 본 보고서를 트위스트 휠 방식 폐비닐 수거기 개발 과제의 최종보고서로 제출 합니다. 2008년 4월 24일 주관연구기관명: 경 북 대 학 교 총괄연구책임자: 김 태 욱 연 구 원: 조 창 래 연 구 원: 배 석 경 연 구 원: 김 승 현 연 구 원: 신 동 호 연 구 원: 유 기 형 위탁연구기관명: 삼 생 공 업 위탁연구책임자:
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 4, pp DOI: * A Study on Teache
Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp.149-171 DOI: http://dx.doi.org/10.21024/pnuedi.27.4.201712.149 * A Study on Teachers and Parents Perceptions on the Introduction of Innovational
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities
More information한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26
2015 한국전지학회 춘계학술대회 2일차 한국전지학회 춘계 학술대회(신소재 및 시장동향 관련 주제 발표) 시간 제목 비고 세션 1 차세대 이차전지용 in-situ 분석기술 좌장 : 윤성훈 09:00~09:30 Real-time & Quantitative Analysis of Li-air Battery Materials by In-situ DEMS 김동욱(한국화학연구원)
More information슬라이드 1
2014.5.8. 목요세미나 Anti-HCV 검사의재검기준 S/CO 설정 짂단면역학파트 최향숙 재검기준설정배경 목차 자료조사및분석방법 짂단성능및재검기준분석결과 결롞 2 Hepatitis C virus 만성갂질홖의주요원인바이러스 수혈매개감염의원인 감염전파방지를위하여정확핚짂단이필수 C형갂염짂단을위핚검사 혈청학적검사 분자유전학검사 3 HCV 감염짂단을위핚검사 HCV
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Feb.; 29(2), IS
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Feb.; 29(2), 93 98. http://dx.doi.org/10.5515/kjkiees.2018.29.2.93 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) UHF-HF
More information1. Korea Centers for Disease Control and Prevention. The fifth Korea National Health and Nutrition Examination Survey (KNHANES V-1) 2010. Cheongwon: Korea Centers for Disease Control and Prevention; 2012.
More information디지털포렌식학회 논문양식
ISSN : 1976-5304 http://www.kdfs.or.kr Virtual Online Game(VOG) 환경에서의 디지털 증거수집 방법 연구 이 흥 복, 정 관 모, 김 선 영 * 대전지방경찰청 Evidence Collection Process According to the Way VOG Configuration Heung-Bok Lee, Kwan-Mo
More informationDevelopment of culture technic for practical cultivation under structure in Gastrodia elate Blume
Development of culture technic for practical cultivation under structure in Gastrodia elate Blume 1996. : 1. 8 2. 1 1998. 12. : : ( ) : . 1998. 12 : : : : : : : : : : - 1 - .. 1.... 2.. 3.... 1..,,.,,
More information, ( ) 1) *.. I. (batch). (production planning). (downstream stage) (stockout).... (endangered). (utilization). *
, 40 12 (2006 6) 1) *.. I. (batch). (production planning). (downstream stage) (stockout).... (endangered). (utilization). * 40, 40 12 (EPQ; economic production quantity). (setup cost) (setup time) Bradley
More information,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012). (2007) 26%., (,,, 2011;, 2006;
,,.. 400,,,,,,.,,, -, -, -., 3.. :, Tel : 010-9540-0640, E-mail : sunney05@hanmail.net ,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012).
More information878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
More informationORIGINAL ARTICLE Evaluation of the OraQuick HCV Rapid Antibody Test as a Screening Test for Hepatitis C Virus Infection Hae In Bang, Tae Youn Choi, Je
ORIGINAL ARTICLE Evaluation of the OraQuick HCV Rapid Antibody Test as a Screening Test for Hepatitis C Virus Infection Hae In Bang, Tae Youn Choi, Jeong Won Shin, Rojin Park, and Eun Su Park Department
More information항체 포털 서비스 Preparation Peptide 총 4주 소요 / 473,000 ~ 511,000 Free of charge 2~3 days 243,000 ~ 281,000 의뢰서 작성 Peptide epitope prediction 유전자 정보
Preparation Service AbFrontier Custom service 장점 실험 담당자와의 원활한 1:1 커뮤니케이션 (신속한 feedback을 통한 맞춤형 제작 서비스) 고객연구센터 - 개별 서비스의 진행 상황 및 결과 즉시 확인 http://center.abfrontier.com (e-mail & SMS 전송) 회원제 -연구자의 프로젝트 보안
More informationJournal of Educational Innovation Research 2016, Vol. 26, No. 3, pp DOI: * The Grounds and Cons
Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp.63-81 DOI: http://dx.doi.org/10.21024/pnuedi.26.3.201612.63 * The Grounds and Consequences of the Elementary School Teachers' Trust Formation
More information연구보고서화학물질노출에의한유전자돌연변이 ( 발암 ) 의조기확인 (II) - 실험동물을이용한고감도발암성확인기법의검증 - 임경택 김수진
연구보고서화학물질노출에의한유전자돌연변이 ( 발암 ) 의조기확인 (II) - 실험동물을이용한고감도발암성확인기법의검증 - 임경택 김수진 요약문 i ii 화학물질노출에의한유전자돌연변이 ( 발암 ) 의조기확인 (II) 요약문 iii iv 화학물질노출에의한유전자돌연변이 ( 발암 ) 의조기확인 (II) 요약문 v vi 화학물질노출에의한유전자돌연변이 ( 발암 ) 의조기확인
More information135 Jeong Ji-yeon 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 머리말 협저불상( 夾 紵 佛 像 )이라는 것은 불상을 제작하는 기법의 하나로써 삼베( 麻 ), 모시( 苧 ), 갈포( 葛 ) 등의 인피섬유( 靭 皮 纖 維 )와 칠( 漆 )을 주된 재료
MUNHWAJAE Korean Journal of Cultural Heritage Studies Vol. 47. No. 1, March 2014, pp.134~151. Copyright 2014, National Research Institute of Cultural Heritage 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 정지연 a 明 珍 素 也
More information(JBE Vol. 21, No. 1, January 2016) (Regular Paper) 21 1, (JBE Vol. 21, No. 1, January 2016) ISSN 228
(JBE Vol. 1, No. 1, January 016) (Regular Paper) 1 1, 016 1 (JBE Vol. 1, No. 1, January 016) http://dx.doi.org/10.5909/jbe.016.1.1.60 ISSN 87-9137 (Online) ISSN 16-7953 (Print) a), a) An Efficient Method
More informationKIM Sook Young : Lee Jungsook, a Korean Independence Activist and a Nurse during the 이며 나름 의식이 깨어있던 지식인들이라 할 수 있을 것이다. 교육을 받은 간 호부들은 환자를 돌보는 그들의 직업적 소
1 의사학 제24권 제1호(통권 제49호) 2015년 4월 Korean J Med Hist 24 ː1-34 Apr 2015 c대한의사학회 http://dx.doi.org/10.13081/kjmh.2015.24.1 pissn 1225-505X, eissn 2093-5609 간호부 이정숙의 독립운동 김숙영* 1. 서론 2. 본론 1) 출생에서 정신여학교 수학시절까지
More information슬라이드 1
TAKARA 1. PCR 2. qpcr 2014. 02. 13. 최유미 DNA? DNA 생물체 > 기관 > 세포 >DNA DNA (Deoxyribonucleic acid) 세포내에서생물의유젂정보를보관하는물질 구성 : Adenine, Thymine, Cytosine, Guanine 종특이적, 개체특이적 PCR (Polymerase Chain Reaction)
More informationexample code are examined in this stage The low pressure pressurizer reactor trip module of the Plant Protection System was programmed as subject for
2003 Development of the Software Generation Method using Model Driven Software Engineering Tool,,,,, Hoon-Seon Chang, Jae-Cheon Jung, Jae-Hack Kim Hee-Hwan Han, Do-Yeon Kim, Young-Woo Chang Wang Sik, Moon
More informationDBPIA-NURIMEDIA
Printed in the Republic of Korea "/"-:5*$"- 4$*&/$& 5&$)/0-0(: Vol. 18, No. 5, 425-430, 2005» 677*4 Ÿ w sƒ ½»x Á Á½ k w y w, w y œw Some considerations for the analytical approaches to measure atmospheric
More informationDBPIA-NURIMEDIA
e- 비즈니스연구 (The e-business Studies) Volume 17, Number 1, February, 28, 2016:pp. 293~316 ISSN 1229-9936 (Print), ISSN 2466-1716 (Online) 원고접수일심사 ( 수정 ) 게재확정일 2015. 12. 04 2015. 12. 24 2016. 02. 25 ABSTRACT
More information