< FB1B9B8B3B0F8BFF85FBAB05FB8EAC1BEC0A7B1E2BEDFBBFDB5BFBDC4B9B05FC7F6C8B25FB9F8BFAA2E687770>

Save this PDF as:
 WORD  PNG  TXT  JPG
Size: px
Start display at page:

Download "< FB1B9B8B3B0F8BFF85FBAB05FB8EAC1BEC0A7B1E2BEDFBBFDB5BFBDC4B9B05FC7F6C8B25FB9F8BFAA2E687770>"

Transcription

1 in of Korea Korea - Ursus thibetanus ussuricus, Lutra lutra, Elaphe schrenckii, Falco peregrinus, Koreocobitis naktongensis, Eumenis autonoe Jirisan (35) (29) - Martes flavigula, Prionailurus bengalensis, Pteromys volans aluco, Strix aluco, Buteo buteo, Milvus migrans, Terpsiphone atrocaudata, Falco columbarius, Accipiter gularis, Aegypius monachus, Dryocopus martius, Eremias argus, Microphysogobio koreensis, Lethocerus deyrollei, Chrysochroa fulgidissima, Fabriciana nerippe, Copris tripartitus, Parnassius bremeri, Nannophya pygmaea - Eleutherococcus senticosus, Astilboides tabularis, Trientalis europaea var.arctica, Iris koreana, Aconitum koreanum, Paeonia obovata, Corylopsis gotoana var.coreana, Aconitum austrokoreense, Smilacina bicolor, Astragalus membranaceus Gyeongju (9) (9) - Prionailurus bengalensis, Falco subbuteo, Strix aluco, Buteo buteo Bubo bubo, Parnassius bremeri - Iris odaesanensis, Iris koreana, Paeonia obovata (3) - Elaphe schrenckii, Lutra lutra, Moschus moschiferus parvipes Gyeryongsan (19) (16) - Martes flavigula, Prionailurus bengalensis, Terpsiphone atrocaudata, Accipiter gentilis, Buteo buteo, Bubo bubo, Pitta nympha, Falco subbuteo, Dryocopus martius, Strix aluco, Kaloula borealis, Rana plancyi, Eremias argus, Protantigius superans, Lethocerus deyrollei - Paeonia obovata Hallyeohaesang (7) - Lutra lutra, Elaphe schrenckii, Falco peregrinus, Haliaeetus pelagicus, Haliaeetus albicilla - Aerides japonicum, Neofinetia falcata

2 (11) - Prionailurus bengalensis, Terpsiphone atrocaudata, Pitta nympha, Pernis ptilorhynchus, Milvus migrans, Buteo buteo, Synthliboramphus wumizusume, Copris tripartitus - Milletia japonica, Corylopsis gotoana var.coreana, Cymbidium macrorrhizum - Moschus moschiferus parvipes, Naemorhedus caudatus, Lutra lutra, Elaphe schrenckii, Falco peregrinus, Aquila chrysaetos Seoraksan (43) (37) - Prionailurus bengalensis, Martes flavigula, Pteromys volans aluco, Mustela nivalis, Terpsiphone atrocaudata, Aegypius monachus, Dryocopus martius, Buteo buteo, Strix aluco, Falco subbuteo, Circus cyaneus, Bubo bubo, Accipiter gentilis, Strix uralensis, Falco columbarius, Chinemys reevesii, Pseudopungtungia tenuicorpas, Gobiobotia brevibarba, Cottus poeclopus, Challia fletcheri, Fabriciana nerippe - Eleutherococcus senticosus, Trientalis europaea var.arctica, Jeffersonia dubia, Rhododendron aureum, Lilium cernuum, Leontopodium coreanum, Thalictrum coreanum, Smilacina bicolor, Cypripedium guttatum, Leontice microrrhyncha, Arctous ruber, Iris koreana, Aconitum koreanum, Paeonia obovata, Astragalus membranaceus, Trillium tschonoskii (1) - Lutra lutra Songnisan (28) (27) - Prionailurus bengalensis, Martes flavigula, Pteromys volans aluco, Terpsiphone atrocaudata, Dryocopus martius, Buteo buteo, Falco subbuteo, Pernis ptilorhynchus, Accipiter gularis, Kaloula borealis, Chinemys reevesii, Acheilognathus signifer, Cottus poeclopus, Copris tripartitus, Nannophya pygmaea, Fabriciana nerippe, Parnassius bremeri - Paeonia obovata, Aconitum koreanum, Lilium cernuum,

3 Hallasan (43) (10) (33) Thalictrum coreanum, Jeffersonia dubia, Berchemia berchemiaefolia, Iris odaesanensis, Eleutherococcus senticosus, Iris koreana, Abeliophyllum distichum - Myotis formosus chofukusei, Aquila chrysaetos, Falco peregrinus, Haliaeetus pelagicus, Haliaeetus albicilla, Metop Mentus blanchardi, Eumenis autonoe, Aporia crataegi, Polyphylla laticollis manchurica - Diapensia lapponica var.obovata - Circus aeruginosus, Dryocopus martius, Aegypius monachus, Gallicrex cinerea, Buteo buteo, Pernis ptilorhynchus, Falco amurensis, Galerida cristata, Terpsiphone atrocaudata, Falco subbuteo, Milvus migrans, Falco columbarius, Bubo bubo, Circus melanoleucus, Strix aluco, Circus cyaneus, Accipiter gularis, Accipiter gentilis, lxobrychus eurhythmus, Buteo hemilasius, Buteo lagopus, Pitta nympha, Aquila clanga, Sibynophis collaris, Lethocerus deyrollei, Chrysochroa fulgidissima, Gymnopleurus mopsus, Copris tripartitus, Fabriciana nerippe, Cicindela hybrida nitida - Isoetes japonica, Galeola septentrionalis, Utricularia yakusimensis - Lutra lutra, Aquila chrysaetos, Falco peregrinus, Elaphe schrenckii Naejangsan (21) (17) - Prionailurus bengalensis, Martes flavigula, Dryocopus martius, Buteo buteo, Accipiter gentilis, Charadrius placidus, Buteo lagopus, Terpsiphone atrocaudata, Rana plancyi, Chinemys reevesii, Parnassius bremeri, Chrysochroa fulgidissima, Fabriciana nerippe - Iris koreana, Cymbidium macrorrhizum, Vexillabium yakushimensis, Lycoris chinensis var.sinuolata Gayasan (8) (1) - Lutra lutra

4 (7) - Prionailurus bengalensis, Pteromys volans aluco, Buteo buteo, Circus aeruginosus - Lilium cernuum, Trientalis europaea var.arctica, Paeonia obovata - Lutra lutra, Pseudopungtungia nigra, Aquila chrysaetos, Myotis formosus chofukusei, Elaphe schrenckii - Cypripedium japonicum Deogyusan (35) (29) - Prionailurus bengalensis, Martes flavigula, Pteromys volans aluco, Buteo buteo, Accipiter gentilis, Buteo lagopus, Falco subbuteo, Strix aluco, Bubo bubo, Falco columbarius, Pitta nympha, Milvs, Pigrans, Circus aeruginosus, Cygnus columbianus, Galerida cristata, Buteo hemilasius, umbarius, Pitta nymdimaster mirabilissimus mirabilissimus, Circus cyaneus, Nannophya pygmaea, Gallicrex cinerea, Terpsiphone atrocaudata, Chinemys reevesii, Gobiobotia brevibarba - Paeonia obovata, Lilium cernuum, Eleutherococcus senticosus, Smilacina bicolor, Astilboides tabularis - Moschus moschiferus parvipes, Naemorhedus caudatus, Lutra lutra, Aquila chrysaetos, Elaphe schrenckii, Callipogon relictus Odaesan (30) (24) - Pteromys volans aluco, Prionailurus bengalensis, Martes flavigula, Mustela nivalis, Buteo buteo, Falco subbuteo, Strix uralensis, Strix aluco, Dryocopus martius, Bubo bubo, Buteo hemilasius, Aegypius monachus, Accipiter gentilis, Pseudopungtungia tenuicorpas, Cottus poeclopus, Damaster mirabilissimus mirabilissimus, Fabriciana nerippe, Osmoderma opicum - Eleutherococcus senticosus, Astilboides tabularis, Trientalis europaea var.arctica, Iris odaesanensis, Paeonia obovata, Smilacina bicolor Juwangsan (2) - Lutra lutra, Elaphe schrenckii

5 (16) - Martes flavigula, Prionailurus bengalensis, Pteromys volans aluco, Buteo buteo, Bubo bubo, Dryocopus martius, Pernis ptilorhynchus, Charadrius placidus, Circus cyaneus - Hylotelephium ussuriense, Lilium cernuum, Thalictrum coreanum, Iris odaesanensis, Eleutherococcus senticosus, Berchemia berchemiaefolia, Jeffersonia dubia - Lutra lutra, Falco peregrinus, Egretta europhotes, Eumenis autonoe Taeanhaean (25) (21) - Prionailurus bengalensis, Buteo buteo, Accipiter gentilis, Pernis ptilorhynchus, Charadrius placidus, Accipiter gularis, Haematopus ostralegus, Milvus migrans, Numenius madagascariensis, Anser fabalis, Pandion haliaetus, Bubo bubo, Falco subbuteo, Rana plancyi, Eremias argus, Chrysochroa fulgidissima, Lethocerus deyrollei, Cicindela anchoralis punctatissima, Cygnus cygnus - Leontopodium coreanum, Ranunculus kazusensis (14) - Lutra lutra, Elaphe schrenckii, Myotis formosus chofukusei, Falco peregrinus, Aquila chrysaetos, Ciconia boyciana, Haliaeetus albicilla, Eurynorhynchus pygmeus, 저어새, Egretta europhotes, Platalea leucorodia - Aerides japonicum, Neofinetia falcata, Cymbidium kanran Dadohae haesang (57) (43) - Buteo buteo, Accipiter gentilis, Pernis ptilorhynchus, Falco subbuteo, Milvus migrans, Charadrius placidus, Branta bernicla, Haematopus ostralegus, Anser fabalis, Bubo bubo, Circus cyaneus, Buteo hemilasius, Accipiter gularis, Circus aeruginosus, Terpsiphone atrocaudata, Cygnus cygnus, Pandion haliaetus, Gorsachius goisagi, Falco amurensis, Aquila heliaca, Grus leucogeranus, Circus melanoleucus, Gallicrex cinerea, lxobrychus eurhythmus, Aquila clanga, Ciconia nigra, Rana plancyi, Triops longicaudatus, Psacothea hilaris, Copris tripartitus,

6 Lethocerus deyrollei - Eleutherococcus senticosus, Osmanthus insularis, Milletia japonica, Trientalis europaea var.arctica, Cymbidium macrorrhizum, Saururus chinensis, Galeola septentrionalis, Drosera peltata var.nipponica, Quercus gilva, Utricularia yakusimensis, Saracanthus scolopendrifolius, Hibiscus hamabo - Moschus moschiferus parvipes, Elaphe schrenckii, Naemorhedus caudatus, Myotis formosus chofukusei Chiaksan (22) - Prionailurus bengalensis, Pteromys volans aluco, Buteo buteo, Dryocopus martius, Pernis ptilorhynchus, Falco amurensis, Accipiter gentilis, Accipiter gularis, Falco subbuteo, Strix aluco, Aegypius monachus, Charadrius placidus, Bubo bubo, Terpsiphone atrocaudata, Pseudopungtungia tenuicorpas, Cottus poeclopus - Eleutherococcus senticosus, Iris odaesanensis - Elaphe schrenckii, Naemorhedus caudatus, Lutra lutra, Aquila chrysaetos woraksan (14) - Prionailurus bengalensis, Pteromys volans aluco, Martes flavigula, Chinemys reevesii, Buteo buteo, Dryocopus martius, Accipiter gentilis, Falco subbuteo, Buteo hemilasius, Fabriciana nerippe, Gobiobotia brevibarba - Lilium cernuum, Berchemia berchemiaefolia, Viola websteri Bukhansan (19) (19) - Falco columbarius, Aegypius monachus, Anser fabalis, Dryocopus martius, Strix aluco, Bubo bubo, Falco amurensis, Challia fletcheri, Pernis ptilorhynchus, Kaloula borealis, Buteo buteo, Accipiter gentilis, Falco subbuteo, Accipiter gularis, Charadrius placidus, Fabriciana nerippe, Cottus poeclopus, Spindasis takanonis - Abeliophyllum distichum Sobaeksan - Aquila chrysaetos, Naemorhedus caudatus, Lutra lutra,

7 Myotis formosus chofukusei (30) (26) - Prionailurus bengalensis, Pteromys volans aluco, Charadrius placidus, Falco subbuteo, Buteo buteo, Dryocopus martius, Bubo bubo, Strix aluco, Accipiter gularis, Buteo lagopus, Cottus poeclopus, Damaster mirabilissimus mirabilissimus, Parnassius bremeri, Challia fletcheri, Protantigius superans, Fabriciana nerippe, Nannophya pygmaea - Paeonia obovata, Iris odaesanensis, Lilium cernuum, Smilacina bicolor, Trientalis europaea var.arctica, Eleutherococcus senticosus, Iris koreana, Aconitum austrokoreense, Echinosophora koreensis Wolchulsan - Buteo buteo, Aegypius monachus, Terpsiphone atrocaudata, Prionailurus bengalensis, Martes flavigula - Iris koreana Byeonsan bando (15) (2) (13) - Lutra lutra, Elaphe schrenckii - Fabriciana nerippe, Chrysochroa fulgidissima, Kaloula borealis, Rana plancyi, Buteo buteo, Accipiter gularis, Accipiter gentilis, Falco columbarius, Eremias argus, Prionailurus bengalensis, Copris tripartitus - Iris koreana, Abeliophyllum distichum

< 토론문 1> 한강을이젠쉬게하자 - 보호종 ( 멸종위기종, 특정종 ) 을중심으로 - 제작기관 조사내용 한강하구전략회의 - 강화도시민연대, DMZ 생태연구소, 한국갯벌생태연구소 - 한국환경생태연구소, 녹색연합, 인천녹색연합 - 김포경제정의실천시민연합환경부지정보호종 (

< 토론문 1> 한강을이젠쉬게하자 - 보호종 ( 멸종위기종, 특정종 ) 을중심으로 - 제작기관 조사내용 한강하구전략회의 - 강화도시민연대, DMZ 생태연구소, 한국갯벌생태연구소 - 한국환경생태연구소, 녹색연합, 인천녹색연합 - 김포경제정의실천시민연합환경부지정보호종 ( < 토론문 1> 한강을이젠쉬게하자 - 보호종 ( 멸종위기종, 특정종 ) 을중심으로 - 제작기관 조사내용 한강하구전략회의 - 강화도시민연대, DMZ 생태연구소, 한국갯벌생태연구소 - 한국환경생태연구소, 녹색연합, 인천녹색연합 - 김포경제정의실천시민연합환경부지정보호종 ( 멸종위기종, 특정종 ), 천연기념물 ( 조류, 식물, 양서, 파충류, 어류, 육상곤충, 저서,

More information

(9-3)B-본문.hwp

(9-3)B-본문.hwp Journal of Climate Change Research 2018, Vol. 9, No. 3, pp. 235 243 DOI: https://doi.org/10.15531/ksccr.2018.9.3.235 지구온난화에따른국내멸종위기야생동물의민감도및취약성분석 김진용 * 홍승범 ** 신만석 * * 국립생태원융합연구실연구원 ** 국립생태원융합연구실선임연구원 Analysis

More information

10.hwp

10.hwp ():, Korean J. Ecol. 한강지역조류군집의특성 이우신 박찬열 임신재 적요 :,,,..,,,,...,,,,,,,.. 검색어 :,,,, 서론 (Miller )... ( )... () (), (). (), () ( ).,.. 조사지역및방법, (Table ). ( ), ( ), ( ), ( ).. (, ) ( ).,,, ( ).,,, ( ),,,,. (H')

More information

KCHTOSXBVKPF.hwp

KCHTOSXBVKPF.hwp 1 새만금일대의조류 새만금일대의조류 이윤경 국립환경과학원 김희윤 서울대학교 * * 요약 새만금(356033) 일대에대한조류조사는 21년 2~10 월에실시되었다. 이지역에 서확인된조류는총 54 종이었다. 멸종위기조류Ⅰ급은 1 종( 노랑부리백로), 멸종위기조 류Ⅱ급은 2 종( 큰기러기, 검은머리물떼새), 보호종은 6 종( 큰회색머리아비, 회색머리아비, 뿔논병아리,

More information

408.fm

408.fm Journal of Korean Nature Vol. 5, No. 4 335-343, 2012 http://dx.doi.org/10.7229/jkn.2012.5.4.335 A Study on the Change of Birds Community in Gyeongju National Park Jae-Pyoung Yu, In-Hwan Paik, Seon-Deok

More information

Red Data Book 5 한국의 멸종위기 야생동 식물 적색자료집 관속식물 Red Data Book of Endangered Vascular Plants in Korea

Red Data Book 5 한국의 멸종위기 야생동 식물 적색자료집 관속식물 Red Data Book of Endangered Vascular Plants in Korea Red Data Book 5 한국의 멸종위기 야생동 식물 적색자료집 관속식물 Red Data Book of Endangered Vascular Plants in Korea Red Data Book 5 한국의 멸종위기 야생동 식물 적색자료집 관속식물 Red Data Book of Endangered Vascular Plants in Korea 발간사 생물다양성

More information

<BACF3FC1DF20C1A2B0E6C1F6BFAA20B0B3B9DFC7F6C8B220B9D720C8AFB0E6BBF3C5C220C1B6BBE72833C2F72928B0ADC5C3B1B8292E687770>

<BACF3FC1DF20C1A2B0E6C1F6BFAA20B0B3B9DFC7F6C8B220B9D720C8AFB0E6BBF3C5C220C1B6BBE72833C2F72928B0ADC5C3B1B8292E687770> 사업보고서 2013-07-02 북 중 접경지역 개발현황 및 환경상태 조사(3차) 강택구 외 편 연구진 연구책임자 참여연구진 강택구 (한국환경정책 평가연구원 부연구위원) 노태호 (한국환경정책 평가연구원 연구위원) 추장민 (한국환경정책 평가연구원 연구위원) 오일찬 (한국환경정책 평가연구원 부연구위원) 이호림 (중국 연변대학교 농학과 교수) 박인철 (중국 연변대학교

More information

176 Jae-Pyoung Yu et al. Fig. 1. The location map of the survey areas in Ulleungdo, Korea (A: Nari Basin & Sunginbong area, B: Tracking course area, C

176 Jae-Pyoung Yu et al. Fig. 1. The location map of the survey areas in Ulleungdo, Korea (A: Nari Basin & Sunginbong area, B: Tracking course area, C Journal of Asia-Pacific Biodiversity Vol. 6, No. 1 175-187, 2013 http://dx.doi.org/10.7229/jkn.2013.6.1.175 Characteristics of Birds Community in Ulleung Island, Korea Jae-Pyoung Yu 1, Seon-Deok Jin 1,

More information

류새한 박시룡 * 강상준 ** Riparian Vegetation and Bird Biotope of Urban Stream with Special Reference to Mushimcheon-River of Cheonju City, Chungbuk Province S

류새한 박시룡 * 강상준 ** Riparian Vegetation and Bird Biotope of Urban Stream with Special Reference to Mushimcheon-River of Cheonju City, Chungbuk Province S 류새한 박시룡 * 강상준 ** Riparian Vegetation and Bird Biotope of Urban Stream with Special Reference to Mushimcheon-River of Cheonju City, Chungbuk Province School of Science Education, College of Education, Chungbuk

More information

뿐이리라 23 내가 속한 바 곧 내가 섬기는 하나님의 사자가 어제 밤에 내 곁에 서서 말하되 24 바울아 두려워하지 말라 네가 가이사 앞에 서야 하겠고 또 하나님께서 너와 함께 항해하는 자를 다 네게 주셨다 하였으니 25 그러므로 여러분이여 안심하라 나는 내게 말씀하신

뿐이리라 23 내가 속한 바 곧 내가 섬기는 하나님의 사자가 어제 밤에 내 곁에 서서 말하되 24 바울아 두려워하지 말라 네가 가이사 앞에 서야 하겠고 또 하나님께서 너와 함께 항해하는 자를 다 네게 주셨다 하였으니 25 그러므로 여러분이여 안심하라 나는 내게 말씀하신 2015 년 6 월호 기쁨의 언덕으로 소그룹 교재 (월간주제: 죽도록 충성, 죽어도 영광) 첫째주 소그룹 모임 사명자의 길 찬송: 383 장 (새 336 장) 환난과 핍박 중에도 367 장 (새 341 장) 십자가를 내가 지고 355 장 (새 323 장) 부름받아 나선 이 몸 본문: 사도행전 27:9-25 9 여러 날이 걸려 금식하는 절기가 이미 지났으므로

More information

< FC1B6B7F95FC1B6BBE7C7A52E786C7378>

< FC1B6B7F95FC1B6BBE7C7A52E786C7378> No 종코드 종명과명목명도엽특이사항격자번호국명학명국문영문국문영문도엽번호도엽명 조사일자 조사시간날씨개체수집단수면종여부집단번식여부책임조사자 일반조사자 1 GSBD00172 멧비둘기 Streptopelia orientalis 비둘기과 Columbidae 비둘기목 Columbiformes 346013 암태 E3 2012-03-31 오전 맑음 2 n n 이한수 신용운

More information

<31302EB3B2BBFDC0CC20BCADBDC4C3B320BAB9BFF8C0BB20C0A7C7D120BCADBDC4C3B320B8F0C7FC20BFACB1B8283131352D313235292E687770>

<31302EB3B2BBFDC0CC20BCADBDC4C3B320BAB9BFF8C0BB20C0A7C7D120BCADBDC4C3B320B8F0C7FC20BFACB1B8283131352D313235292E687770> 韓 國 環 境 復 元 技 術 學 會 誌 16(2):115~125(2013) J. Korean Env. Res. Tech. 16(2):115~125(2013) 남생이 서식처 복원을 위한 서식처 모형 연구* 김수련 2) 이지현 1) 송재영 3) 장민호 3) 성현찬 4) 조동길 1) 1) 넥서스환경디자인연구원(주) 2) 단국대학교 대학원 3) 국립공원관리공단 국립공원연구원

More information

43-4대지04공우석외3iok

43-4대지04공우석외3iok Disjunctive Distribution of Vaccinium vitis-idaea and Thermal Condition* Woo-seok, Kong** Jong-Hwan, Lim*** 350m 1,200m 6.6 Abstract Vaccinium vitis-idaea or lingonberry, a typical arctic-alpine plant,

More information

<30312E28B8AEBAE429B9AEC8EFB1D428C4AEB6F3292E687770>

<30312E28B8AEBAE429B9AEC8EFB1D428C4AEB6F3292E687770> J Plant Biotechnol (2010) 37:343 356 DOI:10.5010/JPB.2010.37.4.343 Review 국내 임목류 기내증식 연구현황 및 전망 문흥규 김용욱 박소영 한무석 이재선 A review of forest trees micropropagation and its current status in Korea Heung Kyu Moon

More information

untitled

untitled 08 2014 Vol. 117 www.cha.go.kr ..,,,..,. 우측 마크는 시각장애인을 위한 음성변환 보이스아이 바코드입니다. 26 문화재 가까이 보기 ǎ᮹ ᰂᔢ 28 문화재를 밝히는 사람들 ᬑญ ᩍ۵ ᙁ ǢDZ ಽ ᪅ᖙ ᙹǢ šญᗭ ᯕᔢ ᵝ š / ᯕ 30 근대와 현대의 조우 ᨖ ݍ ə ᯕ ᦥᯕᜅ / ၶᱶ႑ 특집 삶의 유산이 꽃피다 찬란하게 꽃피운

More information

<3335373135342DC1F8BBF32DBEEEB7F92DC6EDC1FD2E687770>

<3335373135342DC1F8BBF32DBEEEB7F92DC6EDC1FD2E687770> 진상 일대의 담수어류 진상 일대의 담수어류 고명훈 유민정 전북대학교 요 약 진상(357154) 일대에서 채집된 어류는 모두 5과 17종이었으며, 우점종은 참갈겨니, 아우점종은 피라미, 민물검정망둑, 황어였다. 외래종은 떡붕어 1종이 서식하였으며, 출현종 중 한국고유종은 큰줄납자루, 긴 몰개, 참몰개, 참갈겨니, 왕종개, 줄종개 6종이었다. 1. 서 론 본 조사

More information

새와생명의터조류목록 The Birds Korea Checklist 글 편집 나일무어스 하정문서해민

새와생명의터조류목록 The Birds Korea Checklist 글 편집 나일무어스 하정문서해민 1 새와생명의터조류목록 The Birds Korea Checklist 글 편집 나일무어스 하정문서해민 새와생명의터는황해연안을중심으로한국의새들과그들의서식지를보전하기위해노력하는소규모단체입니다. 새들과서식지의상황을증진시키기위해지속적으로조류목록을만들어공개하고있습니다. 2007 년과 2009년에한반도에서기록된새들을온라인목록으로발표한것을시작으로 2013년과 2014 년에다시금목록을개정했습니다.

More information

untitled

untitled 1 2 3 4 5 006 009 020 024 028 032 036 040 044 050 056 064 070 086 090 188 192 195 199 202 205 209 212 214 219 102 110 224 6 7 6 008 9 8 9 9 10 10 11 11 12 12 13 13 14 14 15 15 16 16 17 17 18 19 파주 20 1)

More information

< FC1B6B7F95FC1B6BBE7C7A52E786C7378>

< FC1B6B7F95FC1B6BBE7C7A52E786C7378> No 종코드 종명과명목명도엽특이사항격자번호국명학명국문영문국문영문도엽번호도엽명 조사일자 조사시간날씨개체수집단수면종여부집단번식여부책임조사자 일반조사자 1 GSBD00259 큰부리까마귀 Corvus macrorhynchos 까마귀과 Corvidae 참새목 Passeriformes 379144 죽변 E1 2012-04-26 오전 맑음 4 n n 박헌우 최순규 2 GSBD00172

More information

<C7CABCBAC6EDC1FD2D303220B4EBB9DF20C7CFC3B520C1B6B7F9303130372D323031352E687770>

<C7CABCBAC6EDC1FD2D303220B4EBB9DF20C7CFC3B520C1B6B7F9303130372D323031352E687770> 2014년도 정책연구보고서 2014-33 대전시 3대 하천에 서식하는 조류의 분포 및 관리 방안 연구 연구진 연구책임 연구참여 이은재 연구위원 : 도시기반연구실 정환도 책임연구위원 : 도시기반연구실 이재근 책임연구위원 : 도시기반연구실 조사참여 김인규, 조해진 연구원 : 한국환경생태연구원 자문위원 백인환연구원 (국립중앙과학관) 진선덕박사 (국립중앙과학관)

More information

(02이승록).fm

(02이승록).fm Journal of National Park Research, Vol. 2, No. 4, pp. 194-202 (2011) 설악산국립공원의어류상 이승록 1 * 조용성 1 이동운 2 1 국립공원관리공단국립공원연구원, 2 국립공원관리공단북한산사무소 Fauna of Freshwater Fish in Seoraksan National Park Seung-Rok Lee

More information

발간등록번호 11-1480523-001564-01 전국내륙습지정밀조사 국립습지센터 이정현, 양희선, 김태성, 이정희, 이창우, 이창수, 정지웅, 문상균, 강미정, 양병국 2013 목차 목 차 목차 ⅰ 표목차 ⅲ 그림목차 ⅳ Abstract ⅴ I. 서론 1 II. 조사내용및방법 3 1. 조사기간 3 2. 조사지역 3 가. 해남고천암호 3 나. 곡성백련제습지

More information

<30352DC3D6BFEBC0C728C0CFB9DD292E687770>

<30352DC3D6BFEBC0C728C0CFB9DD292E687770> J Plant Biotechnol (2014) 41:94 99 DOI:http://dx.doi.org/10.5010/JPB.2014.41.2.94 ISSN 1598-6365 Research Article 희귀수종미선나무 (Abeliophyllum distichum Nakai.) 의기내증식및발근에미치는 LED (light emitting diode) 효과 이나념

More information

<4D F736F F D20BAD3C0BAB1CDB0C5BACFC0C7C7D1BEE0C0E7B5EEC8B0BFEBB9E6BEC8BFA1B0FCC7D1BFACB1B8>

<4D F736F F D20BAD3C0BAB1CDB0C5BACFC0C7C7D1BEE0C0E7B5EEC8B0BFEBB9E6BEC8BFA1B0FCC7D1BFACB1B8> I. II. III. 1. 1) (1) ( ) [ ] Reeve's turtle [ ] Geoclemys(Chinemys) reevesii [ ] -, -kusa kame, - () [ ] [ ] 2025cm 30cm.,,.,...,.. [ ] [ ].. [ ] 68 1 46. [ ].,. [ ] a. 120130.,,.. (2) [ ] Trionyx sinensis

More information

ISSN (Print) ISSN (Online) ORIGINAL ARTICLE Korean J Parasitol Vol. 56, No. 4: , August

ISSN (Print) ISSN (Online) ORIGINAL ARTICLE Korean J Parasitol Vol. 56, No. 4: , August ISSN (Print) 0023-4001 ISSN (Online) 1738-0006 ORIGINAL ARTICLE Korean J Parasitol Vol. 56, No. 4: 341-349, August 2018 https://doi.org/10.3347/kjp.2018.56.4.341 Infections with Centrocestus armatus Metacercariae

More information

Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard by Yoo Kyung Lee, Gyu Lee, Eun Ju Lee 다산과학기지 주변에서 볼 수 있는 북극 식물 Arctic Plants living in N

Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard by Yoo Kyung Lee, Gyu Lee, Eun Ju Lee 다산과학기지 주변에서 볼 수 있는 북극 식물 Arctic Plants living in N 다산과학기지 주변에서 볼 수 있는북극 식물 Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard 북극식물-본문p001-019(0409).indd 1 2012-04-10 오후 4:36: Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard by Yoo

More information

μ μ μ matk_193f trnk_670f matk_520r matk_1246r rbcl accd matk matk trnk (5 ) trnk (3 ) trnk_670f CTGTATCGCACTATGTATC matk_193f GTTATTCGAATGTATCAACAG matk_520r CTCATGCTTGCATTTATTACG matk_1246r CTTTCTCATTATTACAGCGG

More information

Journal of Climate Change Research 2017, Vol. 8, No. 3, pp DOI: 지리산국립공원세석지역의아고산관속식물상 노일 * 정재민 *

Journal of Climate Change Research 2017, Vol. 8, No. 3, pp DOI:   지리산국립공원세석지역의아고산관속식물상 노일 * 정재민 * Journal of Climate Change Research 2017, Vol. 8, No. 3, pp. 201 211 DOI: http://dx.doi.org/10.15531/ksccr.2017.8.3.201 지리산국립공원세석지역의아고산관속식물상 노일 * 정재민 ** 조민기 *** 김태운 **** 문현식 **** * 국립공원관리공단내장산사무소, ** 국립수목원산림자원보존과,

More information

16년 조선왕릉 역사문화경관림 자원조사 연구 종합평가

16년 조선왕릉 역사문화경관림 자원조사 연구 종합평가 2010~2016 년종합평가 문화유산헌장 CULTURAL HERITAGE CHARTER 문화유산은 우리 겨레의 삶의 예지와 숨결이 깃들 어 있는 소중한 보배이자 인류 문화의 자산이다. A nation's cultural heritage embodies its intellectual and spiritual contributions to the civilization

More information

<C1A631C8B8C6F7C0AFB7F9BFACB1B8C8B8C3A5C0DA28C8ABC0B1C1F6292E687770>

<C1A631C8B8C6F7C0AFB7F9BFACB1B8C8B8C3A5C0DA28C8ABC0B1C1F6292E687770> 제 1회포유류연구회모임 자료집 일시: 2010년 12월 11 일 ( 토요일) 오후 2:00-6:00 장소: 서울대학교수의과대학 3층스코필드홀 주최 : 서울대학교야생동물유전자원은행 프로그램 오후 2:00-3:00 등록, 포스터전시 3:00-5:00 각기관및연구실연구현황소개 ( 소개기관수에따라시간조정가능) 5:00-6:00 포스터질의/ 응답 6:00- 만찬과뒤풀이

More information

도감본문(수정)~10p

도감본문(수정)~10p 두번째이야기 덩굴나무 두번째이야기덩굴나무 6 00 Pinus densiflora Siebold & Zucc. 4 5 6 6 5 4 7 8 9 P. densiflora P. densiflora for. multicaulis P. densiflora for. erecta 0 6 산에서자주만나는큰키나무 덩굴나무 8 산에서자주만나는큰키나무 덩굴나무 덩굴나무차례 9

More information

<C3D6C1BEBAB8B0EDBCAD5FC7A5C1F62E687770>

<C3D6C1BEBAB8B0EDBCAD5FC7A5C1F62E687770> 훼손된 자연생태계 복원기술 Restoration Technology of Damaged Ecosystem 도시녹지공간의 생태 corridor 설계기법 Development of Design Technology for the Eco-corridor in Urban Area 고려대학교 환 경 부 보고서 초록 연구과제명 코드번호 (국문) 도시녹지공간의 생태 corridor

More information

1 1 10-0767050 2 10-1166045 3 10-0895586 4- - 10 4 10-1616887 11 5 10-1358259 12 6 10-0775080 7 10-0973839 8 10-1165269 15 9 10-1056952 16 10 10-1551559 11 10-1179175 12 10-1179177 19 13 10-1136822 20

More information

저작자표시 - 비영리 - 동일조건변경허락 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 이차적저작물을작성할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비

저작자표시 - 비영리 - 동일조건변경허락 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 이차적저작물을작성할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비 저작자표시 - 비영리 - 동일조건변경허락 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 이차적저작물을작성할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 동일조건변경허락. 귀하가이저작물을개작, 변형또는가공했을경우에는,

More information

13-ºÎ·Ï¸ðÀ½-0312

13-ºÎ·Ï¸ðÀ½-0312 Pinus thunbergii Parlatore Abies holophylla Maximowicz Pinus densiflora Siebold et Zuccarini Juniperus chinesis Linnaeus Pinus densiflora for. erecta Uyeki Juglans mandshurica Maximowicz Ginkgo biloba

More information

untitled

untitled 11-1400119-000205-01 THE FOREST EDUCATION PROGRAM THE FOREST EDUCATION PROGRAM 93520 9 788997 450602 ISBN 978-89-97450-60-2 THE FOREST EDUCATION PROGRAM 20149 031-540-2000 415 aplan Tomorrow FOUR SEASONS

More information

제 3 차사적분과위원회회의록

제 3 차사적분과위원회회의록 제 3 차사적분과위원회회의록 (표 참고)의 추가지정도 필요한 사항임 갑곶진 및 갑곶돈대 3. 갑곳리 1050-1 제외 요청 - 갑곳리 1050-1번지의 경우 소유자와 소유자의 자녀와 유선통화를 통해 문화재구역 지정에

More information

R hwp

R hwp 목적기초연구 1 * Anticomplement Activities of Korean Indigeneous Plants No. Plant name Srientific name Family Activity(IC50) 98112 해변싸리 Lespedeza martrima 콩과 12.2 96019 지리산오갈피 Acanthopamax chiisanensis

More information

< C2F7C6EDC1FD BDC3C7E8BFACB1B8BAB8B0EDBCAD2E687770>

< C2F7C6EDC1FD BDC3C7E8BFACB1B8BAB8B0EDBCAD2E687770> 어젠다코드 4-16 - 56 구 분 과제완결 기술분야코드 V2 기술유형코드 P01 작목구분코드 LP-02-4130 과제종류 공동연구 세세부사업 국책기술개발 연구과제및세부과제 수행기간 과제책임자및세부책임자 설사방지및항원충성항생제대체물질개발 10~ 12 국립축산과학원 김동운 2) 항생제대체물질개발을위한식물자원탐색및공급체계확립 10~ 12 인삼약초연구소이광재 색인용어

More information

<38392D B1E8BBF3C5C22E666D>

<38392D B1E8BBF3C5C22E666D> 한국자연보호학회지, 제 10 권제 2 호 (2016) Korean Journal of Nature Conservation Vol. 10, No. 2, pp. 89-100 ISSN (Pring) 1976-6769 ISSN (Online) 2287-8122 https://doi.org/10.11624/kjnc.2016.10.2.089 DNA 보존을위한 FTA 카드의관속식물분류군별적용성조사

More information

<B3EDB9AE3128C3D6C1BE292E687770>

<B3EDB9AE3128C3D6C1BE292E687770> 연구논문 / 1 최근 5년동안한라산영실일대소나무림장기생태연구지내수목분포특성변화고정군, 김권수, 한태완 최근 5년동안동백동산일대상록활엽수림장기생태연구지내수목분포특성변화고정군, 김권수, 한태완 한라산정상일대야생동물분포특성오장근, 이영돈, 강인보, 김창조, 양영환 제주의멧돼지분포와행동권조사연구오장근, 이영돈, 강인보, 김창조, 양영환 백록담내딱정벌레목곤충의분포특성이영돈,

More information

Ⅲ Ⅲ - i - - ii - - iii - - iv - - v - - vi - - vii - - viii - - ix - - x - - xi - - xii - - xiii - - xiv - - xv - - xvi - - 1 - - 1 - - 2 - - 3 - - 4 - PH - 5 - 90 80 70 60 개체수 50 40 51 59 통발목견 30 20

More information

102.fm

102.fm Journal of Asia-Pacific Biodiversity Vol. 6, No. 1 31-81, 2013 http://dx.doi.org/10.7229/jkn.2013.6.1.031 The Vascular Plant Species in the Korean Demilitarized zone (DMZ) Chang Hyeon Lee 1, Hyun Tak Shin

More information

Journal of Climate Change Research 2015, Vol. 6, No. 4, pp DOI: * ** *** *** * ***, *, **, ***

Journal of Climate Change Research 2015, Vol. 6, No. 4, pp DOI:   * ** *** *** * ***, *, **, *** Journal of Climate Change Research 2015, Vol. 6, No. 4, pp. 379 388 DOI: http://dx.doi.org/10.15531/ksccr.2015.6.4.379 * ** *** *** * ***, *, **, *** ( ) Ecological Characteristics of Abies koreana Forest

More information

조경식물학 - 활엽수 계열(2) -

조경식물학 - 활엽수 계열(2) - 조경식물학 - 상록활엽수외 - 1. 녹나무 내한성 : 약함 음양성 : 중용수 녹나무 Cinnamomum camphora 성상 : 상록활엽교목 수형 : 타원형 분포 : 난온대지역 이식 : 어려움 번식 : 실생 / 삽목 대기정화능력우수, 환경정화수 기조, 녹음, 가로수, 방풍, 방화식재 2. 생달나무 내한성 : 약함 음양성 : 음수 생달나무 Cinnamomum

More information

12 Korean Journal of Agricultural and Forest Meteorology, Vol. 16, No. 1 다 (Kim et al., 2012). 여러가지생물종이어우러져구성된생물군집은종간상호작용이다양할것이므로종다양성이높은군집은구조적으로복잡할것이다

12 Korean Journal of Agricultural and Forest Meteorology, Vol. 16, No. 1 다 (Kim et al., 2012). 여러가지생물종이어우러져구성된생물군집은종간상호작용이다양할것이므로종다양성이높은군집은구조적으로복잡할것이다 한국농림기상학회지, 제 16 권제 1 호 (2014) (pissn 1229-5671, eissn 2288-1859) Korean Journal of Agricultural and Forest Meteorology, Vol. 16, No. 1, (2014), pp. 11~21 DOI: 10.5532/KJAFM.2014.16.1.11 c Author(s) 2014.

More information

<BFACB1B8C0DAB7E C8A328C8F1B1CDC0AFC0FCC0DABFF8292DB3BBC1F6C6ED2E687770>

<BFACB1B8C0DAB7E C8A328C8F1B1CDC0AFC0FCC0DABFF8292DB3BBC1F6C6ED2E687770> KOREA FOREST RESEARCH INSTITUTE 발간사 산림은물, 공기, 휴양등으로인류에간접적인크나큰혜택을주고있으며, 산업사회가발전할수록기후변화와더불어산림자원의존재가치와중요성이더욱더높아지고있습니다. 그중에서도고급용재수, 약용수등의산림유전자원은직접적인활용가치가높은생물자원입니다. 아울러생물산업발달과더불어산림유전자원은다양성이요구되는미래사회의중요한생명자원으로서그역할은이루말할수없을것입니다.

More information

UM00003782.PDF

UM00003782.PDF 1 북한 산림 생태계의 지속가능한 관리 방안에 관한 연구 강 호 상 (서울대 객원연구원) 목 차 요약문 3 1. 서 론 5 2. 북한의 자연자원 8 3. 북한의 산림자원 16 4. 북한의 산림황폐화 원인 및 현황 18 5. 훼손된 북한 산림생태계의 복원 25 6. 장기생태연구지 설정 및 연구 31 7. 동북아시아 국가간 산림 network 조성 및 교류 협력

More information

<32B1B32D3320B2C9C2F7BFEB28C7D1BFB5BCF7292E687770>

<32B1B32D3320B2C9C2F7BFEB28C7D1BFB5BCF7292E687770> KOREAN J. FOOD COOKERY SCI. Vol. 27, No. 3 June, 2011 꽃차용꽃추출물의구강위생균에대한항균특성 한영숙 ¹ 강소진 ¹ 박세아 ¹ 이선숙 ² 송희자 ³ ¹ 성신여자대학교식품영양학과, ² 목원대학교건강관리학과, ³ 머루랑다래랑 Antibacterial Activities of Flower Tea Extracts against

More information

2 대한스포츠한의학회지 제15권 제1호(2015년 7월) Ⅰ. 서론 도핑(dopping)의 유래는 18세기 경 남아프리카 부족이 의식에서 사용한 음료 중 흥분 효과가 있는 것을 '도프(dop)'라고 한 것에서 부터 시작된 것으 로 알려져 있다 1). 하지만 고대 그리스

2 대한스포츠한의학회지 제15권 제1호(2015년 7월) Ⅰ. 서론 도핑(dopping)의 유래는 18세기 경 남아프리카 부족이 의식에서 사용한 음료 중 흥분 효과가 있는 것을 '도프(dop)'라고 한 것에서 부터 시작된 것으 로 알려져 있다 1). 하지만 고대 그리스 대한스포츠한의학회지 제15권 제1호(2015년 7월) J Sports Korean Med 2015;15(1):1-9 2015년 한약의 도핑관리 윤성중 1,2 제정진 1 이훈 1 김유진 1 이현삼 1 1 대한스포츠한의학회 도핑방지위원회, 2 경희장수한의원 Anti-dopping of herbal medicine in 2015 Sung Joong Yun 1,2,

More information

담양군 도래수마을의 식물상 조사 분석

담양군 도래수마을의 식물상 조사 분석 담양군도래수마을의식물상조사분석 박미정 1, 최진아 1* 2 1, 이상화, 김은자, 전보배, 유준완 1 1 1. 국립농업과학원 2. 녹색마당 Vegetation Survey and Analysis in Damyang-gun Doraesoo Village Park Meejeong 1, Choi Jin-a 1*, Lee Sanghwa 2, Kim Eunja 1,

More information

*

* * 제 3 차전국자연환경조사담수무척추현지조사표 좌표조사시간종명개체수하천일련법정도엽명격자번호 N E 조사일자또는번호개시종료국명학명보호종도분초도분초풍부도계곡평지강 001 온양 367013E1 127 0 48 36 50 39 06/5/20 애기물달팽이 Austropeplea ollula ++ 002 온양 367013E1 실지렁이 Limnodrilus socialis

More information

< 표지설명 > 한라산에자생하는왕벚나무와이나무의염색체.

< 표지설명 > 한라산에자생하는왕벚나무와이나무의염색체. 연구보고 발 간 등 록 번 연구보고 호 11-01 11-1400377-000436-01 11 01 제주지역 산림유전자원의 수집 및 보존연구 제주지역 산림유전자원의 수집 및 보존연구 김찬수 김수영 변광옥 국립산림과학원 국립산림과학원 KOREA FOREST RESERCH INSTITUTE < 표지설명 > 한라산에자생하는왕벚나무와이나무의염색체. 제주지역산림유전자원의

More information

韓資植誌 Korean J. Plant Res. 24(5) : 549~556(2011) Chen, 2002; Walther et al., 2002; Lee et al., 2009). 기후변화에따른생물계절변화연구는장기간의모니터링을통해이루어지며, 계절변화연구는최근기후변화와기

韓資植誌 Korean J. Plant Res. 24(5) : 549~556(2011) Chen, 2002; Walther et al., 2002; Lee et al., 2009). 기후변화에따른생물계절변화연구는장기간의모니터링을통해이루어지며, 계절변화연구는최근기후변화와기 연구논문韓資植誌 24(5) : 549~556(2011) Korean J. Plant Res. 한반도아고산지대내기후변화취약식물종의식물계절성변화연구 - 덕유산정상지역을중심으로 - 김혁진, 홍정기, 김상철, 오승환 1, 김주환 * 경원대학교생명과학과, 1 국립수목원 Plant Phenology of Threatened species for Climate change

More information

저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,

More information

Method Country Vegetation type Reference AA Japan Quercus-mixed Kirita(1971) Japan Quercus-mixed Nakane(1975) CC China glassland Jia et al.(2006) Japan deciduous forest Hirano e tal.(2003) USA hardwood

More information

103.fm

103.fm Journal of Korean Nature Vol. 3, No. 1 15-24, 2010 Insect Fauna of Is. Boleum-do (Prov. Gyeonggi-do), Korea Seong-Joon Park 1 *, Young-Ho Cho 2, Young-Jin Kim 2, Yong-Gu Han 2, Heon-Myoung Lim 1, Seo-Kyoung

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012 년전국자연환경조사 - 식물 - 유기억 - 영월 목명과명출현종영월 (378142) 도엽특이사항영문한글영문한글학명국명 E6 Equisetales 속새목 Equisetaceae 속새과 Equisetum arvense 쇠뜨기 Filicales 고사리목 Dennstaedtiaceae 잔고사리과 Dennstaedtia wilfordii

More information

韓資植誌 Korean J. Plant Res. 28(4) : 511~525(2015) 소, 기암 10개소, 계곡 4개소, 해변 1개소등 26개소의경관자원이있으며, 공원깃대종은소나무와원앙이다 (Korea National Park Service, 2013). 경주국립공원의

韓資植誌 Korean J. Plant Res. 28(4) : 511~525(2015) 소, 기암 10개소, 계곡 4개소, 해변 1개소등 26개소의경관자원이있으며, 공원깃대종은소나무와원앙이다 (Korea National Park Service, 2013). 경주국립공원의 Korean J. Plant Res. 28(4):511-525(2015) http://dx.doi.org/10.7732/kjpr.2015.28.4.511 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article 경주국립공원구미산지구에분포하는관속식물상 유주한 1 *, 권순영 2 1 동국대학교경주캠퍼스조경학과,

More information

Microsoft PowerPoint - Week02-basics

Microsoft PowerPoint - Week02-basics Tree of Life project http://tolweb.org/tree/ org/tree/ http://www.youtube.com/watch?v=h6iruudbozo&feature=related 녹색식물의계통도 차축조 육상식물 관속식물 선태류 녹조 계통수에대한기본적용어들 말단절 OUTGROUP ( 외군 ) 내부절 가지 기부 Tree 는 mobile

More information

Korean J. Plant Res. 29(2): (2016) Print ISSN Online ISSN Original Research Art

Korean J. Plant Res. 29(2): (2016)   Print ISSN Online ISSN Original Research Art Korean J. Plant Res. 29(2):241-263(2016) http://dx.doi.org/10.7732/kjpr.2016.29.2.241 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article 석회암지대석병산일대의관속식물상 송재모 1, 손호준 2, 김영설 3, 김세창 3, 이다현

More information

fm

fm Korean J. Pl. Taxon. 47(3): 264 288 (2017) https://doi.org/10.11110/kjpt.2017.47.3.264 pissn 1225-8318 eissn 2466-1546 Korean Journal of Plant Taxonomy A checklist of endemic plants on the Korean Peninsula

More information

김진일_국문겉표지

김진일_국문겉표지 대한민국생물지 제 권 호상기문류 절지동물문 : 곤충강 : 딱정벌레목 : 풍뎅이상과 제 권 호 상기문류 절지동물문 : 곤충강 : 딱정벌레목 : 풍뎅이상과 환경부국립생물자원관 제 권 호상기문류 절지동물문 : 곤충강 : 딱정벌레목 : 풍뎅이상과 집필자 : 김진일 성신여자대학교 ,,,,. : ,,,,,,. 1992 21. 2010 ABS.., 3 7. 2006.

More information

년연구과제요약문 과제명광주광역시자연환경조사연구 -4 차년도 연구기간 사업비 47.5백만원성과산출부분정책반영 ( ), 조사연구 (0), 기술개발 ( ), 기타 ( ) 연구목적및목표 본연구는광주광역시의자연환경의현황을파악하고, 연차적으로자연환

년연구과제요약문 과제명광주광역시자연환경조사연구 -4 차년도 연구기간 사업비 47.5백만원성과산출부분정책반영 ( ), 조사연구 (0), 기술개발 ( ), 기타 ( ) 연구목적및목표 본연구는광주광역시의자연환경의현황을파악하고, 연차적으로자연환 년연구과제요약문 과제명광주광역시자연환경조사연구 -4 차년도 연구기간 2018.5. - 2018.12 사업비 47.5백만원성과산출부분정책반영 ( ), 조사연구 (0), 기술개발 ( ), 기타 ( ) 연구목적및목표 본연구는광주광역시의자연환경의현황을파악하고, 연차적으로자연환경이변화되는과정을추적하고해석하여광주광역시의각자연환경인자별자연환경지표 ( 기준 ) 를미래지향적으로설정하며,

More information

206 채병수 김상기 강영훈 허남수 유동욱 박재민 하헌욱 al., 1996; Hong, 1996) 에대한조사, 환경부에서수행하고있는전국자연환경조사 (ME, 2000~2002) 등주기적으로어류상조사가수행되어왔다. 차천과현풍천의어류에대한연구는전국자연환경조사 (ME, 199

206 채병수 김상기 강영훈 허남수 유동욱 박재민 하헌욱 al., 1996; Hong, 1996) 에대한조사, 환경부에서수행하고있는전국자연환경조사 (ME, 2000~2002) 등주기적으로어류상조사가수행되어왔다. 차천과현풍천의어류에대한연구는전국자연환경조사 (ME, 199 KOREAN JOURNAL OF ICHTHYOLOGY, Vol. 29, No. 3, 205-217, September 2017 ISSN: 1225-8598 (Print), 2288-3371 (Online) Received: September 7, 2017 Revised: September 18, 2017 Accepted: September 22, 2017 회천및인접소하천들의어류상과군집구조

More information

82 Journal of Agriculture & Life Science 47(3) was possible to find out that the area of the dam could become a safe shelter and a habitat with a suff

82 Journal of Agriculture & Life Science 47(3) was possible to find out that the area of the dam could become a safe shelter and a habitat with a suff 농업생명과학연구 47(3) pp.81-92 Journal of Agriculture & Life Science 47(3) pp.81-92 진양호댐지역수달의서식지환경과이용형태에관한연구 민희규 1 김종갑 2 권오규 1* 1 경북대학교생태환경시스템학부산림환경자원전공, 2 경상대학교산림환경자원학과 ( 농업생명과학연구원 ) 접수일 (2012 년 7 월 11 일 ),

More information

102(1)-00(74).fm

102(1)-00(74).fm Jour. Korean For. Soc. Vol. 102, No. 1, pp. 1~21 (2013) JOURNAL OF KOREAN FOREST SOCIETY w p š 1 Á¼ 1 Á½ { 2 Á 1 1 w w w w, 2 s w w w A Reconsideration of the List of National Endemic Plants (appendix

More information

< C1A4C8EFB6F42E687770>

< C1A4C8EFB6F42E687770> J. Ecol. Field Biol. 29 (3): 265 275, 2006 대구인접지역삼림식생의진행천이와잠재자연식생 정흥락 * 전영문 1 이호준 1, 1 Progressive Succession and Potential Natural Vegetation on the Forest Vegetation in and surrounding Daegu, Korea Choung,

More information

<C3D6C1BEC6EDC1FD28313138C8A3292E687770>

<C3D6C1BEC6EDC1FD28313138C8A3292E687770> 硏 究 論 文 新 羅 八 部 衆 圖 像 전개에 있어 雙 塔 의 역할 신용철 통도사성보박물관 학예실장, 불교미술사 전공 38shin@hanmail.net Ⅰ. 머리말 Ⅱ. 신라석탑 팔부중상의 도상 및 배치 Ⅲ. 쌍탑 팔부중상의 도상변화 Ⅳ. 신라 팔부중상의 계보 Ⅴ. 맺음말 I. 머리말 신라석탑은 감은사지 삼층석탑에서 이중기단과 삼층 탑신이라는 전형 양식을 이룩한

More information

DMZ 철원두루미가이드북 DMZ Cheorwon Crane Field Guidebook

DMZ 철원두루미가이드북 DMZ Cheorwon Crane Field Guidebook DMZ 철원두루미가이드북 DMZ Cheorwon Crane Field Guidebook 세계자연기금 (World Wide Fund for Nature, WWF) 세계자연기금은 1961 년설립된비영리국제자연보전기관으로, 세계 100 여개국에서글로벌네트워크를구축해 500 만명이상의후원자들과함께활발히활동하고있습니다. WWF 는지구의자연환경을보전하고사람이자연과조화롭게살아가는미래를만들고자합니다.

More information

jumbongsanR3.hwp

jumbongsanR3.hwp 국립공원연구원연구보고 2 0 12-17 Nature, Our Future! 설악산국립공원 자연자원조사 - 점봉산 - 2012. 12. 국립공원탐방서비스헌장 우리공단임직원은국립공원이우리나라의자연생태계와자연및문화경관등을대표하는지역으로후손에물려주어야할소중한유산임을인식하고국민의여가생활과정서함양을위하여다음과같은자세로공원관리에임할것을약속합니다. 1. 다양한생태계, 유구한문화유산,

More information

DMZ 의식물 155 마일

DMZ 의식물 155 마일 DMZ의식물 155마일 을엮은우리의노력이식물을앞세워현실의휴전선을지워나가는길이되었으면합니다. 남과북의경계없이피고지는비무장지대의식물처럼말입니다. DMZ 의식물 155 마일 DMZ의식물 155마일 을엮은우리의노력이식물을앞세워현실의휴전선을지워나가는길이되었으면합니다. 남과북의경계없이피고지는비무장지대의식물처럼말입니다. 발행일 2016년 10월 15일발행처 국립수목원발행자

More information

〈표7

〈표7 1 경주일대의양서 파충류 경주일대의양서 파충류 김일훈 김빛나 강원대학교일반대학원생물학과 요약 본조사는 제3차전국자연환경 " 조사의일환으로 2012년 2월부터 10월까지경상북도경주시에위치한경주도엽 (359014) 에서식하고있는양서 파충류상를대상으로수행되었다. 조사결과, 총 3목 6과 12종의양서 파충류서식이확인되었다. 한반도고유종인한국산개구리 (Rana coreana)

More information

<30362DB9AEC8EFB1D428C0CFB9DD292E687770>

<30362DB9AEC8EFB1D428C0CFB9DD292E687770> J Plant Biotechnol (2014) 41:100 106 DOI:http://dx.doi.org/10.5010/JPB.2014.41.2.100 ISSN 1598-6365 Research Article 희귀식물제주황기의미세번식 한무석 노설아 곽명철 문흥규 Micropropagation of a rare plant species, Astragalus membranaceus

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012년전국자연환경조사 - 식물 - 심정기 - 도곡 목명과명출현종도곡 (377162) 도엽특이사항영문한글영문한글학명국명 E1 E2 E4 E5 Equisetales 속새목 Equisetaceae 속새과 Equisetum arvense 쇠뜨기 Filicales 고사리목 Aspleniaceae 꼬리고사리과 Athyrium iseanum

More information

2(2): 87~97, JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN Flora around Gudeok Campsite, Busan Metropolitan City, Korea Yo

2(2): 87~97, JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN Flora around Gudeok Campsite, Busan Metropolitan City, Korea Yo 2(2): 87~97, 2016. 12. JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN 2465-8146 Flora around Gudeok Campsite, Busan Metropolitan City, Korea You, Ju-Han ABSTRACT 국문초록 Corresponding author: You,

More information

제출문 환경부장관귀하 본보고서를 환경생태유량시범사업및제도운영방안 연구 ( 연구기간 : 2017 년 4월 13 일~2017 년 11월 30 일) 의 최종보고서로제출합니다. 2017년 11월 생물모니터링센터

제출문 환경부장관귀하 본보고서를 환경생태유량시범사업및제도운영방안 연구 ( 연구기간 : 2017 년 4월 13 일~2017 년 11월 30 일) 의 최종보고서로제출합니다. 2017년 11월 생물모니터링센터 환경생태유량시범사업및 제도운영방안연구 최종보고서 2017. 11 환경부 제출문 환경부장관귀하 본보고서를 환경생태유량시범사업및제도운영방안 연구 ( 연구기간 : 2017 년 4월 13 일~2017 년 11월 30 일) 의 최종보고서로제출합니다. 2017년 11월 생물모니터링센터 참여연구진 책임연구원 허준욱 : 생물모니터링센터 연구원 김영도서찬양이주헌장민호최지웅황대호

More information

11.hwp

11.hwp 23(3): 281 291, 2000 Korean J. Ecol. 금강송림의식생구조에관한정량적분석 윤충원 홍성천 적요 :,,,. 1) CCA,,,.,.,,. 2),,,,,.,. 3) 0.6622, 0.7,. 4), 0.6. 5).,. 검색어 :,, CCA,,,, 서론 1950 (classification) (ordination) (GreigSmith 1983),.

More information

<BACEC0CEB0FAC7D0C8B8C1F D3328C3D6C1BE292E687770>

<BACEC0CEB0FAC7D0C8B8C1F D3328C3D6C1BE292E687770> 6) 대한한방부인과학회지 J Korean Obstet Gynecol. VOL.27 NO.3 : 104-115 (2014) http://dx.doi.org/10.15204/jkobgy.2014.27.3.104 여드름치료한약처방과기능성화장품의개발을위한특허자료분석연구 동국대학교한의과대학부인과학교실김동일, 김수현, 안인숙, 최민선 ABSTRACT Analysis of

More information

소비형태보고서.PDF

소비형태보고서.PDF A0063-65610-57-0109 A Study on the Consumption Pattern and Pricing Structure of Major Oriental Medicines in Korea 2001. 5 : . 2001. 5. : : ( ) : ( ) : ( ) : ( ) : ( ) : ( ) : ( ) : ( ) : ( ) : ( ) : (

More information

untitled

untitled 兩 類 20070825 5 年 (Cambrian) 1 5 年 類 類 良 陸 陸 類 來 行 陸 來 行 不 陸 兩 類 類 更 率 陸 陸 數 陸 兩 類 不 兩 類 離 度 陸 錄 兩 3 6 泥 (Devonian) 類 (Subclass Labyrinthodontia) (Ichthyosteg ) (Acanthosteg Acanthostegidae) 兩 類 若 度 來 略

More information

정규영 서정수 * 박명순 이선희 최하나 정수영 Flora of Vascular Plants on Mt. Kookmang(Chungju, Chungbuk) School of Bioresource Science, Andong National University *The K

정규영 서정수 * 박명순 이선희 최하나 정수영 Flora of Vascular Plants on Mt. Kookmang(Chungju, Chungbuk) School of Bioresource Science, Andong National University *The K 정규영 서정수 * 박명순 이선희 최하나 정수영 Flora of Vascular Plants on Mt. Kookmang(Chungju, Chungbuk) School of Bioresource Science, Andong National University *The Korean Association for Conservation of Nature This survey

More information

A Study on the Flora of 15 Islands in the Western Sea of Jeollanamdo Province, Korea

A Study on the Flora of 15 Islands in the Western Sea of Jeollanamdo Province, Korea Journal of Asia-Pacific Biodiversity Vol. 6, No. 2 281-310, 2013 http://dx.doi.org/10.7229/jkn.2013.6.2.281 A Study on the Flora of 15 Islands in the Western Sea of Jeollanamdo Province, Korea Hee-Suk

More information

<4D6963726F736F667420576F7264202D20C3D6BDC52049435420C0CCBDB4202D20BAB9BBE7BABB>

<4D6963726F736F667420576F7264202D20C3D6BDC52049435420C0CCBDB4202D20BAB9BBE7BABB> 최신 ICT 이슈 중국기업 DJI 의 초기 드론 시장 독주 배경 * 중국 심천에 본사를 두고 있는 DJI 는 2011 년을 기점으로 미국 시장에서 드론 신드롬 을 일으키며 급성장하기 시작 - DJI 의 창업자 프랭크 왕은 홍콩에서 보낸 대학시절에 이미 창업하였고, 기숙사에서 드론 컨트롤러를 개발하여 이메일로 주문을 받아 판매하기 시작 - DJI 가 큰 전환기를

More information

함동호외. 한반도난온대지역전남대학교내한약자원및상록활엽식물 최근우리나라는한약자원의해외의존도를줄이기위해대량증식을목적으로하는몇몇기초조사형태의연구가활발히진행중에있다 3). 또한전세계적으로각국가마다생물자원을환경생태보호의목적뿐만아니라산업적인목적으로적극적으로조사및관리하는추세에있다

함동호외. 한반도난온대지역전남대학교내한약자원및상록활엽식물 최근우리나라는한약자원의해외의존도를줄이기위해대량증식을목적으로하는몇몇기초조사형태의연구가활발히진행중에있다 3). 또한전세계적으로각국가마다생물자원을환경생태보호의목적뿐만아니라산업적인목적으로적극적으로조사및관리하는추세에있다 한반도난온대지역전남대학교내한약자원및상록활엽식물 함동호 1, 김원호 1, 이지윤 1, 이준성 1, 한은경 2, 조원범 2, 이정현 2* 1. 전남대학교과학영재교육원 2. 전남대학교사범대학생물교육과 The medicinal and evergreen broad leaved plants in Chonnam national university on warm-temperate

More information

[00]_목차.hwp

[00]_목차.hwp Korean J. Plant Res. 27(5):518-533(2014) http://dx.doi.org/10.7732/kjpr.2014.27.5.518 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article 장창석 1, 양선규 1, 장현도 1, 이로영 2, 박민수 3, 김기홍 1, 오병운

More information

fm

fm Korean J. Pl. Taxon. 46(2): 213 246 (2016) http://dx.doi.org/10.11110/kjpt.2016.46.2.213 pissn 1225-8318 eissn 2466-1546 Korean Journal of Plant Taxonomy Floristic study and conservation management strategies

More information

고성군

고성군 2 장생태계 제 2 장생태계 한반도육지부의남단, 경상남도남부연안의중앙부최남단에위치하고있으며, 행정구역 상동으로는바다를끼고있으며, 서로는사천시, 남으로는통영 거제시, 동북은창원시, 서북으로는진주시와접하고있다. 제 1 절지리적특성 지맥은동북에서서남으로, 지세는서북이높고동남이기울은편이며큰강이나높은산이없어무험순령하나사방이기복하고하천은군의중심부에서사방으로흐르고있으며,

More information

도엽별출현종 _ 통계 년전국자연환경조사 - 식물 - 박재홍 - 남원 목명과명출현종남원 (357102) 도엽특이사항영문한글영문한글학명국명 E2 SELAGINELLALES 부처손목 SELAGINELLACEAE 부처손과 Selaginella involvens 바

도엽별출현종 _ 통계 년전국자연환경조사 - 식물 - 박재홍 - 남원 목명과명출현종남원 (357102) 도엽특이사항영문한글영문한글학명국명 E2 SELAGINELLALES 부처손목 SELAGINELLACEAE 부처손과 Selaginella involvens 바 도엽별출현종 _ 통계 - 2013 년전국자연환경조사 - 식물 - 박재홍 - 남원 목명과명출현종남원 (357102) 도엽특이사항영문한글영문한글학명국명 E2 SELAGINELLALES 부처손목 SELAGINELLACEAE 부처손과 Selaginella involvens 바위손 식물구계학적등급 (Ⅲ) OPHIOGLOSSALES 고사리삼목 OPHIOGLOSSACEAE

More information

박선주.fm

박선주.fm 자연보존 173 : 22-33 ; 2016 년 5 월 운문산생태 경관보전지역의특정식물및귀화식물연구 1) 박선주 송임근 2) 영남대학교생명과학과 서론 운문산은가지산 (1,240 m), 천황산 (1,189 m), 재약산 (1,108 m) 등과더불어해발 1,000 m 이상의고봉에둘러싸여있고, 영남의 7산중의하나이며, 경상남 북도의경계를이루는성현산맥 ( 省峴山脈 )

More information

Weed Turf. Sci. 3(1):6~12 Print ISSN , Online ISSN Research Article Weed & Turfgrass Scien

Weed Turf. Sci. 3(1):6~12   Print ISSN , Online ISSN Research Article Weed & Turfgrass Scien Weed Turf. Sci. 3(1):6~12 http://dx.doi.org/10.5660/wts.2014.3.1.6 Print ISSN 22877924, Online ISSN 22883312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was renamed from formerly

More information

<3230313420C3B6BBF520BEE7C0DAC8B8C0C720B1B9B0A1BAB8B0EDBCAD2DBCF6C1A4322E687770>

<3230313420C3B6BBF520BEE7C0DAC8B8C0C720B1B9B0A1BAB8B0EDBCAD2DBCF6C1A4322E687770> 발 간 등 록 번 호 11-1480000-001341-01 2 0 1 4 철새 양자회의 국가보고서 NATIONAL REPORT 2014 Bilateral Meetings on Migratory Bird Agreements 2014. 11 대한민국 환경부 Ministry of Environment Government of Republic of Korea >>>

More information

조경식물학 - 활엽수 계열(3) -

조경식물학 - 활엽수 계열(3) - 조경식물학 - 활엽수계열 (2) - 1. 서부해당화 음양성 : 양수 서부해당화 Malus prunifolia 성상 : 낙엽활엽소교목 수형 : 구형 번식 : 실생 / 접목 적색의꽃, 적색열매가아름다움 기조, 강조식재 2. 마가목 음양성 : 음수 마가목 Sorbus commixta 수형 : 타원형 이식 : 어려움 전정 : 보통 번식 : 실생 / 접목 / 취목 흰색꽃과적색열매가아름다움

More information

Microsoft Word - 08-안태영

Microsoft Word - 08-안태영 Journal of Bacteriology and Virology 2015. Vol. 45, No. 1 p.54 61 http://dx.doi.org/10.4167/jbv.2015.45.1.54 Communication Development and Verification of Nested PCR Assay for Detection of Tobacco rattle

More information

358051_마상_식물상_종목록.xlsx

358051_마상_식물상_종목록.xlsx 2014년전국자연환경조사-식물-고성철과명출현종영문한글학명국명 특이사항 도엽명 SOLANACEAE 가지과 Solanum nigrum var. nigrum L. 까마중 마상 (358051) RHAMNACEAE 갈매나무과 Rhamnus yoshinoi Makino 짝자래나무 마상 (358051) EBENACEAE 감나무과 Diospyros lotus L. 고욤나무

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012 년전국자연환경조사 - 식물 - 이두범 - 경주 목명과명출현종경주 (359014) 도엽특이사항영문한글영문한글학명국명 E7 Selaginellales 부처손목 Selaginellaceae 부처손과 Selaginella tamariscina 부처손 Equisetales 속새목 Equisetaceae 속새과 Equisetum arvense

More information

유기억.fm

유기억.fm 54 Jong-Soo Kang, Jun-Soo Han, Kyeong-Sik Cheon, Kyung-Ah Kim,Yong-Ho ark and Ki-ug Yoo Appendix 1. List of vascular plants of t. Hanseok. Scientific name / Korean name / Voucher number Selaginellaceae

More information

김진일 Representative Insects of South Korea in the Late 20th Century Professor Emeritus, Sungshin University Total insects listed in 166 survey reports

김진일 Representative Insects of South Korea in the Late 20th Century Professor Emeritus, Sungshin University Total insects listed in 166 survey reports 김진일 Representative Insects of South Korea in the Late 20th Century Professor Emeritus, Sungshin University Total insects listed in 166 survey reports of Korean insect fauna for 30 years, from 1971 to 2000,

More information