untitled

Size: px

Start display at page:

Download "untitled"

유석 사
5 years ago
Views:

1 대한수혈학회지 : 제 29 권제 1 호, 2018 The Korean Journal of Blood Transfusion Vol. 29, No. 1, 33-40, April pissn eissn Original Article 실험실에서자체설계한 HTLV PCR 에서의내부정도관리물질제조및적용 강정원 1 ㆍ신선미 1 ㆍ강재원 1 ㆍ서영익 1 ㆍ민혁기 1 ㆍ허광 2 대한적십자사혈액수혈연구원 1, 대한적십자사남부혈액검사센터 2 Construction and Application of Internal Control for Laboratory-Developed HTLV PCR Jungwon Kang 1, Sun-Mi Shin 1, Jae-Won Kang 1, Young Ik Seo 1, Hyukki Min 1, Kwang Huh 2 Blood Transfusion Research Institute, Korean Red Cross 1, Wonju, Nambu Blood Laboratory Center, Korean Red Cross 2, Busan, Korea Background: For donor samples showing reactive results in a human T-cell lymphotropic virus (HTLV) antibody test along with indeterminate results in Western blot assay, HTLV nucleic acid amplification test using laboratory-developed polymerase chain reaction (PCR) was performed. It is necessary to construct an adequate internal control (IC) to evaluate the accuracy of the results since we did not use an IC in the laboratory-developed PCR. Methods: As a competitive IC, plasmid DNA containing the primer recognition sequence for amplification of the HTLV px region was constructed. We determined the adequate concentration of the IC, which was added to the samples to evaluate the accuracy of the test results. Results: When the plasmid DNA was added to the HTLV-positive samples, the amplified product of IC (400 bp) was detected with the HTLV gene (230 bp). The adequate concentration of plasmid DNA added as an IC was 1 pg. Conclusion: The construction of plasmid DNA as a competitive IC is an efficient method to evaluate accuracy of the test results. However, the production process for the competitive IC must be further developed. Therefore, it is necessary to compare with the performance of a non-competitive IC. (Korean J Blood Transfus 2018;29:33-40) Key words: HTLV, Laboratory-developed PCR, Internal control 서론 대한적십자사에서는 2009 년 4 월부터혈장성분 헌혈자를제외한모든헌혈자에대하여사람 T림프구영양성바이러스 (human T-cell lymphotropic virus, HTLV) 에대한선별검사를실시하고있다. 선 Received on February 9, Revised on March 23, Accepted on April 2, 2018 Correspondence to: Jae-Won Kang Blood Transfusion Research Institute, Korean Red Cross, 50 Hyeoksin-ro, Wonju 26465, Korea Tel: , Fax: , kangjaewon@redcross.or.kr, ORCID: This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Copyright C 2018 The Korean Society of Blood Transfusion

2 Korean J Blood Transfus Vol. 29, No. 1, 33-40, Apr 별검사는화학발광면역법을이용한 HTLV-I/II 항체검사 (HTLV-I/II antibody, anti-htlv-i/ii) 를실시하며, anti-htlv-i/ii에서양성결과를보인경우웨스턴블롯에의한확인검사를실시하고있다 [1]. 웨스턴블롯결과양성을보인경우헌혈이영구적으로보류되며, 음성을보인경우에는 6개월이상경과후선별검사에적용한방법과동일한방법의 anti-htlv-i/ii를실시하여그결과에따라헌혈가능여부가결정된다. 2015년까지는확인검사로핵산증폭검사도같이실시하였으나, 그동안의검사결과및운영상의효율성을고려하여 [2] 2016년부터는웨스턴블롯미결정결과를보인경우에만핵산증폭검사를실시하고있다. 이검사에서양성결과를보일경우에는헌혈이영구보류, 음성일경우에는이후안전성검사결과에따라헌혈가능여부가결정된다. 혈액을시료로하는핵산증폭검사시혈액내에존재하는물질중항응고제로사용되는 EDTA 또는 heparin, 적혈구의 hemoglobin, 혈장에포함된 IgG, lactoterrin 등이핵산증폭반응을저해하는저해제로작용할가능성이있다 [3-9]. 이들이저해제로작용할경우양성검체임에도불구하고불완전한반응으로인한위음성결과를보일가능성이있다. 따라서 international standard organization 의가이드라인에서는이들저해제로인한위음성결과의여부를확인하기위하여내부정도관리물질 (internal control, IC) 을채택할것을권고하고있다 [10]. 현재 HBV, HCV 및 HIV에대한헌혈자선별검사에적용하는핵산증폭검사의경우에는상용화된검사시약을사용하고있으며, 이에는합성 oligonucleotide로제조된 IC가포함되어있어, 검사시각각의개별검체에 IC를첨가하도록되어있으며, 음성결과를보일경우 IC에대한값이양성이어야유효한것으로판정된다 [11]. HTLV 검사를위한핵산증폭검사는현재공인 기관의인가를받은상용화시약이존재하지않아, 현재 HTLV 헌혈자선별검사양성검체에대한확인검사로적용하고있는핵산증폭검사는실험실에서자체적으로설계한중합효소연쇄반응 (laboratory developed polymerase chain reaction, laboratory-developed PCR) 에의한방법을채택하고있다. 따라서, 상용화된검사시약에일반적으로포함되어있는 IC를사용하고있지않기때문에, 음성결과의경우병원체미존재로인한음성결과인지, 불완전한반응으로인한음성결과인지에대한검증이부족하다고여겨질수있다. 이에본연구에서는 laboratory-developed PCR에적용이가능한 IC를제조하였으며, 이의적용가능성과적절한적용방법을검토하였다. 재료및방법 1. HTLV 양성및음성검체본연구에사용된검체는대한적십자사혈액검사센터로부터본원으로확인검사가의뢰된헌혈자전혈검체중양성으로판정된검체와음성으로판정된검체를대한적십자사혈액관리본부의생명윤리심의위원회를득한후사용하였다. 2. HTLV Nested PCR의조건핵산추출은 MagNa Pure DNA isolation kit (Roche Diagnostics GmbH, Mannheim, Germany) 를이용하였으며, HTLV 감염의확인을위한유전자증폭은 Matsumoto C 등의방법을적용하여 HTLV의 px 영역의 230 bp를표적으로한 nested PCR을채용하였으며, 이에사용한 primer는 Table 1과같다 [12]. 1차 PCR 반응액은 AmpliTaq Gold 360 Master Mix (Applied Biosystems, CA, USA) 와 external primer set (Bioneer, Deajeon, Korea) 을사용

3 강정원외 : 실험실에서자체설계한 HTLV PCR 에서의내부정도관리물질제조및적용 하여총 25 L에맞추었고, 핵산증폭은 C1000 Thermal cycler (Bio-rad, CA, USA) 를이용하여 95 o C에서 2분간변성시킨후 95 o C 에서 30초, 61 o C에서 30초, 72 o C에서 1분으로 30회반복후 72 o C에서 5분간항온하였다. 2차 PCR 반응액은 external primer set 대신에 internal primer set를사용한것이외에는 1차 PCR과동일하게진행하였다. 증폭산물의확인을위한전기영동은 Lab Chip GX (Caliper Life Science, MA, USA) 을이용하였다. 3. IC의제조 IC는 Fig. 1과같이 HTLV 표적부위증폭에사용하는 primer 염기서열을양단에포함하면서증폭산물의크기와내부의염기서열이다른재조합플라스미드를제조하였다. px1과 px2를이용한 external fragment는 600 bp, px3과 px4를이용한 internal fragment는 400 bp가되도록 pbha 플라스미드에삽입하였다. 이 100 ng, 10 ng, 1 ng, 0.1 ng, 0.01 ng이되도록하였다. 이에 IC의농도를마찬가지로 200 ng/ L stock을 50 ng/ L로조정하여, 1/10로계대희석한후, 2 L씩처리하여각각의 IC양이 100 ng, 10 ng, 1 ng, 0.1 ng, 0.01 ng, ng, ng이되도록조절한후첨가하여 HTLV의유전자증폭산물과 IC가모두정확하게나타나는농도를설정하였다. 5. IC 적용및미적용시의 HTLV PCR 검출한계농도확인 HTLV PCR 검출한계농도를확인하기위해서 HTLV 양성검체의핵산을 0.5 ng/ L로조정하여, 4. IC 적용을위한최적조건확인 IC 적용을위한최적조건확인은 Abdulmawjood A 등의방법을적용하였다 [13]. HTLV 양성전혈검체의핵산을추출하여 ND-1000 Spectrophotometer (NanoDrop Technologies, DE, USA) 를이용하여정량하였다. 양성검체의핵산은 50 ng/ L 로조정하여, 1/10로계대희석한후, PCR 반응시희석한 DNA를 2 L씩처리하여각각의 DNA양 Fig. 1. Internal control for the determination of HTLV. Table 1. HTLV-I in laboratory-developed PCR (nested PCR) primer set Target Primer Sequence (5 3 ) Amplicon size (bp) External px1 AGGGTTTGGACAGAGTCTT px2 AAGGACCTTGAGGGTCTTAG Internal px3 CTTTTCGGATACCCAGTCYAC 230 px4 GGTTCTCTGGGTGGGGAAGGAG

4 Korean J Blood Transfus Vol. 29, No. 1, 33-40, Apr /10씩계대희석한후, PCR 반응시희석한 DNA 를 2 L씩처리하여각각의 template DNA양이 1 ng 부터 ng 이되도록하여 HTLV nested PCR을수행하였다. 결과 1. 재조합플라스미드의확인제조된재조합플라스미드에대하여 nested PCR 실시결과 400 bp의최종증폭산물이확인되어, HTLV 유전자증폭시사용되는 primer 인식부위를포함하면서크기가다른유전자증폭산물이포함된플라스미드 DNA가적합하게제조되었음을확인하였다 (Fig. 2). 2. IC 효과확인 HTLV 양성및음성검체에플라스미드 DNA 를첨가후증폭반응을한결과양성검체에서는 400 bp의플라스미드증폭산물과 230 bp의 HTLV 유전자증폭산물이검출되고, 음성검체에서는플라스미드의증폭산물만검출되어제조된플라스미드 DNA가 IC로서의역할을할수있음을확인하였다 (Fig. 3). 3. 적정 IC 첨가농도확인 HTLV PCR 양성검체와내부정도관리물질을각각계대희석하여혼합한검체에대한증폭반응결과양성검체및내부정도관리물질이모두정확하게검출되는농도는내부정도관리물질의농도가 1 pg일때로나타났다 (Fig. 4). 4. IC 적용및미적용시의 HTLV PCR 검출한계농도확인 HTLV PCR 검출한계농도를확인하기위해서 HTLV 양성전혈검체의 DNA를 ND-1000 Spectrophotometer (NanoDrop Technologies, DE, USA) 를 Fig. 2. Electrophoresis of PCR product of plasmid DNA as an internal control. Lane M, DNA ladder; Lane 1, Amplified product of plasmid DNA for internal control. Fig. 3. Electrophoresis of PCR product of plasmid DNA as an internal control in the HTLV positive and negative sample. Lane M, DNA ladder; Lane 1, HTLV positive sample without internal control; Lane 2, HTLV negative sample without internal control; Lane 3, HTLV positive sample with internal control; Lane 4, HTLV negative sample with internal control

5 강정원외 : 실험실에서자체설계한 HTLV PCR 에서의내부정도관리물질제조및적용 이용하여정량하였다. 양성검체의핵산은 0.5 ng/ L로조정하여, 1/10씩계대희석한후, PCR 반응시희석한 DNA를 2 L씩처리하여각각의 template DNA양이 1 ng부터 ng이되도록하여 HTLV nested PCR을수행하였다. 그결과 0.1 ng이검출한계농도인것으로나타났으며, 해당농도에서 IC를적용할때도양성인결과를나타냈다 (Fig. 5). Fig. 4. Determination of adequate concentration of plasmid DNA for the application of internal control in HTLV nested PCR. Lane M, DNA ladder; Lane 1, 100 ng of plasmid DNA addition; Lane 2, 10 ng of plasmid DNA addition; Lane 3, 1 ng of plasmid DNA addition; Lane 4, 100 pg of plasmid DNA addition; Lane 5, 10 pg of plasmid DNA addition; Lane 6, 1 pg of plasmid DNA addition. 결론본연구는본원에서자체적으로설계하여실시하고있는 HTLV nested PCR에적용이가능한 IC 의제조를위하여 HTLV 유전자증폭에사용되는 primer와동일한염기서열을포함하면서증폭산물의크기가다른재조합플라스미드를제조하여이를검체에첨가후표적이되는병원체와같이 Fig. 5. Determination of detection limit in the laboratory developed HTLV PCR with IC and without IC. (A) Electrophoresis of PCR products of HTLV positive samples which were amplified with IC. (B) Electrophoresis of PCR products of HTLV positive samples which were amplified without IC. Lane M, DNA ladder; Lane 1, PCR product of 1 ng of template DNA; Lane 2, PCR product of ng of template DNA; Lane 3, PCR product of ng of template DNA; Lane 4, PCR product of ng of template DNA; Lane 5, PCR product of ng of template DNA; Lane 6, PCR product of ng of template DNA; Lane 7, PCR product of ng of template DNA; Lane 8, PCR product of ng of template DNA; Lane 9, PCR product of ng of template DNA; Lane 10, PCR product of ng of template DNA. Abbreviation: IC, internal control

6 Korean J Blood Transfus Vol. 29, No. 1, 33-40, Apr 증폭이될수있도록하였다. 따라서 IC의증폭이없는경우에는음성결과라할지라도증폭반응의불완전으로인한음성결과임을알수있도록하였다. 병원체검출을위한핵산증폭검사시상용화된검사시약의경우는 IC가포함되어있으나, 실험실또는검사실에서자체적으로설계한 PCR의경우는 IC를적용하지않는경우가많다. 그러나검사결과의보증, 특히음성검체에대한검증을위하여는실험실에서자체설계한 PCR이라하더라도 IC의적용이필요하다. 이러한 PCR로의적용을위한 IC로는본연구에서제작한것과같이표적이되는유전자의증폭을위한 primer와동일한염기서열을포함하는합성 oligonucleotie를이용하는 competitive IC와 universal 또는 housekeeping gene을표적대상유전자와같이증폭을하는 noncompetitive IC가있다 [14,15]. 일반적으로사용하는 noncompetitive IC는 beta-2-microglobulin, Glyceraldehyde 3-phosphate dehydrogenase, 18S ribosomal RNA 또는 albumin을 coding하는 house-keeping 유전자영역을증폭대상으로하며별도의 IC제조를위한단계가필요하지않다는장점이있다 [16]. 그러나 Noncompetitive IC는서로다른염기서열의 primer를첨가하여증폭반응을일으키기때문에이로인한간섭반응과비특이적반응이발생할수있는문제점이있다 [10,17]. Competitive IC의농도가높을경우표적이되는병원체유전자의증폭을위하여결합하여야하는 primer 가 IC에주로결합하여결과적으로표적이되는병원체유전자의증폭을방해할수있기때문에 [17] competitive IC를적용할경우적절한 IC 첨가농도를설정해주어야하며, 본연구에서도 IC를 100 ng 첨가했을때에는 HTLV 양성검체에서도 HTLV 유전자의증폭산물을확인할수없었고, 0.1 ng 정도첨가하였을때에 IC와 HTLV 유전자 가모두증폭됨을확인하였다. 효과적인운영을위해서는 noncompetitive IC에대한적용효과의비교가필요할것으로사료되었다. 일반적인헌혈자선별검사로적용하는 HBV, HCV 및 HIV에대한핵산증폭검사의경우공인기관의인증을받은상용화시약이존재하며, 검사결과를보증할수있는체계가갖추어져있지만, 일부국가또는기관에서적용하는병원체유전자검사의경우에는대부분실험실내에서설계하여적용하여야할때가많다. 특히수혈매개가능신종감염병병원체에대한유전자검사필요시에는대부분실험실에서자체적으로설계한방법을활용해야될경우가많을것으로사료되었다. 이러한경우에도검사결과의보증을위한체계구비를위하여이와같은 IC의적용을고려할수있을것으로판단되었다. 요약배경 : HTLV 항체선별검사에서양성결과를보이면서웨스턴블롯에서미결정결과를보인헌혈자검체에대하여자체적으로설계한연쇄중합효소반응 (PCR) 을이용하여 HTLV 핵산증폭검사를실시하고있다. 그러나자체설계한 PCR에서는내부정도관리물질을사용하고있지않아, 검사결과를보증할수있는내부정도관리물질의구축이필요한것으로판단되었다. 방법 : 경쟁적내부정도관리물질로 HTLV의 px 영역증폭에사용하는 primer 인식부위를포함하는플라스미드 DNA를제조하였다. 그리고검사결과의보증을위하여검체에첨가되는내부정도관리물질의적절한농도를설정하였다. 결과 : 플라스미드 DNA를 HTLV 양성검체에첨가시, 400 bp의내부정도관리물질증폭산물이 230 bp의 HTLV 유전자와같이검출되었다. 내부

7 강정원외 : 실험실에서자체설계한 HTLV PCR 에서의내부정도관리물질제조및적용 정도관리물질로서의플라스미드 DNA의적절한첨가농도는 1 pg으로나타났다. 결론 : 경쟁적내부정도관리물질로서의플라스미드 DNA의제조는검사결과보증에효과적인것으로여겨졌다. 그러나경쟁적내부정도관리물질의경우별도의제조과정을거쳐야하므로, 별도의제조과정이필요없는비경쟁적내부정도관리물질의성능과비교할필요도있을것으로사료되었다. References 1. Kwon SY, Lim AH, Park JY, Han SH, Cho NS. Seroprevalence of human T-lymphotropic virus type 1 and 2 in Korean blood donors. J Med Virol 2008;80: Youn KW, Kang JW, Kwon SY, Oh DJ. Consideration of the improvement of the confirmatory assay for the anti-htlv positive blood donation. Korean J Blood Transfus 2015;26: Promega corporation. An introduction to PCR inhibitors. files/resources/profiles-in-dna/1001/an-intro duction-to-pcr-inhibitors.pdf?la=es-es [Online] (last visited on 23 March 2018) 4. Pallen MJ, Puckey LH, Wren BW. A rapid, simple method for detecting PCR failure. PCR Methods Appl 1992;2: Al-Soud WA, Rådström P. Purification and characterization of PCR-inhibitory components in blood cells. J Clin Microbiol 2001;39: Beutler E, Gelbart T, Kuhl W. Interference of heparin with the polymerase chain reaction. Biotechniques 1990;9: Holodniy M, Kim S, Katzenstein D, Konrad M, Groves E, Merigan TC. Inhibition of human immunodeficiency virus gene amplification by heparin. J Clin Microbiol 1991;29: Ijzerman MM, Dahling DR, Fout GS. A method to remove environmental inhibitors prior to the detection of waterborne enteric viruses by reverse transcription-polymerase chain reaction. J Virol Methods 1997;63: Kreader CA. Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein. Appl Environ Microbiol 1996;62: Hoorfar J, Malorny B, Abdulmawjood A, Cook N, Wagner M, Fach P. Practical considerations in design of internal amplification controls for diagnostic PCR assays. J Clin Microbiol 2004; 42: U.S. Food and Drug Administration. Procleix Ultrio Plus assay. loads/scienceresearch/fieldscience/ucm [Online] (last visited on 23 March 2018) 12. Matsumoto C, Mitsunaga S, Oguchi T, Mitomi Y, Shimada T, Ichikawa A, et al. Detection of human T-cell leukemia virus type I (HTLV-I) provirus in an infected cell line and in peripheral mononuclear cells of blood donors by the nested double polymerase chain reaction method: comparison with HTLV-I antibody tests. J Virol 1990;64: Abdulmawjood A, Roth S, Bülte M. Two methods for construction of internal amplification controls for the detection of Escherichia coli O157 by polymerase chain reaction. Mol Cell Probes 2002;16: Murphy NM, McLauchlin J, Ohai C, Grant KA. Construction and evaluation of a microbiological positive process internal control for PCR-based examination of food samples for Listeria monocytogenes and Salmonella enterica. Int J Food Microbiol 2007;120: Sohni Y, Kanjilal S, Kapur V. Cloning and development of synthetic internal amplifi

8 Korean J Blood Transfus Vol. 29, No. 1, 33-40, Apr cation control for Bacillus anthracis real-time polymerase chain reaction assays. Diagn Microbiol Infect Dis 2008;61: Ullmannová V, Haskovec C. The use of housekeeping genes (HKG) as an internal control for the detection of gene expression by quantitative real-time RT-PCR. Folia Biol (Praha) 2003; 49: Majidzadeh K, Mohseni A, Soleimani M. Construction and evaluation of a novel internal positive control (IPC) for detection of coxiella burnetii by PCR. Jundishapur J Microbiol 2014;7:e

untitled

untitled 대한수혈학회지 : 제 27 권제 3 호, 2016 The Korean Journal of Blood Transfusion Vol. 27, No. 3, 274-284, December 2016 https://doi.org/10.17945/kjbt.2016.27.3.274 pissn 1226-9336 eissn 2383-6881 Original Article HCV