MBL fm

Microbiol. Biotechnol. Lett. (2017), 45(3), 250 256 pissn 1598-642X eissn 2234-7305 Microbiology and Biotechnology Letters 해양유래미생물을이용한어류질병세균에대한항균활성탐색 김동휘, 박소현, 김지현, 이해리, 허문수 * 제주대학교해양과학대학수산생명의학과 Received: August 24, 2017 / Revised: September 7, 2017 / Accepted: September 8, 2017 Screening of Antimicrobial Activity of Marine-Derived Biomaterials against Fish Pathogens Dong-Hwi Kim, So-Hyun Park, Ji-Hyun Kim, Hae-Ri Lee, and Moon-Soo Heo* Marine Applied Microbes and Aquatic Organism Disease Control Lab, Department of Aquatic Biomedical Sciences, School of Marine Biomedical Sciences & Marine and Environmental Research Institute, Jeju National University, Jeju 63243, Republic of Korea The prevalence of infections due to pathogenic bacteria such as Edwardsiella tarda, Streptococcus parauberis, and Photobacterium phosphoreum in fish farms in Jeju Island and their management by marinederived biomaterials was studied. In this study, we isolated eight spices type of marine-derived biomaterials from four sea areas of Jeju Island. An antibiotic disc susceptibility test confirmed that the isolated marine-derived biomaterials showed weak resistance only to oxytetracycline and penicillin and sensitivity to the other antibiotics tested, and antimicrobial activity against fish pathogens with the inhibitory zone of 22 mm, 18 mm, and 19 mm for MD-02, MD-04, and MD-06 against E. tarda strains, respectively, and 19 mm, 22 mm, 30 mm, and 29 mm for MD-01, MD-02, MD-04, and MD-06 against S. parauberis strains, respectively, while all the marine-derived biomaterials showed antibacterial activity against P. phosphoreum. Among the eight biomaterials selected, Bacillus subtilis MD-02 displayed the greatest antibacterial activity against the three tested fish pathogens and also displayed susceptibility to antibiotics. The growth of Bacillus subtilis MD-02 was greatest with the carbon source, dextrine; nitrogen source, peptone; and mineral source, MgSO 4 7H 2 O. Hence, the present study confirmed that the isolate B. subtilis MD-02 from Jeju Island could be a potential antimicrobial agent against fish pathogens and a potential pharmacotherapeutic agent. Keywords: Antibiotic substance, antimicrobial activity, fish pathogen, marine derived biomaterials, olive flounder 서 론 국내의육상양식산업은현재많은발전을하여새로운먹거리의한축으로자리잡았다. 하지만양식도중발생하는어류질병이경제적손실에심각한악영향을미치는것으로보고되었다. 육상양식은한정된면적에서생산량을극대화하기위해무분별하게고밀도사육을하여, 어체의증체율저하및각종질병발생의직접적인원인을제공하여폐사에따른경제적손실을일으킨다 [1]. 제주양식넙치의경우폐사현황을보면 2010 년 4,519 톤 ( 생산량 21,370 톤 ), 2011 년 4,427 톤 ( 생산량 22,823 톤 ), 2012 년 *Corresponding author Tel: +82-64-754-3473, Fax: +82-64-756-3493 E-mail: msheo@jejunu.ac.kr 2017, The Korean Society for Microbiology and Biotechnology 5,601톤 ( 생산량 24,575톤 ), 2013년 5,760( 생산량 23,002톤 ), 2014년 6,710톤 ( 생산량 26,283톤 ), 2015년 6,928톤 ( 생산량 27,142톤 ) 으로해마다증가하고있다. 또한폐사로인한피해액은 2010년 294억원, 2011년 376억원, 2012년 513억원, 2013년 403억원, 2014년 485억원, 2015년 529억원으로조사되었다 [2, 3]. 넙치의양식과정에서발생하는주요세균성질병의원인균으로에드워드증 (Edwardsiella sp.), 연쇄구균증 (Streptococcus sp.), 비브리오증 (Vibrio sp.), 활주세균증 (Flexibacter maritimus) 등이보고되고있다 [4, 5]. 이런세균성질병에대한근본적인치료대책이미비하여대부분의양식장에서는화학항생제및극약으로지정된포르말린을사용하고있는실정이다. 이에많은연구진들은천연항생제에대한연구를진행중에있으며, 최근 probiotics, 천연식물에서분리한항생물질등을이용하여사료첨가제

Marine Derived Biomaterials Against Fish Pathogen 251 개발을하고있다 [6]. 그중에서도본연구진은해양유래미생물을이용하여어류질병세균을제어하고자한다. 해양미생물은해수와퇴적층에서의물질순환에중요한역할을수행하고있으며, 근래에는해양오염이나어류질병문제에서도많은관심을받고있다. 해양미생물의응용사례로는호염성해양미생물로부터항생제 istamycin, biopolymer, glycine betaine 생산, 내한성미생물의경우세제용효소의개발, 빙핵활성단백질생산등다양한방면에서이용되고있으며앞으로새로운기능이밝혀짐에따라산업적이용은더욱확대될것이다 [7, 8]. 따라서본연구에서는제주도해양에서분리한해양유래미생물중육상양식장에피해를주는어류질병세균에대한항균활성을가지는미생물을탐색하고자한다. 재료및방법 해양유래미생물후보균주확보해양유래미생물후보균주를분리하기위해제주도내 4개해역 ( 성산, 표선, 대정, 한림 ) 에서각각해수를채취하였다 (Fig. 1). 채취한해수는무균채수병에담아 4 에보관하여실험실로운반하여실험을진행하였다. 채취한해수는 0.85% 생리식염수에희석하여 Marine Agar (MA, Difco, USA), ISP Medium 2 (ISP2, Difco, USA), Reasoner s 2A Agar (R2A, Difco, USA) 에각각접종하였다. 접종한배지는 25 에서 48시간배양하였다 [9]. 배양된균주를이용하여어류질병세균에대하여항균활성을가진해양유래미생물후보균주만선별하였다. 선별된균주는 Marine Broth (MB, Difco, USA), ISP medium 2 Broth (ISP2, Difco, USA), Reasoner s 2A Broth (R2B, Difco, USA) 에접종하여 25 에서 48시간배양시킨후, 80 에 20% (v/v) glycerol에보관하였다 [10, 11]. 어류질병세균확보제주도내넙치양식장에서주로발생하는 Streptococcus parauberis KCTC 3651 (Sp), Edwardsiella tarda KCTC 12267 (Et), Photobacterium phosphoreum KCTC 12377 (Pp) 를생물자원센터 (Korea Collection for Type Culture, KCTC) 에서분양받았다. 분양받은균주를 Brain Heart Infusion Agar (BHIA, Difco, USA) 에접종하여 25 에서 48시간배양하였다 [12, 13]. 배양된균주를 NaCl이 1.5% 첨가된 Brain Herat Infusion Broth (BHIB, Difco, USA) 에접종하여 25 에서 48시간배양시킨후, 80 에 20% (v/v) glycerol에보관하였다 [10, 11]. 항생제감수성테스트항생제종류는 Florfenicol 외 11 종 (Table 1) 을사용하였고, 세균의내성유무를확인하기위해일반적으로사용되는항생제에 Bauer-kirby test 를통해항생제내성균주와감수성균주로분류하였다 [14]. 세균배양액을 Muller Hinton Agar (MHA, Difco, USA) 배지위에접종하고이위에항생제디스크를올려놓으면배지에항생제농도구배가생기며, 디스크주위로생기는억제환이항균력을나타낸다 [15]. 억제환은항생제의용해도와세균의감수성정도에따라크기가다르게나타난다. 유용미생물후보균주를각각의배지에전배양시킨후, MHA 배지에도말하여각각의항생제디스크를올려놓은다음 25 에서 48 시간배양시킨다. 항생제디스크에대한억제환의크기를측정하여항생제내성에대한유무를판단한다 [16]. 해양유래미생물에대한어류질병세균의항균활성제주해역에서분리한해양유래미생물후보균주에대한어류질병세균의항균활성능을 paper disc 법을이용하여측정하였다 [15]. 8 mm paper disc 에전배양한해양유래미생 Fig. 1. Collection place from the coast of Jeju Island for isolated candidate strains of marine derived biomaterials. (A) Seongsan, (B) Pyoseon, (C) Daejeong, (D) Hanlim. September 2017 Vol. 45 No. 3

252 Kim et al. Table 1. Antibiotics list for selection of antibiotic resistant strains. Antibiotics Concentrations (µg) Diameter of inhibition zone (mm) Weakly Resistant sensitive Sensitive Florfenicol (FFL) 30 12 13 17 18 Amoxycillin (AML) 10 13 14 17 18 Oxolinic acid (OA) 20 9 10 12 13 Flumequine (UB) 10 15 16 20 21 Nalidixic acid (NA) 30 13 14 18 19 Ciprofloxacin (CIP) 5 15 16 20 21 Doxycycline (DO) 30 12 13 15 16 Oxytetracycline (OTC) 30 14 15 18 19 Neomycin (NEO) 10 12 13 16 17 Tetracycline (TC) 30 14 15 18 19 Penicillin (PE) 10 unit 19 20 27 28 Spiramycine (SP) 20 13 14 16 17 물후보균주를 100 µl 씩분주하여 25 에서 24 시간건조시켰다. 어류질병균주는전배양하여 MHA 에도말후일정간격으로건조시킨 paper disc 를올려놓은후 25 에서 48 시간동안배양하였다. 배양후 paper disc 주위에억제환의형성유무를확인하여항균활성능을확인하였다 [16]. 해양유래미생물최적배양조건최소생육배지인 GY 배지에대표적인탄소원, 질소원, 무기염을추가로첨가할때나타나는생육활성을대조구와비 교하고자한다. 해양유래미생물후보균주의배지조성에따른생육활성을알아보기위하여최소생육배지인 GY 배지 (Glucose 10 g, Yeast extract 2.5 g, Distilled water 1 L) 에대표적인탄소원 Dextrine, Saccharose, Sorbitol을각각 1% 첨가하여 30, 150 rpm으로 24시간배양한후배양액의탁도를 660 nm에서측정하였다. 대조구는 GY 배지에서 glucose가첨가되지않은배지를사용하였다 [17, 18]. 해양유래미생물후보균주의배지조성에따른생육활성을알아보기위하여최소생육배지인 GY 배지에대표적인질소원 Malt extract, Peptone, Yeast extract를각각 0.5% 첨가하여 30, 150 rpm으로 24시간배양한후배양액의탁도를 660 nm에서측정하였다. 대조구는 GY 배지에서 yeast extract가첨가되지않은배지를사용하였다 [18, 19]. 해양유래미생물후보균주의배지조성에따른생육활성을알아보기위하여최소생육배지인 GY 배지에대표적인무기염 KH 2 Po 4, MgSO 4 7H 2 O, FeSO 4 7H 2 O를각각 0.1% 첨가하여 30, 150 rpm으로 24시간배양한후배양액의탁도를 660 nm에서측정하였다. 대조구는 GY 배지에서 MgSO 4 7H 2 O가첨가되지않은배지를사용하였다 [18, 20]. 결과및고찰 해양유래미생물후보균주해양유래미생물후보균주는총 8 종이분리되었으며, Bacillus safensis 2 종, Bacillus subtillis 3 종, Psychrobacter pulmonis, Pseudomonas balearica, Psychrobacter celer 이분리되었다 (Table 2). 분리된균주는 MD-01 MD-08 으로명 Table 2. Candidate strain of marine derived biomaterials isolated from coast of Jeju Island. Strain No. Species Sequence MD-01 Bacillus safensis TGATTGACGTCATCCCCACCTTCCTCCGGGTTGTCACCGGCAGTCACCTAGAGTGCCCACTGATGCTG CACTAGATCAAGGGTTGCGCTCGTGCG MD-02 Bacillus subtilis CATCCCCAACCTTTCCTCCGGTTGTCACGGCAGTCACCTAGAGTGCCCACTGAATGCTGGCACTAGA TCAAGGGTGCGCTCGTTGCGGGACTTAC MD-03 Psychrobacter pulmonis ACTTCTCGGTGTCACGCAGTCACTAGAGTGCCCACTGATGCTGCACTAGATCAGGTGCGCTCGTGCG GGACTACCCACATCTCCACGACACGAGCT MD-04 Bacillus subtilis CCCGCTCTCAGTTGTCACTGCAGTATCTAGAGTCCGCAAACGCTGTACTAGACAAGGTGCGCTCGTG CGGACTACCAACATCTCACGACACGAGCT MD-05 Bacillus safensis TCTCCGGTTGTCACCGGCAGTCACCTTAGAAGTGCCCAACTGAATGCTGGCAACTAAGATCAAGGGT GCGCTCGTTGCGGGACTAACCCACATCT MD-06 Bacillus subtilis ATCCCCACCTTCCTCCGGTTGTCACCGCAGTCACTAGAGTGCCCACTGAATGCTGCACTAGATCAGG GTGCGCTCGTGCGGGACTACCCACATCTC MD-07 Pseudomonas balearica CATCCCCCACCTTCCTCCGGTTTGTCACGGCAGTCACCTAGAGTGCCCACTGAATGCTGGCACTAGA TCAGGGTGCGCTCGTGCGGGACTAACCC MD-08 Psychrobacter celer TGACTTGACGTCATCCCCCACCTTTCTCCGGTTGTCACCGGCAGTCTCCTAGAGGTGCCACCTAACGT GCTGGTACTAGACAGGGTGCGCTCGTAC

Marine Derived Biomaterials Against Fish Pathogen 253 Fig. 2. Neighbour-joining phylogenetic tree based on 16S rrna gene sequences showing the position of strain MD-2 within the radiation of the genus Bacillus. Bootstrep percentage (from 1000 replication)>50% are shown at branch points. Bar, 0.1 substitutions per nucleotide position. Fig. 3. Antibiotics susceptibility test for candidate strains of marine derived biomaterials. 명하여본실험에사용하였다. 항생제감수성테스트확인항생제감수성결과실험에사용된모든해양유래미생물에서항생제에대하여감수성을보였다 (Fig. 3). 하지만 MD- 01, MD-03 은양식장에서주로사용하고있는 Oxytetracycline 에대해서는 8 mm의억제환을보여다른해양미생물에비해약한내성을보이는것을확인하였다. 또한 MD-07은 Penicillin에 11 mm의억제환을보여다른해양미생물에비해약한내성을보였다. Oxytetracycline과 penicillin에대하여약한내성을보이는이유로는해수를채취한연안주변에육상양식장이밀집해있는것과관련이있다고사료된다. 양식장에서사육하고배출하는배출수에기존의항생제가남아있어바다로유입되어약한내성을보이는것으로사 료된다. 또한항생제에감수성을보이는해양유래미생물을선택하는이유는항생제에내성을보이는균주를사용할경우환경중으로방출되는항생물질에의한생태계의영향및양식생물에미치는영향을고려하여항생제에감수성을보이는균주로선택하였다 [21]. 해양유래미생물에대한어류질병세균의항균활성분리한해양유래미생물을이용하여어류질병세균에대한항균활성을확인한결과 E. tarda에대해서는 MD-02, MD- 04, MD-06이각각 22 mm, 18 mm, 19 mm로억제환을보여항균활성을나타냈다 (Fig. 4A). S. parauberis에대해서는 MD-01, MD-02, MD-04, MD-06 이각각 19 mm, 22 mm, 30 mm, 29 mm로억제환을보여항균활성을나타냈다 (Fig. 4B). P. phosphoreum에대해서는모든해양유래미생물에 September 2017 Vol. 45 No. 3

254 Kim et al. Fig. 4. Antimicrobial activity of candidate strains of marine derived biomaterials for fish pathogens. (A) E. tarda, (B) S. parauberis, (C) P. phosphoreum. Fig. 5. Effect of carbon source, nitrogen source and mineral source on the cell growth of B. subtilis MD-02. (A) Carbon Source, (B) Nitrogen Source, (C) Mineral Source.

Marine Derived Biomaterials Against Fish Pathogen 255 서항균활성을보였다 (Fig. 4C). 이에어류질병세균에대한항균활성이좋으며항생제에감수성을보이는 Bacillus subtilis MD-02로최종선정하였다 (Fig. 2). 해양유래미생물최적배양조건각종배지성분은항균물질생산에중요한것으로알려져있기때문에 [22], 해양유래미생물인 B. subtilis MD-02 의배지조성에탄소원인 Dextrine, Saccharose, Sorbitol 을첨가하여생육활성을측정하였다. 측정결과배지에아무것도첨가하지않은 control 에비해 Dextrine 만생육활성이증가한것을확인할수있었다. Saccharose 와 Sorbitol 의경우 control 에비해생육활성이변화가없거나감소하는것을확인하였다 (Fig. 5A). 해양유래미생물인 B. subtilis MD-02 의배지조성에질소원인 Malt extract, Peptone, Yeast extract 를첨가하여생육활성을측정하였다. 측정결과 control 과비교시 Peptone, Yeast extract 가생육활성이증가하는것을확인할수있었다. Malt extract 의경우 control 에비해생육활성이감소하는것을확인하였다 (Fig. 5B). 이전연구결과에따르면항진균성항생물질을생산할때 yeast extract 가가장효과적이라고보고하였다 [23]. 해양유래미생물인 B. subtilis MD-02 의배지조성에무기염인 KH 2 Po 4, MgSO 4 7H 2 O, FeSO 4 7H 2 O 를첨가하여생육활성을측정하였다. 측정결과 control 과비교시 KH 2 Po 4, MgSO 4 7H 2 O 가생육활성이증가하는것을확인할수있었다. FeSO 4 7H 2 O 의경우 control 과비교시생육활성의차이가없었다 (Fig. 5C). 이전연구결과에따르면항균물질을생산할때 KH 2 Po 4 가효과적이라고보고하였다 [24]. 이에따라해양유래미생물인 B. subtilis MD-02 의가장좋은생육활성환경은배지에 Dextrine, Peptone, MgSO 4 7H 2 O 를첨가하여배양시높은생육활성을기대할수있다고사료된다. 요 약 제주도육상양식장에서주로발생하는어류질병세균인 Edward tarda, Streptococcus parauberis, Photobacterium phosphoreum에대한피해를줄이고치료하고자해양유래미생물을이용하고자한다. 본연구진은제주지역 4개해역에서해양유래미생물을 8종분리하였다. 분리된해양유래미생물을이용하여항생제디스크에대한감수성확인을한결과, Oxytetracycline과 penicillin에서만약한내성을보일뿐나머지항생제디스크에대해선감수성을보였다. 해양유래미생물을이용하여어류질병에대한항균활성을확인한결과 E. tarda에대해선 MD-02, MD-04, MD-06이각각 22 mm, 18 mm, 19 mm의억제환이나타났다. S. parauberis 에대해선 MD-01, MD-02, MD-04, MD-06이각각 19 mm, 22 mm, 30 mm, 29 mm의억제환이나타났으며, P. Phosphoreum에대해선모든해양유래미생물에서항균활성을보였다. 이중어류질병세균에대하여항균활성이가장좋으며항생제에감수성을보이는 B. subtilis MD-02를최종선정하였다. B. subtilis MD-02의배지조성은탄소원에서는 Dextrine, 질소원에서는 Peptone, 무기염에서는 MgSO 4 7H 2 O에서생육이가장활발한것을확인하였다. 이에따라해양에서분리된 B. subtilis MD-02는어류질병균주에대한항균활성을가지는동시에향후치료제로써의가치가있다고사료된다. Acknowledgments This research was supported by The Leading Human Resource Training Program of Regional Neo industry through the National Research Foundation of Korea (NRF) funded by the Ministry of Science, ICT and future Planning (2016H1D5A1911152 & 2017R1A2B4005688). References 1. Ministry for Food Agriculture Forestry and Fisheries. 2015. Statistical year book of maritime affairs and fisheries. 2. Kim DH, Subramanian D, Jang YH, Heo MS. 2016. Inhibitory effect of transition metal gallium (Ga(NO 3 ) 3 ) on biofilm by fish pathogens. Microbiol. Biotechnol. Lett. 44: 535-539. 3. Statistics Korea. 2016. Aquaculture Status Survey. 4. Lee CH, Kim PY, Ko CS, Oh DC, Kang BJ. 2007. Biological characteristics of Streptococcus iniae and Streptococcus parauberis isolated from cultured flounder, Paralichthys olivaceus, in Jeju. J. Fish Pathol. 20: 33-40. 5. Nguyen HT, Kanai K. 1999. Selective agars for the isolation of Streptococcus iniae from Japanese flounder, Paralichthys olivaceus, and its cultural environment. J. Appl. Microbiol. 86: 769-776. 6. Kim DH, Subramanian D, Park SH, Jang YH, Heo MS. 2017. Assessment and potential application of the probiotic strain, Bacillus amyloliquefaciens JFP2, Isolated from fermented seafood-jeotgal in flounder Paralichthys olivaceus juveniles. Isr. J. Aquac. 69: 1352-1364. 7. Cottrell MT, Moore JA, Kirchman DL. 1999. Chitinases from uncultured marine microorganisms. J. Appl. Environ. Microbiol. 65: 2553-2557. 8. Friedrich AB, Merkert H, Fendert T, Hacker J, Proksch P, Hentschel U. 1999. Microbial diversity in the marine sponge Aplysina cavernicola (formerly Verongia cavernicola) analyzed by fluorescence in situ hybridization (FISH). J. Mar. Biol. 134: 461-470. 9. Bergman O, Haber M, Mayzel B, Anderson MA, Shpigel M, Hill RT, et al. 2011. Marine-based cultivation of Diacarnus sponges and the bacterial community composition of wild and maricultured September 2017 Vol. 45 No. 3

256 Kim et al. sponges and their larvae. Mar. Biotechnol. 13: 1169-1182. 10. Jung SH, Choi DL, Kim JW, Jo MR, Jee BY, Seo JS. 2009. Pharmacokinetics of oxolinic acid in cultured olive flounder Paralichthys olivaceus by oral administration, injection and dipping. J. Fish Pathol. 22: 125-135. 11. Woo SH, Lee JH, Kim YK, Cho MY, Jung SH, Kim JW, et al. 2010. Effects of garlic Allium sativum extract immersion on the immune responses of olive flounder Paralichthys olivaceus prechallenged with pathogenic bacteria. J. Fish Pathol. 23: 199-209. 12. Chiang WC, Martin M, Jensen PØ, Høiby N, Nielsen TE, Givskov M, et al. 2013. Extracellular DNA shields against aminoglycosides in Pseudomonas aeruginosa biofilms. Antimicrob. Agents Chemother. 57: 2352-2361. 13. Kim JH, Kim CH, Hacker J, Ziebuhr W, Lee BK, Cho SH. 2008. Molecular characterization of regulatory genes associated with biofilm variation in a Staphylococcus aureus strain. J. Microbiol. Biotechnol. 18: 28-34. 14. Oh EG, Yu HS, Shin SB, Son KT, Park KB, Kwon JY, Lee HJ. 2008. Trimethoprim resistance of Vibrio parahaemolyticus isolated from the fish farm. J. Korean Fish. Soc. 41: 324-329. 15. Lee KW, Park KS. 2010. Antibiotic-resistance profiles and the identification of the ampicillin-resistance gene of Vibrio parahaemolyticus isolated from seawater. Korean J. Fish Aquat. Sci. 43: 637-641. 16. Park EH, Kim JA, Choi SH, Bin JH, Cheigh HS, Suk DH, et al. 2007. Isolation and antimicrobial susceptibility of Campylobacter jejuni from diarrhea patients. J. Life Sci. 17: 811-815. 17. Park WM, Kim GH, Hyeon JW. 1995. New synthetic medium for growth of mycelium of Pleurotus species. Korean J. Mycol. 23: 275-283. 18. Sung JM, Choi YS, Shrestha B, Park YJ. 2002. Cultural characteristics of mycelial growth by Cordyceps militaris. Korean J. Mycol. 30: 1-5. 19. Ok M, Choi YS. 2005. Screening of fibrinolytic enzyme producing from microorganisms in korean fermented soybean paste and optimum conditions of enzyme production. Korean J. Food Preserv. 12: 643-649. 20. Kang AS, Cha DY, Hong IP, Chang HY, Yu SH. 1994. Studies of cultural condition on the mycelial vegetative growth in Naematoloma sublateritium (Fr.) Karst. Korean J. Mycol. 22: 153-159. 21. Oh EG, Son KT, Ha KS, Yoo HD, Yu HS, Shin SB, et al. 2009. Antimicrobial resistance of Vibrio strains from brackish water on the coast of Gyeongsangnamdo. Korean J. Fish Aqua Sci. 42: 335-343. 22. Ryu HS, Shon MY, Cho SJ, Park SK, Lee SW. 2007. Characterization of antibacterial substance-producing Bacillus subtilis isolated from traditional Doenjang. J. Korean Soc. Appl. Biol. Chem. 50: 87-94. 23. Kang B, Zhang X, Wu Z, Wang Z, Park S. 2014. Production of citrinin-free Monascus pigments by submerged culture at low ph. Enzyme Microb. Tec. 55: 50-57. 24. Chen W, He Y, Zhou Y, Shao Y, Feng Y, Li M, et al. 2015. Edible filamentous fungi from the species Monascus: early traditional fermentations, modern molecular biology, and future genomics. Compr. Rev. Food Sci. Food Saf. 14: 555-567.