( ) : : :,,,,,,,, 1 : : ( ) 2 : : ( ) 3 :, : - 2 -

Transcription

1 BSAG890M ( ) Research on lactoferrin from Korean native livestock and development of its utilization technique

2 ( ) : : :,,,,,,,, 1 : : ( ) 2 : : ( ) 3 :, : - 2 -

3 . ( )..,,,,., ( ) -. - (, lactoferricin)

4 cdna. 3. transformation transformants (, ). 1. ( ) - ( ) CM-Toyopearl 650 ion exchange AF-Heparin Toyopearl 650 ion enchange SDS-page, 80kD. - Circular dichroism(cd) spectra lactoferrin 2. - helix 24.5%, -structure 36%, - turn 13.5%, Unordered 26%. Fe 30.6% - E. coli0111, Minimal Inhibitory Concentration(MIC) 5mg/, MIC 0.1mg/, HPLC MIC 30 /. - (lactoferricin-kng) - 4 -

5 (YQWQRRMRKLGAPSIT). - - ( ) CM-Sephadex C-50 ion exchange Heparin-agarose. - 81,000Da 0.56mg/g 40.6%. pi 9 (K-Lf) (B-Lf) H-Lf. - E. coli O111 (B-Lf) (K-Lf), B-Lf-h( ) K-Lf-h( ). MIC E. coli O111 B-Lf 1.5mg/ml, K-Lf 2.75mg/ml B-Lf-h 0.125mg/ml, K-Lf-h 0.25mg/ml B-Lf-h. Lf lysozyme. - K-Lf K-Lf RAW264.7 cell TNF-, LPS TNF-. - K-Lf TNF- NO. - K-Lf-h Lf TNF- NO

6 Total RNA Le Provost primer RT-PCR cdna 2.4kb. Genbank Data Library accession number U Total RNA BM TitanTM one tube RT-PCR kit cdna template cdna Aspergillus niger cloning, 3 (psgt, psnt, psct) - A. niger (150 colonies) - Southern blot (9/150) - Northern blot (1/9) - A. oryzae cloning pblf - A. oryzae (30 colonies) - PCR, ( 130/150, 10/30) % - 6 -

7 . -. (, ) - KLFC Salmonella typhimurium KLFC. -.,.,,

8 SUMMARY The present study aims at identifying lactoferrin from milk of Korean native livestock, cow and black goat, in the level of molecule, and developing mass production system by genetic engineering. Application techniques have been studied to extend its usage. The results are as follows. 1. Purification of lactoferrin proteins from milk of Korean native cow and its characterization. The molecular weight of the purified Korean native cow lactoferrin(k-lf) was 81kDa, and the content of iron was 0.56mg/g indicating 40.6% of iron saturation. The isoelectric point was 9. Bovine lactoferrin(b-lf) showed a higher antibacterial activity level than that of K-Lf. The Minimal Inhibitory concentration(mic) of B-Lf was 1.5mg/ml and the MIC of B-Lf was 1.6mg/ml in E. coli The same result was also observed between B-Lf-h(hydrolysate)(0.125mg/ml) and K-Lf-h(0.25mg/ml) Even though K-Lf increased the production of TNF- in RAW264.7 cells with dose-dependency, it didn't affect on the production of TNF- in LPS-stimulated RAW264.7 cells. K-Lf induced the production of NO similar to its role on the TNF- production. Despite K-Lf-h has higher level of antibacterial activity comparing to Lf, it seems that Lf-h didn't significantly affect the production of TNF- and NO in RAW264.7 cells. 2. Purification of lactoferrin proteins from milk of Korean native goat and its characterization. Lactoferrin, 80kD, was purified from colostrum of Korean native goat by CM-Toyopearl 650 ion exchange and AF-Heparin Toyopearl 650 ion exchange. -helix was 24.5%, -structure was 36%, -turn was 13.5% and unordered - 8 -

9 form was 26% in KN goat lactoferrin. MIC against E.Coli was 5 / in KN goat lactoferrin, 0.1 / in pepsin hydrolysate of KN goat lactoferrin and 30 / in KN goat lactoferrin peptide derived by HPLC from pepsin hydrolysate. Lactoferricin amino acid sequence was identified as YQWQRRMRKLGAPSIT. 3. Clonning of KN cow lactoferrin gene and development of mass production system in yeast. Lactoferrin gene was clonned by RT PCR using KN cow testis RNA and primer set derived from already reported bovine lacroferrin cdna as a template. Its sequence was very similar to bovine lactoferrin sequence reported already by showing 97% homology. Its pepide sequence corresponding to lactoferricin region was ligated into pichia pastori expression vector ppic9 and recombinant peptide was produced in yeast transformants by inducing with alcohol. Transformant SLK-6 was verified to show strong anti-microbial activity against various pathogenic microorganism. 4. Clonning of KN goat lactoferrin gene and development of mass production system in fungus. Lactoferrin was clonned by RT-PCR using KN goat mammary gland RNA and primer set derived from the reported goat lactoferrin cdna sequence as a template. The nucleotide sequence of the lactoferrin gene of KN goat was found to differ in 15 sites from that of the goat lactoferrin reported earlier. The antibacterial activity of KN goat lactoferrin was found to be greater than that of Sannen goat. Lactoferrin cdna was ligated into Fungus expression vector containing -amylase promoter and signal peptide sequence, and KN goat lactoferrin expressing transformants were obtained. 5. Application study of lactoferrin - 9 -

10 Lactoferrin has exhibited various biological function. Anticancer activity of lactoferrin was tested in transgenic mice exhibiting hepatocellular carcinoma by feeding waters containing lactoferrin for 8 months. However, any significant results were not obtained in the experiment. Rat liver treated with lactoferrin for 2 weeks exhibited significant anti-inflammation effect when injected by CCL4 compared to control rat liver. KN cow recombinant lactoferrin peptide addition was also significant in growth inhibit of Salmonella typhimurium

11 CONTENTS Abstract Summary Contents(English) Introduction Purification of lactoferrin from Korean native livestock milk and study of its biological function Lactoferrin gene clonning of Korean native livestock and determination of its primary sequence Studies on production of recombinant lactoferrin Studies on application of lactoferrin Reference

12 ( )

13 Carlsberg Brewery Soren Peter Lauritz Sorensen Margarethe Sorensen (Sorensen 1939).,,,, secondary granules.,,,,....,..,

14 (Lf) Lf, Lf,, macrophage TNF- NO, Lf cytokine. 2. Lf,,, Chromatography Lf ( ) 2. HPLC lactoferin ( ) 3 1. Lf ( ) 4 1. ( )

15 1. RAW264.7 cell macrophage ( ) 2. ( ) 3. Lf Cytokine ( ) 4. Lf ( ) 6 * (Nam MS,1998) 1. 5kg. ( / ). 2.. whey protein 3 (3,000 rpm, 20 ) ph 4.6 casein Whey( ). whey protein 50g.. CM-Toyopearl 650 ion exchange CM-Toyopearl 650 ion exchange resin column starting buffer 0.005M sodium phosphate buffer(ph 6.0) whey protein starting buffer column. Starting buffer column 0.1M NaCl 0.005M sodium phosphate buffer elution 0.3M NaCl 0.005M sodium phosphate buffer elution 0.5M NaCl 0.005M sodium phosphate elution peak band 0.5M NaCl elution crude Lf.. AF-Heparin Toyopearl 650 ion enchange

16 Lf AF-Heparin Toyopearl column 0.1M Nacl, 0.3M Nacl, 0.5 M Nacl step elution Goat Lf SDS-PAGE Lf SDS-PAGE. Fig. 1 CM-Toyopearl 650 Chromatography profile 3 peak. 0.5M Nacl peak Lf peak Fig. 2. Fig. 3 Fig M Nacl fraction(82 94 ) AF-Heparin Toyopearl 650 Chromatography profile, Fig. 4 AF-Heparin Toyopearl 650 Chromatography 0.5M Nacl peak, band Lf. Fig. 5 bovine lactoferrin Western blotting sannen goat bovine lactoferrin

17 Fig. 1. Fractionation of Korean Native goat whey protein on CM-Toyopearl 650M chromatography. Whey protein dissolved in 0.005M sodium phosphate buffer(ph 6.0) was applied to the column. The column was washed with the same buffer and then eluted with a step gradient of NaCl as indicated. The flow rate was 20ml/hr and detection was performed by UV absorbance measurement at 280mm

18 Fig. 2. Profiles of SDS-PAGE of fractions from CM-Toyopearl 650M chromatography. 1. MW Standard marker proteins ; 2. KN goat whey protein ; 3. Unbounded whey protein ; 4. Fraction No. 20 ; 5. Fraction No. 62 ; 6. Fraction No. 68 ; 7. Fraction No. 86 ; 8. Fraction No. 88 ; 9. Fraction No

19 Fig. 3. Profile on AF-Heparin Toyopearl 650M chromatography of peak 3 fraction from CM-Toyopearl chromatography. Lactoferrin-enriched fractions dissolved against 0.005M sodium phosphate buffer(ph 6.0) was applied to the column. The column was washed with the same buffer and then eluted with a step gradient of NaCl as indicated. The flow rate was 20ml/hr and detection was performed by UV absorbance measurement at 280nm. Fig. 4. Profiles of SDS-PAGE after AF-Heparin 650M chromatography. 1. MW Standard marker protein ; 2. Fraction No. 35 ; 3. Fraction No. 36 ; 4. Fraction No. 37 ; KNG LF ; Korean Native goat lactoferrin

20 Fig. 5. Western blotting comparison of the KN goat lactoferrin, goat(saanen) lactoferrin and bovine lactoferrin. KNG ; Korean Native goat. 1. MW Standard marker protein(pre-stained marker, Bio-Rad) ; 2. KN goat lactoferrin ; 3. Goat(Saanen) lactoferrin ; 4. Bovine lactoferrin

21 7 Circular dichroism(cd) spectra lactoferrin 2. Fig. 6 CD Spectra nm, -helix 24.5%, Saanen 15% -structure 36%, Saanen 40% Saanen. -turn 13.5%, Saanen 12%. Unordered 26%, Saanen 33% Saanen. Fig nm Saanen, Tyrosine, Phenylalanine. Fig Fe 30.6% Saanen 36%. Fig.6. CD Spectra nm

22 Fig.7. CD Spectra nm Fig.8. CD Spectra nm

23 1. E. coli Tomita (1991), 1% bactopeptone / E. coli incubator E. coli., 1 (Saanen) 7.5 /, 5 /. 1. E. coli (mg/ml ) (Saanen) : positive - : negative N HCl PH / pig pepsin 37 4, N NaOH PH. Reverse-phase HPLC fraction, fraction E coli 0111,

24 9. HPLC E. coli 0111, 280 / MIC. 2. peptide E.coli O111 peptide N,, 23mer Fmoc TSK gel ODS-prep HPLC E.coli O111. peptide Sequence : CYQWQRRMRKLGAPSITCIRRTS

25 : / 30 / 35 / 40 / 45 / 50 / KNgLf peptide : positive antibacterial activity - : negative antibacterial activity

26 Sequencing( ) 3 1. cdna (Schanbacher, F.L. et al., J Dairy Sci 76, , 1993). cdna, (involution), (Chirgwin et al., Biochem., 18, 5294, 1979) RNA. 1 RNA 75mM KCl, 1mM dithiothreitol, 3mM MgCl2, 0.5mM each of dntp, 100pM hexanucleotide primer (Promega), 10 U AMV reverse transcriptase (Promega) 50mM Tris, ph ul 42'C, 2 cdna. cdna 3ul 1mM MgCl2, 100pM , 200 M each of dntp, 2 U vent DNA polymerase (New England Biolabs)

27 10mM Tris, ph 8.4, 94 5, 94 1, 56 1, , PCR 10 1% (Fig.10). Fig 10. Amplification of lactoferrin gene fragments in mammary gland tissues. lanes : 1, pbr322/bstni digest ; 2, negative control ; 3, 5` region of goat lactoferrin ; 4, 3` region of goat lactoferrin ; 5, pbr322/bstni digest primer ( le Provost et al. ),. primer 1; 5'-GACCC CAGAC ATGAA GCTC-3' (64-83 ) primer 2; 5'-CCTCC GCGGT TTCCC TGAGG TT-3' ( ) primer 3; 5'-AAACC GCGGA GGAGT TGAAG-3' ( ) primer 4; 5'-AGGGA ATGAA AATCA ACAGC A-3' ( ) PCR DNA dideoxy nucleotide chain termination procedure (Sanger et al., Proc. Natl. Acad. Sci. USA, 74, 5463, 1977)

28 Sequencing Version 2.0 DNA sequencing Kit (US Biochemical) DNA ( 11). 11 cdna, cdna,. ( Saanen ) (Le Provost, 1994) 99%, 98%. 6, 15 ( 3). Genbank Data Library accession number U CCCCAGAC 9 ATG AAG CTC TTC GTC CCC GCC CTG CTG TCC CTT GGA GCC CTT GGA CTG TGT CTG Met Lys Leu Phe Val Pro Ala Leu Leu Ser Leu Gly Ala Leu Gly Leu Cys Leu 63 GCT GCC CCG AGG AAA AAC GTT CGA TCG GTG TGC ATC TCA CTG CCG GAG TGG TCC Ala Ala Pro Arg Lys Asn Val Arg Ser Val Cys Ile Ser Leu Pro Glu Trp Ser 117 AAA TGC TAC CAA TGG CAG AGG AGG ATG AGG AAG CTG GGT GCT CCC TCT ATC ACC Lys Cys Tyr Gln Trp Gln Arg Arg Met Arg Lys Leu Gly Ala Pro Ser Ile Thr G G 171 TGT ATA AGG AGG ACC TCT GCC TTG GAA TGT ATC CGG GCC ATC GCG GGA AAA AAT Cys Ile Arg Arg Thr Ser Ala Leu Glu Cys Ile Arg Ala Ile Ala Gly Lys Asn Val G 225 GCG GAT GCT GTG ACC CTG GAT AGT GGC ATG GTG TTT GAG GCG GGC CTG GAC CCC Ala Asp Ala Val Thr Leu Asp Ser Gly Met Val Phe Glu Ala Gly Leu Asp Pro Arg 279 TAC AAA CTG CGG CCA GTA GCG GCA GAG ATC TAT GGG ACA GAA AAA TCT CCC CAA Tyr Lys Leu Arg Pro Val Ala Ala Glu Ile Tyr Gly Thr Glu Lys Ser Pro Gln A 333 ACC CAC TAT TAT GCT GTG GCC GTC GTG AAG AAG GGC AGC AAC TTT CAG CTG GAC Thr His Tyr Tyr Ala Val Ala Val Val Lys Lys Gly Ser Asn Phe Gln Leu Asp Lys T 387 CAG CTG CAA GGC CAG AAG TCC TGC CAC ATG GGC CTT GGC AGG TCC GCT GGG TGG Gln Leu Gln Gly Gln Lys Ser Cys His Met Gly Leu Gly Arg Ser Ala Gly Trp CC 441 AAC ATC CCT GTG GGA ATC CTT CGC CCG TTC TTG AGC TGG ACA GAG TCG GCC GAG Asn Ile Pro Val Gly Ile Leu Arg Pro Phe Leu Ser Trp Thr Glu Ser Ala Glu Pro 495 CCC CTC CAG GGA GCT GTG GCT AGA TTC TTC TCT GCC AGC TGT GTT CCC TGC GTT Pro Leu Gln Gly Ala Val Ala Arg Phe Phe Ser Ala Ser Cys Val Pro Cys Val 549 GAT GGA AAA GCG TAC CCC AAC CTG TGT CAA CTG TGC AAG GGG GTG GGA GAG AAC Asp Gly Lys Ala Tyr Pro Asn Leu Cys Gln Leu Cys Lys Gly Val Gly Glu Asn 603 AAG TGT GCC TGC TCC TCC CAG GAA CCA TAC TTT GGT TAT TCT GGT GCC TTC AAG Lys Cys Ala Cys Ser Ser Gln Glu Pro Tyr Phe Gly Tyr Ser Gly Ala Phe Lys 657 TGC CTG CAG GAC GGG GCT GGA GAC GTG GCT TTT GTC AAG GAG ACG ACA GTG TTT Cys Leu Gln Asp Gly Ala Gly Asp Val Ala Phe Val Lys Glu Thr Thr Val Phe 711 GAG AAC TTG CCA GAG AAG GCT GAC AGG GAC CAG TAT GAG CTT CTC TGC CTA AAC Glu Asn Leu Pro Glu Lys Ala Asp Arg Asp Gln Tyr Glu Leu Leu Cys Leu Asn

29 765 AAC ACT CGG GCG CCA GTG GAT GCA TTC AAG GAG TGC CAC CTG GCC CAG GTC CCT Asn Thr Arg Ala Pro Val Asp Ala Phe Lys Glu Cys His Leu Ala Gln Val Pro 819 TCT CAT GCT GTT GTG GCC CGC AGT GTG GAT GGC AAG GAG AAC TTG ATC TGG GAG Ser His Ala Val Val Ala Arg Ser Val Asp Gly Lys Glu Asn Leu Ile Trp Glu C 873 CTT CTC AGG AAG GCA CAG GAG AAG TTT GGA AAA AAC AAG TCT CAG AGC TTC CAG Leu Leu Arg Lys Ala Gln Glu Lys Phe Gly Lys Asn Lys Ser Gln Ser Phe Gln Arg 927 CTC TTT GGC TCT CCA GAA GGC CGG AGG GAC CTG CTA TTC AAA GAC TCT GCC CTT Leu Phe Gly Ser Pro Glu Gly Arg Arg Asp Leu Leu Phe Lys Asp Ser Ala Leu 981 GGG TTT GTG AGG ATC CCC TCA AAA GTA GAT TCG GCG CTG TAC CTG GGC TCC CGT Gly Phe Val Arg Ile Pro Ser Lys Val Asp Ser Ala Leu Tyr Leu Gly Ser Arg 1035 TAC TTG ACC GCC TTG AAG AAC CTC AGG GAA ACC GCG GAG GAG TTG AAG GCG CGG Tyr Leu Thr Ala Leu Lys Asn Leu Arg Glu Thr Ala Glu Glu Leu Lys Ala Ala 1089 TGC ACG CGG GTC GTG TGG TGC GCG GTG GGA CCC GAG GAG CAG AGT AAG TGC CAG Cys Thr Arg Val Val Trp Cys Ala Val Gly Pro Glu Glu Gln Ser Lys Cys Gln 1143 CAG TGG AGC GAG CAG AGC GGC CAG AAC GTG ACC TGT GCC ACG GCC TCC ACC ACC Gln Trp Ser Glu Gln Ser Gly Gln Asn Val Thr Cys Ala Thr Ala Ser Thr Thr G 1197 GAC GAC TGC ATC GCC CTG GTG CTG AAA GGG GAA GCG GAC GCC CTG AGC TTG GAT Asp Asp Cys Ile Ala Leu Val Leu Lys Gly Glu Ala Asp Ala Leu Ser Leu Asp Gly 1251 GGA GGA TAT ATC TAC ACT GCC GGC AAG TGC GGC CTG GTG CCT GTC ATG GCA GAG Gly Gly Tyr Ile Tyr Thr Ala Gly Lys Cys Gly Leu Val Pro Val Met Ala Glu 1305 AAC CGG AAA TCC TCC AAA TAC AGT AGC CTA GAT TGT GTG CTG AGA CCA ACG GAA Asn Arg Lys Ser Ser Lys Tyr Ser Ser Leu Asp Cys Val Leu Arg Pro Thr Glu 1359 GGG TAC CTT GCC GTG GCA GTT GTC AAG AAA GCA AAT GAG GGG CTC ACT TGG AAT Gly Tyr Leu Ala Val Ala Val Val Lys Lys Ala Asn Glu Gly Leu Thr Trp Asn 1413 TCT CTG AAA GGC AAG AAG TCG TGC CAC ACC GCC GTG GAC AGG ACT GCA GGC TGG Ser Leu Lys Gly Lys Lys Ser Cys His Thr Ala Val Asp Arg Thr Ala Gly Trp 1467 AAC ATC CCC ATG GGC CTG ATC GCC AAC CAG ACA GGC TCC TGC GCA TTT GAT GAA Asn Ile Pro Met Gly Leu Ile Ala Asn Gln Thr Gly Ser Cys Ala Phe Asp Glu 1521 TTC TTT AGT CAG AGC TGT GCC CCT GGG GCC GAC CCG AAA TCC AGC CTC TGT GCA Phe Phe Ser Gln Ser Cys Ala Pro Gly Ala Asp Pro Lys Ser Ser Leu Cys Ala 1575 TTG TGT GCC GGC GAT GAC CAG GGC CTG GAC AAG TGT GTG CCC AAC TCT AAG GAG Leu Cys Ala Gly Asp Asp Gln Gly Leu Asp Lys Cys Val Pro Asn Ser Lys Glu 1629 AAG TAC TAT GGC TAC ACC GGG GCT TTC AGG TGC CTG GCT GAG GAC GTT GGG GAC Lys Tyr Tyr Gly Tyr Thr Gly Ala Phe Arg Cys Leu Ala Glu Asp Val Gly Asp A 1683 GTT GCA TTT GTG AAA AAC GAC ACA GTC TGG GAG AAC ACG AAT GGA GAG AGC TCT Val Ala Phe Val Lys Asn Asp Thr Val Trp Glu Asn Thr Asn Gly Glu Ser Ser 1737 GCA GAC TGG GCT AAG AAC TTG AAT CGC GAG GAC TTC AGG CTG CTC TGC CTC GAT Ala Asp Trp Ala Lys Asn Leu Asn Arg Glu Asp Phe Arg Leu Leu Cys Leu Asp 1791 GGC ACC ACG AAG CCT GTG ACG GAG GCT CAG AGC TGC TAC CTG GCG GTG GCC CCG Gly Thr Thr Lys Pro Val Thr Glu Ala Gln Ser Cys Tyr Leu Ala Val Ala Pro 1845 AAT CAC GCT GTG GTG TCT CGG AGC GAT AGG GCA GCG CAC GTG GAA CAG GTG CTG Asn His Ala Val Val Ser Arg Ser Asp Arg Ala Ala His Val Glu Gln Val Leu T 1899 CTC CAC CAG CAG GCT CTG TTC GGG AAA AAT GGA AAA AAC TGC CCG GAC CAG TTT Leu His Gln Gln Ala Leu Phe Gly Lys Asn Gly Lys Asn Cys Pro Asp Gln Phe 1953 TGT TTG TTC AAA TCT GAA ACC AAA AAC CTT CTG TTC AAT GAC AAC ACT GAG TGT Cys Leu Phe Lys Ser Glu Thr Lys Asn Leu Leu Phe Asn Asp Asn Thr Glu Cys 2107 CTG GCC AAA CTT GGA GGC AGA CCA ACG TAT GAA AAA TAT TTG GGG ACA GAG TAT Leu Ala Lys Leu Gly Gly Arg Pro Thr Tyr Glu Lys Tyr Leu Gly Thr Glu Tyr 2161 GTC ACG GCC ATT GCC AAC CTG AAA AAA TGC TCA ACC TCC CCG CTT CTG GAA GCC Val Thr Ala Ile Ala Asn Leu Lys Lys Cys Ser Thr Ser Pro Leu Leu Glu Ala 2215 TGC GCC TTC CTG ACG AGG TAA AGC CTG CAA AGA AGC TAG CCT GCC TCC CCG GGC Cys Ala Phe Leu Thr Arg *** *** G GA 2269 CTC AGC TCC TCC CTG CTC TCA GCC CCA GTC TTC AGA CGC GAG GAC CCT TCC TCT CCC TTC CTG AAG TCG GAT TTT TGC CAA GCT CAT CAG TAT TCA CAA TTC CCT GCT T 2377 GTC ATC TTA GCA AGA AAT AAA ATT AGA AAT GCT GTT GAT TTT CAT TCC CT 3'

30 cdna cdna Le Provost, sequence Le Provost. 3. Nucleotice Goat KN goat (Amino acid) (le Provost et. al. 1994) (our results) 174; ; (56) (88) (124) (130) (154) (304) (414) (571) (637) GTG(Val) CGG(Arg) AAG(Lys) GGT(Gly) CCC(Pro) CGC(Arg) GGT(Gly) ACA(Thr) TTT(Phe) G G A T ATA(Ile) CTG(Leu) CAG(Gln) GGC(Gly) TTC(Phe) AGC(S er) GAT(Asp) ACG(Thr) TTC(Phe) A A C A flanking

31 5 flanking genomic DNA Seyfert et al(1994) bovine lactoferrin 5' flanking sequence template 2 primer PCR, 1kb PCR product, pgem-t vector clone sequence 13. Seyfert 91.4%. primer sequence PCR. primers forward primer ; 5' -GCTGCAATGGAAGCGCCAGG-3' Reverse primer ; 5' GGAAGCAAGGCCTCAGCG-3' PCR 94 5min 94 1min, 60 1min 30sec, 72 2min (30cycles) 72 7min -1021BOP GATCTTAGTTCCCCCAAATGGGTCTGAACCTACACATGCTGCAATGGAAGCGCCAGGGAA ::::::::::::::::: ::::: KNG GCTGCAATGGAAGCGCCCGGGAA -961 BOP GTCCT-CCCCCACCCCTTGGGGGACACTTAGTTTGCTTGCAATCAGTGAACGATAAGCAG ::::: ::::::::::::: ::::: :::::::: :::::::::::::: ::::::::: KNG GTCCTGCCCCCACCCCTTGATGGACATTTAGTTTGTTTGCAATCAGTGAATGATAAGCAG -901 BOP GGCTGCACTGGAGACCCCTGCGTGGGAGTTGTTGTGCTTCAAGGGAGTGTCTT-CAAGGA ::::::::::::::::::::::::::::: ::::::::::::::::::: :: : :::: KNG GGCTGCACTGGAGACCCCTGCGTGGGAGTCATTGTGCTTCAAGGGAGTGTATTTCGAGGA -841 BOP TGCAGAGCAGAGTTCTAGCTT-AGAACTGAAAACCAGCCTCCTGAAACAGGGTCAGCCTG ::::::::::: ::::::: :::: ::::::::::: ::::::::::::::::::::: KNG TGCAGAGCAGA---CTAGCTTTAGAATTGAAAACCAGCTTCCTGAAACAGGGTCAGCCTG -781 BOP TGTACTGAGGACAAAATAGGACATTTATCAAAATGAGGTTCCTGTCTCCCACCTCATATT ::::::::::::::::::::::::::::::::::::::::::: :::::::::::::::: KNG TGTACTGAGGACAAAATAGGACATTTATCAAAATGAGGTTCCTATCTCCCACCTCATATT -721 BOP GCCACAAAACAACACAAGGGGTAGGATATCCTTTTCATTGGCAAATGAGGGACCAGGAGA :::::::::::: ::::: :::::::::::::::::::::::::::::::::::::::: KNG GCCACAAAACAAAACAAGTGGTAGGATATCCTTTTCATTGGCAAATGAGGGACCAGGAG BOP CAGCCTTTGGGCACTTAGGCCTCTGGTTCTGTTTTCTGGGAGCTGTATTTCGGTCTCAGG :::::::::::::::::::::::::::::::::::::::::::::::: ::::::::: KNG -AGCCTTTGGGCACTTAGGCCTCTGGTTCTGTTTTCTGGGAGCTGTATTA-GGTCTCAGG -601 BOP AGGACTCCAGGGGCAGTCTGGGTCAGACTCTGGGCAGC CTCTGCCAGCTGGAC

32 ::: : :::: ::::::::::::::::::::::::::: ::::::::: ::::: KNG AGGGCCCCAGAGGCAGTCTGGGTCAGACTCTGGGCAGCATATTGCCTCTGCCAGTTGGAC -541 BOP CAGGCTGCCGTGGACCCCGGGCCAGGCAGCGGGCCCTCTTTCAAAACTCCAGGCTGGCT- :: ::::: :::::::::::::::::::::::: : ::::::::::::::::::::::: KNG CAAGCTGCTGTGGACCCCGGGCCAGGCAGCGGGTCTTCTTTCAAAACTCCAGGCTGGCTG -481 BOP CTGCGTGCAGATGCAAGGGTCTCCGTCTGTCTTAACTGGTTCCCAAGCACTTTAGATACC ::::::::::: :::::: :::::::::: :: ::::: ::::::::::::::::::::: KNG CTGCGTGCAGACGCAAGGATCTCCGTCTGCCTCAACTGTTTCCCAAGCACTTTAGATACC -421 BOP TTCTCTATAGTCAAGCTGATCCGCAAAGATTCACCCTAGGACCCCTGCTCTGGATCCCGC ::: :: ::::::::::::::::::::::::::: ::::::::::::::: : : ::: KNG ATCTGTACAGTCAAGCTGATCCGCAAAGATTCACCTTAGGACCCCTGCTCTAGGTGCCGA -361 BOP TCTCTAGGAGGCACTGAGACCGGAGCGGGGACAAAACCCAGGGACTGCCACTCCCGAAGG :::: :: ::::::::::::: ::: ::::::::::: ::::::::::::::::::: :: KNG TCTCCAGAAGGCACTGAGACCAGAGAGGGGACAAAACTCAGGGACTGCCACTCCCGA-GG -301 BOP GCTGCGGACAAGTGGGAAAGAAAGAGCACCCCCCAACTAGGCAGCGCTGGGGA-ACTTGA :::::::::::::::::: ::::::::: ::::::::::::::::::::::: :::::: KNG GCTGCGGACAAGTGGGAAGGAAAGAGCATCCCCCAACTAGGCAGCGCTGGGGGGACTTGA -241 BOP GAGGTGGGTGTGGGTTGGGTATCCTCTCCCCGAGCGCCAAGCCCCGCCCGGGCACCTTTC :::::::::::::::::::::::::::::: ::::::::: : :::::::::::::::: KNG GAGGTGGGTGTGGGTTGGGTATCCTCTCCC-GAGCGCCAA--CGCGCCCGGGCACCTTTC -181 BOP TCGCTCCCTCGGTCTCCACCCCCGCTCTTCCCCCTTCCCCCCGGTTTTCCCCCTCTAGGA ::::::::: ::::: ::::: : :: :::::::::::: : : :::::: ::::::: KNG CTGCTCCCTCGTTCTCCGCCCCCAC-CTCCCCCCTTCCCCCAGTTCTTCCCC-TCTAGGA -121 BOP ACCAGCAGACCTCGGGAGAGGGGAGGAGGGAGGC-TGGGGCGCTTATAGGACCACAGGGC :: ::::::::::::::: :::::::::::::: ::::::::::::::::::::::::: KNG ACTAGCAGACCTCGGGAGGAGGGAGGAGGGAGGCCTGGGGCGCTTATAGGACCACAGGGC -60 BOP GGGGCAAACCTCGTGAGGTCACCGAGCACTGGCTAAAGGGACGCAGAACGAGCGCAGGTG :::::::::::::::::: ::::::::::::: ::::::::::::::::::: ::::::: KNG GGGGCAAACCTCGTGAGGCCACCGAGCACTGGATAAAGGGACGCAGAACGAGGGCAGGTG +1 BOP GCAGAGCCTTCGTTCCGGAGTCGCCCCAGGACGCCAGCCATGAAGCTCTTCGTCCCCGCC ::::::::::::::::::::::: KNG -CAGAGCCTTCGTTCCGGAGTCGC BOP CTGCTGTCCCTCGGAGCCCTTGGTGAGTGCAGGTATGAGTGGGGGCGGGGCATGC KNG flanking (KNG) Seyfert (1994) 5' flanking (BOP)

33 4 Northern blot 14.,,. Fig 14. Northern blot hybridization of total RNA isolated from tissues of mammary gland. Total RNAs were transferred to a nylon membrane, and then hybridized with the 32P labeled lactoferrin probe (A) and rehybridized with -actin probe as the control for RNA loading (B). Lanes : V, virgin mammary gland; P, pregnancy mammary gland; L, lactation mammary gland; I, involution mammary gland

34 5 1 ( )... proteinase.,. awamori, strain ( ) 3 1. Korean native goat lactoferrin(knglf). Promoter inducing promoter Aspergillus oryze -amylase promoter signal sequence A. oryze -amylase terminator glucose

35 oxidase pagt. TATA box inverted repeat sequence promoter 99bp 327bp enhancer 1copy 2copy pagt promoter ligation paegt17 paegt16. selection, pan7-1 transformation. Fig. 15. Fig. 15 Map of selection vector, pan7-1 and expression vectors, pagt, paegt17 and paegt transformant 2-1. Protoplast (NRRL3) Northern Regional Research Laboratories. CM-plate(2% glucose, 2% malt extract, 0.1% peptone, 1.5% agar) A. niger 10ml 0.01% Tween ml CD(Czapeck's dox) / 0.025%(W/V) casamino acid rpm

36 Myracloth filter filtering. 200ml MP-buffer I(0.6M MgSO4.7H2O, 10mM potassium phosphate(ph5.8, 100mM KH2PO4, 100mM K2HPO4.3H2O)). 1g 5ml MP-buffer II(1.5M MgSO4. 7H2O, 10mM potassium phosphate (ph5.8)). 1g 20mg Novozyme 15,000unit -glucuronidase rpm ml cortexglass ST-buffer I(0.6M Sorbitol, 0.1M Tris.Cl, ph7.5). 6,000rpm protoplast tube 10ml ST-buffer II(1M Sorbitol, 10mM Tris.Cl, ph7.5) 4,000rpm. 10ml STC-buffer (1M Sorbitol, 10mM Tris.Cl ph7.5, 50mM CaCl2) 4,000rpm pellet STC-buffer protoplast protoplast /200 STC buffer Transformation 200 protoplast selection vector, pan7-1 expression vector pagt, paegt17, paegt PTC-buffer(60% Polyethylenglycol 6,000, 10mM Tris.Cl(pH7.5), 50mM CaCl2) PTC-buffer 20. microcentrifuge 5. Pellet 1ml STC-buffer 200 3ml top agar selection plate(cd-media + 1M sucrose /ml Hygromycin B) colony CM-hygromycin B plate 3 pagt, paegt17, paegt16 28, 38, 42 colony Transformant Southern blot analysis

37 Transformation colony 50ml CD 2 genomic DNA. -70 pre-cooling. Lysis buffer(0.5% SDS, 50mM EDTA) 30 phenol : chloroform : isoamylalcohol(25:24:1). ethanol TE buffer pellet RNase RNA. genomic DNA Southern blot analysis. Transformation 106 colony Southern blot. PCR DNA copy detection multicopy Southern blot. Southern blot DIG probe PCR DIG probe synthesis kit(bm ). Template pagt vector promoter 510bp signal sequence 70bp N- 100bp 680bp probe(fig 16). Fig. 16 Map of probe genomic DNA 40 EcoRI. 1% agarose gel loading 80volt 4 ethidium bromide(etbr) polaroid. Nitrocellulose membrane DNA transfer gel 0.5N NaOH, 1.5 M NaCl denaturation 1M

38 Tris Cl(pH8), 1.5M NaCl neutralization. pyrex dish transfer buffer(10x SSC) 3MM paper bridge gel gel membrane transfer buffer gel. gel 1cm 3MM paper buffer. paper towel 500g capillary transfer DNA membrane transfer 5X SSC washing. UV(254nm) 2 cross-linking. Membrane 42 2 prehybridization (hybridization ; 2% Blocking reagent, 0.1% N-lauroylsarcosine, 0.2% SDS, 50% formamide) boiling probe 16 hybridization. washing solution I(2X SSC, 0.1% SDS) II(0.5X SSC, 0.1% SDS) membrane washing. Membrane washing buffer(3% Tween 20 in Maleic acid buffer; 100mM maleic acid, 150mM NaCl, ph 7) 1 equilibration blocking solution(1% blocking reagent in maleic acid buffer) 1 blocking. membrane blocking buffer 5,000 anti-dig-alkaline phosphatase 1 washing buffer 15 2 washing. Detection buffer(45 NBT and 35 X-phosphate solution in 10ml detection buffer. Detection buffer; 100mM Tris Cl, 100mM NaCl ph9.5) 2 equilibration color substrate. Fig. 17 probe vector hybridization band

39 Fig. 17 Analysis of vectors for Southern blot Southern blot analysis pagt clone 10, paegt17 11 paegt Kb, 2.3Kb, 2.5Kb band. Fig. 4 Southern blot transformant. Positive Fig. 18 panel A transformant 12-O 47, panel B 11 20, 40, 47 panel C 11 15, 29, copy

40 Fig. 18 Southern blot analysis of Transformants Panel A, Transformants of pagt; panel B, Transformants of paegt17; panel C, Transformants of paegt16 (3) Southern blot clone transcription Northern blot analysis. RNA CD(Czapek' dox) 37 2 SY (5% starch, 2% yeast extract, 0.2% tryptone, 0.1% MgSO4, 0.1% K2HPO4, 0.05% KCl, 0.001% FeSO4, 1.5% CaCO3, ph 5.5) mg Trizol(Gibco ) 1ml. 5 Trizol 1ml 0.2ml chloroform ,000xg, 4 15 tube. 0.5ml isoprophanol 10 12,000xg, % 1ml vortex 7,500xg, 4 5 pellet. RNase RNA. RNA 20 DEPC-water sample buffer(65% formamide, 8.1% formaldehyde, 1.3X MOPS) loading dye 1% agarose gel loading. 80 volt 4 EtBr Southern blot transfer. Hybridization 5X SSC 2% blocking solution, 0.1% N-lauroylsarcosine, 0.2% SDS, 50% formamide. Probe 2.1kb LF cdna 32P-dCTP labeling

41 hybridization washing solution I(2x SSC, 0.1% SDS), II(1x SSC, 0.1% SDS) membrane washing X-ray film 24. Northern blot total RNA transformant pagt12-o mrna. vector clone, pagt47, paegt17-11, paegt kb band (Fig 19). Northern blot analysis copy genomic DNA integration DNA mrna transcription Fig. 19 Northern blot analysis of transformants Panel A is Northern blot and panel B is total RNA. 1, NRRL3 (control); 2, pagt12-o; 3, pagt18; 4, pagt19; 5, pagt20; 6, pagt-12-n; 7, pagt47; 8, paegt17-11; 9, paegt Western blot

42 E. coli O111 test. 50ml NRRL3, pagt-12-o, pagt-12-n, pagt-47, paegt17-11, paegt /ml rpm 100ml SY 30, 200rpm ml ph E. coli O111 test. test E. coli O111 survival rate(%). 1% peptone 100 SY 200 1X105 /ml E. coli O E. coli O111 (595nm) 100% sample. Fig pagt-12-o, pagt-12-n, pagt-47, paegt17-11, paegt17-40 E. coli O111 survival rate 60% 140 E. coli survival rate 10 20%. ph 4 survival rate protein ph 4, 90,. survival rate. SY ph 4, 30, 200rpm 90. Fig. 20. Survival Rate of Transformants against E. coli O111 and ph

43 6 1.,. (SK-1) : 1994 Furumanski solid tumor, Tsuda 1997 colon cancer. Hepatitis B virus X (HBx ) lactoferrin. 2. : - : HBx (8 ) 7 ( 3 ) - : HBx (8 ) 7 ( 3 ) C57BL/6 (8 ) - : bovine lactoferrin 2 g/ liter( )

44 - : : HBx 6 displastic nodule 1 85% ,., HBx. 10 4,.,3 C57BL/6,. HBx 7 nodule 8 1 mm 4 mm % : (CCl4) 2. : 1) : 8 Sprague-Dawly %

45 1 ml/kg (1 3 ) 0.5 ml/kg (2 4 ) 24. 2) :, 14, 15 GOT, GPT, TG, AKP automatic chemical analyzer (Ciba-Corning, Express 550). 3) : 10%. 3 4 Hematoxylin & Eosin % 1, 25 50% 2, 51 75% 3, % ) :.. 2) : 24 GOT U/ 2, U/ ( 0.01 P ), GPT U/ 1, U/ ( 0.01 P ) ( 21)

46 Figure 21. Serological assays of experimental rats. The levels of GOT and GPT raised very high after administration of 1 ml/kg CCL4 I.P. Note that the CCL4 effect was diminished in lactoferrin treated rats. 2) : ( 0.05 P ). 4. 2%. 4 Salmonella typhimurium ( ) 5 ( )

47 1. Tomita M., Bellamy W., Takase M., Yamauchi K., Wakabayashi H., Kamase K. (1991) Journal of Dairy Science 74, Le Provost, F. LE., Nocart, M., Guerin, G., and Martin, P. (1994) Biochem. Biophys. Res. Commun., 203, Kakuta, I., Kurokura, H., Nakamura, H., and Yamauchi, K. (1996) Suisanzoshoku, 44, Masada, S., Yamane, Y., Shimoda, K., Shimoda, T., Nakaniwa, S., Uno, T., Hirose, T., Ishikawa, K., Kijima, M., and Yonezawa, H. (1995) J. Anim. Clin. Res. Found., 3(2), Fujihara, T., and Hayashi, K. (1995) Arch. Virol., 140, T H Lee, K Shimazaki, S l Yu, M S Nam, S J Kim, K K Lee, D Y Yu(1997) Polymorphic sequence of korean native goat lactoferrin exhibiting greater antibacterial activity. Animal Genetics, 28, Seyfert, H. M., Tuckoricz, A., Interthal, H., Koczan, D. and Hobom, G.(1994) Gene, 143, Nam MS, Yu DY. Purification of Korean Native Goat Lactoferrin by using ion-exchange chromatography and affinity chromatography. Korean J. Dairy S -ci (3) : Nam MS, Yu DY, Shimazaki K. Comparison of antibaterial activities on Ko -rean native goat, bovine, sheep and horse lactof-errin. Korean J. Dairy S -ci (3) : Nam MS, Shimazaki K, Kumura H, Lee KK, Yu DY. Characterization of Kor -ean native goat lactoferrin. Comparative Biochemistry and physiology part B , Kimura M, Nam MS, Ohkouchi Y, Kumura H, Shimazaki K and Yu DY. Antimicrobial peptide of Korean native goat lactoferrin and identification of the part essential for this activity. Biochem. Biophys. Res. Comm. 2000, 268,

48 12.Sorenson, M. and S.P.L. Sorensen, C.R. Lab.(Carlsberg)(1939) [Ser Chim], 23 : Schanbacher, F.L., Goodman, R.E. and Talhouk, K.S. (1993) J.Dairy Sci., 76 : Sekine K, Watanabe E, Nakamura J, Takasuka N, Kim DJ, Asamoto M, et al. Jpn. J. Cancer Res. 1997, 88, Bezault J, Bhimani, R, Wiprovnick J, Furmanski P. Cancer Res , Chirgwin et al. Biochem., 1979, 18, Sanger et al. PNAS USA, 1977, 74,

49 lactoferrin peptide

50 lactoferrin peptide : :

51 ( ) : : ( ) :,,,,

52 Lf Lf, macrophage TNF- NO liter lactoferrin 65mg 29.4%. 2. K-Lf 81,000Da 0.56mg/g 40.6%. pi 9 K-Lf B-Lf H-Lf. 3. E. coli O111 B-Lf K-Lf, B-Lf-h K-Lf-h. MIC E. coli O111 B-Lf 1.5mg/ml, K-Lf 2.75mg/ml B-Lf-h 0.125mg/ml, K-Lf-h 0.25mg/ml B-Lf-h. Lf lysozyme. 4. K-Lf K-Lf RAW264.7 cell TNF-, LPS TNF-. 5. K-Lf TNF- NO. 6. K-Lf-h Lf TNF- NO

53 Summary The purpose of this study is to demonstrate biochemical properties and antibacterial activity of the Lf obtained from the colostrum of Korean native cow by the process of isolation purification and also verify the effect of K-Lf on the productions of TNF- and NO in RAW264.7 cells by K-Lf. The results are as follows; 1. The amount of Lf collected from a liter of colostrum of Korean native cattle was 65mg and the recovery rate was 29.4%, showing relatively a high purity in K-Lf. 2. The molecular weight of the purified K-Lf was 81kDa, and the content of iron was 0.56mg/g indicating 40.6% of iron saturation. The isoelectric point was 9. In the immunodiffusion test and Western blotting, cross-reactivity was observed between K-Lf and B-Lf not between K-Lf and H-Lf. 3. In the measurement of anitibacterial activity to E. coli 0111 and other microorgainisms, B-Lf showed a higher antibacterial activity level than that of K-Lf. The MIC of B-Lf was 1.5mg/ml and the MIC of B-Lf was 1.6mg/ml in E. coli The same result was also observed between B-Lf-h(0.125mg/ml) and K-Lf-h(0.25mg/ml): the antibacterial activity of B-Lf-h was higher than that of K-Lf-h. In addition, mixture of Lf and lysozyme raised the antibacterial activity level higher as well. 4. Even though K-Lf increased the production of TNF- in RAW264.7 cells with dose-dependency, it didn't affect on the production of TNF- in LPS-stimulated RAW264.7 cells. 5. K-Lf induced the production of NO similar to its role on the TNF- production. 6. Despite K-Lf-h has higher level of antibacterial activity comparing to Lf, it seems that Lf-h didn't significantly affect the production of TNF- and NO in RAW264.7 cells

54 . 58 II Lactoferrin lactoferrin lactoferrin RAW264.7 cell macrophage Lf Lf cytokine Lf 81 III Chromatography Lf HPLC lactoferin Lf RAW264.7 cell macrophage Lf Cytokine Lf

55 . immunoglobulin, lactoferrin(lf) lactoperoxidase, lysozyme, superoxide dismutase (Reiter, 1975). Lf,, (Arnold, 1977; Oseas, 1981; Mansson, 1990). Lf lactotransferrin (Montreuil Mullet, 1960), transferrin family (Aisen Listowsky, 1980; Brock, 1985 ; Rose, 1986),,, mucous neutrophil secondary granules. Lf 1960 Groves, Johansson Montreuil. Human-Lf(H-Lf) glycoprotein 2 glycan chain 691 (Metz-Boutigue, 1984), Pierce (1991) Bovine Lf(B-Lf) peptide 689. B-Lf 76KDa, 83KDa (, 1993). 2 lobe, lobe 1 2 Fe3+. Lf, coliform enterobacteria free iron chelating (Arnold, 1977; Bullen, 1981; Nemet Simonovits, 1985)., Lf lipopolysaccharide(lps), 55

56 (Ellison, 1988; Nikaido, 1989). Lf (Arnold, 1977) (Nemet Simonovits, 1985), myelopoiesis (Broxemeyer, 1980), (Oseas, 1981; Mansson, 1990), lympocytes (Hashizume, 1983) macrophage glanulocyte, neutrophil, leukocyte (Ambruso Johnston, 1981; Bullen Amstrong, 1979). Lf (hemopoietic progenitor cell) complex regulatory network (Malmquist, 1978). macrophage Lf, tumor necrosis factor- (TNF- ) interleukin-8(il-8), nitric oxide(no) (Sorimachi, 1997), in vivo Lf TNF- interleukin-6 cytokine (Machnicki, 1993). TNF- LPS phorbol-12-myristate-13-acetate macrophage monocyte proinflammatory cytokine (Manogue, 1992) apoptosis antitumor, TNF- (Vileek Lee, 1991). TNF- (Beutler, 1992) immunological liver injury (Tiegs, 1989),, (Firestein, 1994) autoimmune disease. TNF- HIV(human immunodeficiency virus) DNA, (Sekut Connolly, 1996). NO (Nathan, 1992) NO 56

57 acetylcholine (Ignarro, 1990; Moncada Higgs, 1991), cytokine (Furchgott Vanhoutte, 1989). Lf Lf lactoferrin hydrolysate(lf-h) Tomita (1991) Bellamy (1992) pepsin B-Lf N-terminal amino acid 3,126Da domain lactoferricin(lfcin). B-Lf (MIC) 2000 / Lfcin 6 / 300, H-Lf Lfcin 16. Lfcin. Lf,,,,. Lf Lf Lf-h Holstein Lf. B-Lf Lf. Holstein (, 1998) Lf. Lf, Lf,, macrophage TNF- NO, Lf cytokine. 57

58 II. 1. Lf 2 3. Bovine lactoferrin human lactoferrin Sigma Co. bovine lactoferrin, 2. Lactoferrin 4 5,000 g 30, 20 1N HCl ph 4.6 casein, 5,000 g 10 whey. whey 1N NaOH ph 8.0 5,000 g Batch extraction( 1 ) Dionysius (1991) (1994), whey 1 liter 50mM Na-phosphate buffer(ph 8.0) CM-Sephadex C-50(Sigma. Co.) 200, 1 1. slurry aspirator funnel, buffer, 0.2M NaCl buffer 200 slurry. slurry column( 3cm 30cm) 0.5M NaCl buffer /hr 10 UV monitor system(econo system: Bio-rad, USA) 280nm. 4 cold room ultrafiltration system(amicon, USA). 58

59 2.2. Ion exchange chromatography( 2 ) 1 crude Lf fraction 50mM Na-phosphate buffer(ph 8.0), buffer CM-sephadex C-50 column( 3cm 30cm). gradient stepwise gradient 1 0.1M NaCl 50mM Na-phosphate buffer(ph 8.0) 250, 2 0.3M NaCl buffer 250, 3 0.5M NaCl buffer /hr 10 /tube, 4 UV monitor system 280nm. 4 cold room ultrafiltration Gel filtration chromatography( 3 ) 2 crude Lf 50mM Na-phosphate buffer(ph 8.0), Sephadex G-150(Pharmacia, Sweden) column( 2.5cm 40cm) loading, 50mM Na-phosphate buffer(ph 8.0) 1 liter 30 /hr 10 /tube. 4 UV monitor system 280nm cold room ultrafiltration Heparin agarose affinity chromatography( 4 ) Chen (1991) affinity chromatography. Heparin-agarose binding buffer(5mm Tris-HCl containing 50mM NaCl, ph 8.0) column( 3cm 20cm), 3 Lf binding buffer loading. Washing buffer(5mm Tris-HCl, containing 0.2M NaCl, ph 8.0) 0.2M 0.7M NaCl 30 /hr 10. UV monitor 280nm, cold room ultrafiltration. 59

60 2.5. 1) Sodium dodecyl sulfate polyacrylamide gel electrophoresis Lactoferrin Laemmli (1970), Mini-Protein II(Bio-rad, USA) sodium dodecyl sulfate polyacrylamide gel electrophoresis(sds-page). SDS-PAGE 0.1% SDS 10% acrylamide gel 0.025M Tris, 0.192M glycine electrode buffer(ph 8.3) well constant current 4mA, gel 0.25% coomassie blue R-250 methanol acetic acid water(3 1 6, v/v/v) staining solution 1 acetic acid methanol water(1 3 6) destaining solution. 2) High performance liquid chromatography Lf Lf HPLC(SP8800, Spectra-Physics, USA) reverse phase column chromatography Table Lactoferrin Lf-hydrolysate Tomita (1991) Lf 5%(w/v) 3, ph mM HCl pepsin Lf 3%(w/w) 37 shaking water bath water bath 15 ph ,000 g

61 3. lactoferrin 3.1. lactoferrin HPLC Lf HCl Pico-Tag HPLC(Waters, USA).. 61

62 colostrum Centrifugation 5,000 g for 30 min at 4 Skim Milk adjust to ph 4.6 at 20 with HCl Whey Casein adjust to ph 8.0 with 1N NaOH additon of 200 of CM-Sephadex C-50 Agitation 4, 1hr Precipitation Elution (batch type) Lactoferrin-rich fraction CM-Sephadex C-50 column Fraction I Fraction II Dialysis Freeze Drying Sephadex G-150 column Dialysis Freeze Drying Heparin Agarose column Dialysis Freeze Drying Fig. 1. Schematic diagram of purification lactoferrin 62

63 Table 1. Gel preparation for SDS-PAGE Stock solution deionized water 30% acrylamide solution 1.5M Tris (ph 8.8) 10% SDS 10% ammonium persulfate TEMED 10% gel

64 Table 2. Operation condition of HPLC Column Detector Flow rate Mobile phase Symmetry(C18reverse, Waters) UV 280nm 1.00 /min (A) 0.1% TFA/H2O (B) 0.1% TFA/CH3CN Gradient 0 min A B (80 : 20) 35 min A B (55 : 45) 64

65 Table 3. Gel preparation for isoelectric focusing Stock solution 5% gel deionized water 30% acrylamide mix ampholytes(3.5/10) glycerol 10% ammonium persulfate TEMED

66 3.2. (isoelectric focusing) Lf Robertson (1987). 5% acrylamide gel (3.3%, ph ) Mini-Protein II(Bio-rad) IEF-PAGE. cathode buffer 20mM NaOH anode buffer 10mM phosphoric acid current voltage 200V 1 30, 400V % trichloroacetic acid 20. 1% trichloroacetic acid 2 SDS-PAGE Lf serum iron analysis kit (Wako Pure Chemical Industries, Japan). (L-ascorbic acid) 15 buffer(tween M Acetic acid, ph 5.0) 2. 1% Lf 0.5 blank 535nm (ESBI) (bathopenanthroline sulfonic acid disodium salt, 19mM/liter) 535nm (ES). (Fe 200g/dl) (ESTD) (EBI) Lf. ( / ) = 3.4. Circular dichroism Es- ESBI- EBI ESTD- EBI 200 Circular dichroism(cd) Shimazaki (1993) PS 150J power supply JASCO J-715 automatic recording spectro- polarimeter(, Japan). cell 1 mm, 150 / CD. 66

67 3.5. lactoferrin 1) 1 K-Lf 500 / PBS Freund's complete adjuvant(difco, USA) (New Zealand White) 1 immuno diffusion test. 1 2 Freund's incomplete adjuvant(difco, USA) K-Lf 1 2 K-Lf K-Lf ) Ouchterlony immunodiffusion test PBS buffer 1% agarose gel 1.5 well rabbit anti-k-lf-antiserum 10 Lf ) Antibody titer 0.05M carbonate buffer(ph 9.0) 2 / EIA 96-well plate C overnight coating. Tween % PBS(PBST) PBST 3. 2 (horse radish peroxidase-conjugated anti-rabbit IgG) PBST 1 10, PBST 3. (TMB substrates buffer, 30% H2O2, TMB 1 / methanol) M H2SO4 50 ELISA reader(elx800 : Bio-tec, USA) 450nm. 67

68 4) Western blot analysis Lf SDS-PAGE gel transfer buffer (25mM Tris, 192mM glycine, 20% methonal, ph 8.3) nitrocellulose membrane electrotransfer kit(bio-rad, USA) transfer buffer constant voltage 100V membrane blocking buffer(tbs buffer+5% BSA) ,000 TBS buffer primary antibody solution 4 overnight TBS buffer 10 3 biotinylated secondary antibody reagent 30 TBS buffer straptavidin alkaline phosphatase reagent 30 TBS buffer 10 3 BCIP/NBT(5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium). 4. lactoferrin 4.1. E. coli O111, Staphylococcus aureus ATCC25923, Salmonella typhimurium ATCC13311, Candida tropicalis KCTC7221 Difco Co.. nutrient 37, 1% peptone % peptone 0.45 filter (Millipore Co.) Lf 6 106cfu/

69 4.3. Minimum inhibitory concentration nutrient % peptone Lf 106cfu/ colony Lysozyme Lf lysozyme E. coli O cfu/ Transmission electron microscopy 1% peptone Lf 5 / Lf-h 1 / Candida tropicalis KCTC cfu/ mM phosphate buffer (ph 6.8) 1% agar 1mm 1mm 3mm Karnnovsky's. washing buffer (50mM cacodylate buffer, ph 7.2) 1% OsO4 buffer 3 washing buffer 0.5% uranyl acetate overnight. 50, 75, 90, 95, 100% ethanol propylene oxide 1 epon propylene oxide epon embedding diamond knife ultrathin section uranyl acetate lead citrate 75kV Transmission electron microscopy(tem)(h-800: Hitachi, Japan) Lactoferrin peptide Lf-h 5 / HPLC C18 column 1 69

70 evaporator filtration(0.45 ). HPLC Table 3. 70

71 5. RAW264.7 cell macrophage 5.1. cell line (KCLB) culture medium Gibco/BRL Co., Sigma Co.. RAW264.7(KCLB 40071) cell murine macrophage cell 10%(v/v) fetal bovine serum(fbs) (penicillin(100units/ )/streptomycin (100 / )) DMEM culture medium(ph 7.2) culture dish( 100) 90% scraping L929(KCLB 10001:NCTC clone 929) cell murine fibroblast cell 10%(v/v) FBS 1% penicillin/streptomycin RPMI1640 medium(ph 7.2) culture dish( 100) 90% 1% trypsin/edta cell Lf Lf-h culture medium 10 / 0.22 filter(millipore, USA), LPS actinomycin D 100 / PBS(Phosphate buffer saline). MTT(3-(4,5-Dimethylthiazol -2-yl)-2,5-diphenyltetrazolium bromide) 5 / PBS (cytotoxicity) RAW264.7 cell 1 105cells/well, L929 cell 3 104cells/well 96-well mocroplate 37, 5% CO2incubator 4. well volume MTT (5 / )

72 well PBS buffer % SDS 50 CO2incubator 24. ELISA microplate reader(elx800 : Bio-tec, USA) 540nm in vitro TNF- TNF- (1998). Lf LPS RAW264.7 cell TNF- 96-well plate RAW264.7 cell 2 105cells/well. well Lf Lf-h LPS 1 / well , 5% CO2incubator 6. TNF- TNF- L929 cell L929 cell 3 104cells/well 96-well microplate % CO2incubator 4 75 RAW264.7 cell 25. actinomycin D(4 / ) 25 37, 5% CO2incubator MTT(5 / ) well 5 4 CO2incubator. 4 PBS buffer % SDS solution 50. CO2incubator 24 ELISA microplate reader TNF- RAW264.7 cell TNF- R&D systems(usa) mouse TNF- immunoassay Quntikine M ELISA kit in vitro Nitric oxide Lf RAW264.7 cell NO 72

73 cell scraping cells/well 96-well microplate Lf Lf-h ( / ) interferon- (IFN- ) 10unit/, LPS 100ng/, well volume , 5% CO2incubator well microplate Griess reagent (0.2% naphthyethylene diamine) (10% phosphoric acid containing 2% sulfanilamade) ELISA microplate reader 540nm sodium nitrite nitric oxide nitrite. 6. Lf Lf (KCLB). human A427(lung carcinoma, KCLB 30053), A498(kidney carcinoma, KCLB 30044), HeLa(cervix adenocarcinoma, KCLB 10002), HepG2(liver hepatoblastoma, KCLB 58065), HT29(colon adenocarcinoma, KCLB 30038), MCF7(breast adenocarcinoma, KCLB 30022), SK-HEP-1(liver adenocarcinoma, KCLB 30052), WiDr(colon adenocarcinoma, KCLB 10218) Cytotoxicity A427, A498, SK-HEP-1, WiDr heat inactivation 10 (v/v) fatal bovine serum(fbs) (penicillin(100units/ )/streptomycin(100 / )) Dulbecoo's modified Eagle's medium(dmem, ph 7.2), HeLa, HT29, HepG2, MCF heat inactivation 10 (v/v) fatal bovine serum(fbs) (penicillin(100units/ )/streptomycin(100 / )) RPMI1640(pH 7.2)medium. culture dish( 100) % trypsin/edta 1 : 5. 73

74 6.2. in vitro cytotoxicity Lf cytotoxic effect MTT assay cells/well 96 well plate plate 37, 5 CO2incubator / 1 / H-Lf, B-Lf, K-Lf 20 37, 5 CO2incubator MTT (5 / ) well PBS % SDS solution 50 37, 5 CO2incubator 24 ELISA microplate reader(elx800 : Bio-tec, USA) 540nm. (Growth inhibitory effect(%)=[( - / )]

75 7. Lf cytokine Cytokines Lf T cell cytokine IL-2, IL-4, IL-6, IFN- cytokine. mouse T cell EL-4(KCLB 40039) heat inactivation 10 (v/v) horse serum (penicillin(100units/ )/streptomycin(100 / )) Dulbecoo's modified Eagle's medium(dmem, ph 7.2), culture flask (T-75) 1 : well plate 3 106cells/well, Lf 1mg/ml. Cytokine PMA(phorbol-12-myristate-13-acetate) 100ng/ml, 3 7 5% CO2 incubator 24, cytokine Total RNA Lf cytokines EL-4 cell total RNA AGPC(acid guanidinium thiocyanate-phoh-chloroform extraction)., Lf 24 EL-4 cell, 0.5% sarcosyl RNA total RNA. total RNA isopropyl alcohol, 70% ethanol 3. Total RNA 260nm, RT-PCR RT-PCR Cytokines RT-PCR (reverse transcriptase polymerase chain reaction). AGPC total RNA 15 cdna, cdna cytokines primer (Table. 1) PCR. PCR 94 /3, 94 /30, 58 /1, 72 /2 25, 72 /5. PCR PCR % agarose, cytokines. 75

76 76

77 Table. 4. Nucleotides sequences of oligosaccharide primers for RT-PCR. IL-2 IL-4 IL-6 Upstream 5'-CCTTGCTAATCAC TCCTCAC-3' 5'-AGGACCACGATTA TGAGC-3' 5'-GAGTTGTGCAATG GCAATTC-3' Downstream 5'-TTTGAAGGTGAGCA TCCTGG-3' 5'-TTGTTGAGTGCCAT CTGG-3' 5'-TGGATGGTCTTGGT CCTTAG-3' IFN- 5'-CAGCTGTCACCAG AATCTAGCC-3' 5'-CAGCACCTCACGGG GTCATTGC-3' 77

78 8. Lf Mouse C57BL/6 (6-7 weeks, ), kidney Staphylococcus.aureus(ATCC 25923). Lf(10mg/ml) 0.22um, 1 0.1ml(1mg/mouse). 0.9% saline. Kidney infection Lf 1 S.aureus 0.1ml (106cell/ml nutrient broth), 14 kidney. kidney, 3ml PBS homogenizer ( ). salt mannitol agar, Staphylococcal colony counting. Mouse diets. Lf, 2% ( ), 50ml/day. 78

79 III. 1. Chromatography Lf Lf Nagasawa (1972) DEAE-Cellulose, Spik (1982) SP-Sephadex, Dionysius (1991) CM-Sephadex C-50 ion exchange chromatography, Ena (1990) -lactoglobulin affinity chromatography, batch lactoferrin. 1 batch K-Lf rich fraction 280nm 0.294, Dionysius (1991) Lf lactoperoxidase buffer NaCl Lf lactoperoxidase. 2 2 (Fig. 2), fraction 0.3M NaCl fraction 0.5M NaCl. fraction Fig. 5 2 Lf fraction Lf Lf. 3 gel filtration chromatography, Fig. 3 peak SDS-PAGE Lf. 4 Fig. 4 heparin agarose affinity chromatography Lf, 0.5M NaCl peak SDS-PAGE, Sigma Co. bovine lactoferrin 79

80 . K-Lf SDS-PAGE Fig. 5. logarithm K-Lf 81KDa, B-Lf 80KDa. K-Lf Table 4 whey 1 65 K-Lf. 29.4% Lf affinity lactoferrin. Lf sephadex G-150 gel filtration heparin agarose affinity chromatography. Lf 5 /, Tsuchi (1990) Lf 0.5 /. K-Lf. Tsuchi (whole milk) Lf. Lf

81 Fig. 2. CM-sephadex C-50 ion exchange chromatography of lactoferrin purified from Korean native cow's colostrum following batch extraction with CM-sephadex C-50 Fig. 3. Sephadex G-150 gel filtration chromatography of lactoferrin purified from Korean native cow's colostrum following CM-sephadex C-50 ion exchange chromatography 81

82 Fig. 4. Heparin agarose affinity chromatography of lactoferrin purified from Korean native cow's colostrum following sephadex G-150 gel filtration chromatography 82

83 Table 5. Recovery rate of lactoferrin from Korean native cow's whey by purification steps Purification Step ( ) ( ) Recovery rate(%) whey 1L

84 Fig. 5. SDS-PAGE anyalysis of lactoferrin purified from Korean native cow's colostrum by purification step Lane 1 molecular weight marker(sigma. Co.) Lane 2 lactoferrin purified from Korean native cow's colostrum by CM-sephadex ion exchange chromatography Lane 3 lactoferrin purified from Korean native cow's colostrum by G-150 gel filtration chromatography Lane 4 commercial bovine lactoferrin Lane 5 lactoferrin purified from Korean native cow's colostrum by heparin agarose affinity chromatography A -galactosidase (MW 116,000) B fructose-6-phosphate kinase (MW 84,000) C pyruvate kinase (MW 58,000) D ovalbumin (MW 45,000) E lactic dehydrogenase (MW 36,500) F triosephosphate isomerase (MW 26,000) 84

85 2. HPLC lactoferin Lf HPLC. 1 peak (Fig. 6) 2 peak batch peak (Fig. 7). ion exchange chromatography Lf HPLC pattern retention time. 3 HPLC pattern(fig. 8) peak Lf peak peak. 4 peak (Fig. 9) 4 pattern chromatography. K-Lf B-Lf HPLC pattern SDS-PAGE affinity chromatography peak retention time (Fig. 10). H-Lf HPLC pattern(fig. 11) H-Lf retention time K-Lf B-LF peak K-Lf B-LF. Fig. 6. HPLC analysis pattern of crude lactoferrin purified from Korean native cow's colostrum following batch extraction with CM-sephadex C-50 Fig. 7. HPLC analysis pattern of crude lactoferrin purified from Korean native cow's colostrum following CM-sephadex C-50 ion exchange chromatography 85

86 Fig. 8. HPLC analysis pattern of crude lactoferrin purified from Korean native cow's colostrum following G-150 gel filtration chromatography 86

87 Fig. 9. HPLC analysis pattern of lactoferrin purified from Korean native cow's colostrum following heparin agarose affinity chromatography 87

88 Fig. 10. HPLC analysis pattern of commercial bovine lactoferrin Fig. 11. HPLC analysis pattern of commercial human lactoferrin 3. Lf 3.1. lactoferrin amino acid K-Lf amino acid Pierce (1991) B-Lf amino acid lysine, K-Lf amino acid B-Lf amino acid K-Lf B-Lf K-Lf pi isoelectric focusing Lf pi 9 (Fig. 12). (1994) K-Lf pi 8.7 B-Lf pi 8.9 K-Lf H-Lf pi 8.8 Moguilevsky (1985) 8.7, Foley (1987), O'connor (1987) H-Lf pi Lf Serum iron analysis Kit Lf Lf (Table 7). K-Lf B-Lf 40.6% 34.2% B-Lf H-Lf 15.4% 10.8%. K-Lf B- Lf 88

89 Frasson (1980) 1 4% Lf Circular dichroism spectra Circular dichroism(cd) Fig helix K-Lf 18% -helix B-Lf 15 % -helix. Brown (1974) B-Lf -helix 15% Shimazaki (1991) B-Lf 12%, apo-b-lf 14%, holo-b-lf 12% -helix B-Lf -helix. -helix K-Lf B-Lf Ouchterlony immunodiffusion test K-Lf lactoferrin K-Lf K-Lf B-Lf, K-Lf, H-Lf, B-Lf-h BSA Ouchterlony immunodiffusion test (Fig. 14) B-Lf K-Lf B-Lf-h K-Lf. B-Lf-h K-Lf. K-Lf H-Lf. Lf. Shimazaki (1991) immunodiffusion B-Lf sheep-lf goat-lf H-Lf horse-lf H-Lf Lf. 89

90 3.6. Antibody titer 3 boosting 4 boosting 3 boosting 4 boosting. ELISA. Antibody titer (Fig. 15) Western blot analysis B-Lf, K-Lf H-Lf SDS-PAGE Lf cross-reactivity K-Lf Western blotting Fig. 16. B-Lf, K-Lf H-Lf. ouchterlony test B-Lf K-Lf H-Lf lactoferrin. 90

91 Table 6. Amino acids composition of Korean native cow's lactoferrinand A bovine lactoferrin B C Amino acids D B-Lf K-Lf Alanine Arginine Asparagine 29 E 59 Aspartic acid 36 Cysteine F Glutamine G 29 Glutamic H acid Glycine I Histidine 9 8 Isoleucine Leucine Lysine Methionine J 4 1 Phenylalanine Proline Serine Threonine Tryptophan Tyrosine Valine Total A.A. residues Data were calculated from the amino acid sequence of bovine lactoferrin(pierce, 1991) Fig. 12. Isoelectric focusing gel electrophoresis of lactoferrins 1. pi standard marker 2. K-Lf 3. B-Lf 91

92 4. H-Lf A : Trypsinogen(pI 9.3) B : Lectin (pi 8.8) C : Lectin (pi 8.6) D : Lectin (pi 8.2) E : Myoglobulin(pI 7.2) F : Carbonic Anhydrase(pI 6.6) G : Carbonic Anhydrase(pI 5.9) H : -lactoglobulin A(pI 5.1) I : Trypsin inhibitor(pi 4.6)J : Amyloglucosidase(pI 3.6) Table 7. Iron content and iron saturation of different kinds of lactoferrin B-Lf H-Lf K-Lf B-Lf (normal (normal (colostrum) (colostrum) milk) milk) Fe content( /g) F e saturation(%) K-Lf Fe saturation 100% = 1.38 /g Lf B-Lf Fe saturation 100% = 1.43 /g Lf 92

93 Fig. 13. CD-spectra of Korean native cow's lactoferrin and commercial bovine lactoferrin 93

94 Fig. 14. Ouchterlony immunodiffusion pattern of rabbit anti-k-lf -antiserum against B-Lf, K-Lf, H-Lf, B-Lf-h and BSA c : rabbit anti-k-lf-antiserum 1 : B-Lf 2 : K-Lf 3 : H-Lf 4 : B-Lf-h 5 : BSA 94

95 Fig. 15. Quantitative analysis of K-Lf and its antibody complex by ELISA on the basis of amount of the rabbit anti-k-lf-antiserum 95

96 Fig. 16. Western blot analysis comparision of lactoferrins 1. H-Lf 2. K-Lf 3. B-Lf 96

97 Lf Lf-h B-Lf K-Lf 1, 2, 3, 4 /, B-Lf-h K-Lf-h 0.05, 0.1, 0.5, 1 / E. coli O111. B-Lf K-Lf Lf. B-Lf 1 /. K-Lf B-Lf (Fig. 17, 18). K-Lf B-Lf. Lf Fig. 19 Fig. 20 B-Lf-H 0.5 / E. coli O111 K-Lf-H 0.5 /, 1 / B-Lf-H (Minimum inhibitory concentration) B-Lf K-Lf, B-Lf-h, K-Lf-h E. coli O111, Staphylococcus aureus, Salmonella typhimurium, Candida tropicalis (MIC). E. coli O111, MIC B-Lf 1.50 /, K-Lf 2.75 /, B-Lf-h 0.12 /, K-Lf-h 0.25 / Lf MIC 2 (Table 7). Tomita (1991) Bellamy (1992) B-Lf MIC 2 /, B-Lf-h 0.1 / MIC. Staphylococcus aureus B-Lf, K-Lf 50 /. lactoferrin Staphylococcus aureus B-Lf-H 0.70 /, K-Lf-H 1.80 / B-Lf-h K-Lf-h 2 97

98 (Table 8). Salmonella typhimurium Lf B-Lf MIC 0.3 / (Table 9), Candida tropicalis K-Lf B-Lf Lf (Table 10). B-Lf K-Lf B-Lf-h K-Lf-h Lactoferrin lysozyme Lysozyme 0.39 / (Gurr, 1981) lysozyme Lf, lysozyme Lf (Suzuki, 1989). lysozyme E. coli O111 Table 11. Lf lysozyme E. coli O111 MIC B-Lf 1.5 /, K-Lf 2.75 /, lysozyme 0.25 / Table Lf lysozyme synergistic effect, Ellison(1991)., K-Lf B-Lf lysozyme B-Lf lysozyme K-Lf TEM Lf 1% peptone Lf 5 / Lf-h 1 / Candida tropicalis KCTC cfu/

99 Transmission electron microscopy (TEM). (Fig.21). Lf Lf-h (Fig. 22, 23) cytoplasmic Bellamy (1993, 1994) lactoferricin B yeast fungi. yeast Lf Lf-h Lactoferrin peptide Lf peak HPLC gradient, peptide peak Fig. 24. K-Lf B-Lf retention time Tomita (1994) reverse phase column lactoferricin B gradient. 99

100 Fig. 17. Bacteriostasis of E. coli O111 by B-Lf in 1% peptone broth at

101 Fig. 18. Bacteriostasis of E. coli O111 by K-Lf in 1% peptone broth at

102 Fig. 19. Bacteriostasis of E. coli O111 by B-Lf-H in 1% peptone broth at

103 Fig. 20. Bacteriostasis of E. coli O111 by K-Lf-h in 1% peptone broth at

104 Table 8. Inhibitory sensitivity of lactoferrin and peptic lactoferrin hydrolysates to E. coli O111 MIC( / ) B-Lf K-Lf B-Lf-H K-Lf-H Table 9. Inhibitory sensitivity of lactoferrin and peptic lactoferrin hydrolysates to Staphylococcus aureus MIC( / ) B-Lf K-Lf B-Lf-H K-Lf-H >50 >

105 Table 10. Inhibitory sensitivity of lactoferrin and peptic lactoferrin hydrolysates to Salmonella typhimurium MIC( / ) B-Lf K-Lf B-Lf-H K-Lf-H Table 11. Inhibitory sensitivity of lactoferrin and peptic lactoferrin hydrolysates to Candida tropicalis MIC( / ) B-Lf K-Lf B-Lf-H K-Lf-H

106 Table 12. Minimum inhibitory concentration of lactoferrin purified from Korean native cow's colostrum and commercial bovine lactoferrin with or without lysozyme Lysozyme ( / ) control B-Lf( / ) K-Lf( / ) _ _ : no antibacterial effect + : antibacterial effect Fig. 21. Electron micrographs of Lf-untreated Candida tropicalis Cells were cultured in 1% peptone broth at 37 for 4hrs bar 1 106

107 Fig. 22. Electron micrographs of Candida tropicalis showing morphological changes induced by lactoferrins (A) Cells were cultured in 1% peptone broth supplemented with 5mg/ml commercial A bovine lactoferrin at 37 for 4hrs (B) Cells were cultured in 1% peptone broth supplemented with 5mg/ml Korean native cow's lactoferrin at 37 for 4hrs bar 1 A Fig. 23. Electron micrographs of Candida tropicalis showing morphological changes induced by peptic lactoferrin hydrolysates (A) Cells were cultured in 1% peptone broth supplemented with 1mg/ml peptic Bbovine lactoferrin hydrolysate at 37 for 4hrs (B) Cells were cultured in 1% peptone broth supplemented with 1mg/ml peptic Korean native cow's lactoferrin hydrolysate at 37 for 4hrs bar 1 B 107

108 Fig. 24. Reverse-phase HPLC profile of the lactoferrin hydrolysates A : K-Lf-h B : B-Lf-h Arrow indicates the position of the active peptide recovered for sequence analysis. 108

109 5. RAW264.7 cell macrophage 5.1. Lf Lf Lf-h RAW264.7 cell L929 cell Lf Lf-h /. RAW264.7 cell L929 cell 24 MTT Fig. 25, Fig % Lf RAW264.7 cell L929 cell Lf Lf RAW264.7 cell TNF- Macrophage LPS proinflammatory cytokine IL-1, IL-6, TNF-. Lf macrophage TNF- murine macrophage cell line RAW264.7 cell. LPS RAW264.7 cell Lf(K-Lf, B-Lf, H-Lf), TNF-. TNF- L929 cell cell survival rate (Fig. 27). 1mg/ml K-Lf, B-Lf, H-Lf RAW264.7 cell 6, K-Lf 22% (Fig. 27-A). B-Lf H-Lf 85% 90%, K-Lf. K-Lf, LPS. K-Lf bioassay L929 cell cytotoxic effect (Fig. 26). K-Lf macrophage TNF-. K-Lf TNF- Fig. 27-B. K-Lf TNF-. K-Lf 1 / 6%, 5 / 16% TNF-. 3%, 5 / K-Lf 109

110 TNF-. B-Lf H-Lf 11% 6%, 16% K-Lf TNF- (Fig. 27-C, 27-D). Lf macrophage TNF-. K-Lf macrophage TNF Lf LPS TNF- RAW264.7 cell LPS TNF-. Lf LPS RAW264.7 cell TNF-. 1 / LPS RAW264.7 cell 6 bioassay TNF-, 28% (Fig. 28-A)., K-Lf, B-Lf, H-Lf LPS RAW264.7 cell TNF- Fig. 30. LPS 28% K-Lf, B-Lf, H-Lf 31%, 51%, 63% (Fig. 28-A). TNF-, LPS K-Lf 3%, B-Lf 23%, H-Lf 35% TNF-. Lf TNF-, H-Lf TNF-., Lf. Fig. 28-B LPS K-Lf Lf. B-Lf H-Lf Lf LPS TNF- 110

111 H-Lf (Fig. 28-C, 28-D). Lf LPS TNF-., Lf bioassay TNF- L929 cell. Lf RAW264.7 cell TNF-, L929 TNF-. recombinant TNF- Lf L929 cell TNF- (Choe and Lee, unpublished data)., Lf LPS RAW264.7 cell TNF-. Lf LPS LPS. LPS Lf H-Lf 35% TNF-., Lf RAW264.7 cell TNF-. Lf DNA, Lf,. Lf Lf TNF-. Lf., Lf TNF- TNF- Nuclear Factor- B(NF- B). TNF-, TNF-. Zagulski (1989) B-Lf mouse 24 E. coli mouse TNF- 111

112 , Machnicki (1993) in vivo Lf TNF-. Sawatzki Rich(1989) LPS Lf (5 6 ) Guttenberg (1989) Lf Lf. Lf IL-1 (Silva Cohen, 1992), TNF- (Beutler, 1985) proinflammatory cytokine ELISA TNF- RAW264.7 cell Lf ELISA TNF-. TNF- 0 TNF-. Table 12 RAW264.7 cell LPS TNF- 212ng/ K-Lf B-Lf TNF- bioassay K-Lf TNF- B-Lf. LPS Lf ELISA reader TNF-. Lf LPS RAW264.7 cell Lf TNF- bioassay LPS Lf. 112

113 Fig. 25. Effect of lactoferrin purified from Korean native cow's colostrum, commercial bovine lactoferrin, peptic hydrolysate of K-Lf and peptic hydrolysate of B-Lf on the growth of RAW264.7 cells A : 1 / K-Lf C : 1 / B-Lf E : 1 / K-Lf-h G : 1 / B-Lf-h B : 1 / K-Lf D : 1 / B-Lf F : 1 / K-Lf-h H : 1 / B-Lf-h Fig. 26. Effect of lactoferrin purified from Korean native cow's colostrum, commercial bovine lactoferrin, peptic hydrolysate of K-Lf and peptic hydrolysate of B-Lf on the growth of L929 cells A : 1 / K-Lf C : 1 / B-Lf E : 1 / K-Lf-h G : 1 / B-Lf-h B : 1 / K-Lf D : 1 / B-Lf F : 1 / K-Lf-h H : 1 / B-Lf-h 113

114 Fig. 27. TNF- production A of RAW264.7 Bcells by different kinds of lactoferrin A : RAW cells were incubated with lactoferrin at 1mg/ml in DMEM with 10% FBS B-D : RAW264.7 cells were incubated with different lactoferrin (at 0 to 1000 /ml) level of TNF- production was expressed by growth inhibition of L929 cells C D Survival rates were measured by MTT assay in which supernatant of cultured RAW 264.7cells for 6hrs was applied to L929 cells 114

115 Fig. 28. TNF- production of RAW264.7 cells by different kinds of lactoferrin A with LPS stimulation B RAW264.7 cells were stimulated by 1 /ml LPS(A-D) A : RAW264.7 cells were incubated with lactoferrin at 1mg/ml in DMEM with 10% FBS B-D : RAW264.7 cells were incubated with different level of lactoferrin(at 0 to 1000 /ml) TNF- production was expressed by growth inhibition of L929 cells Survival rates were measured by MTT assay in which supernatant of cultured RAW 264.7cells for 6hrs was applied to L929 cells C D 115

116 Table 13. Quantitation of TNF- production from the stimulated RAW264.7 cells by lactoferrins Treatment conc. ( / ) K-L (ng/ ) B-Lf (ng/ ) LPS(1 / ) ng

117 5.5. Lf RAW264.7 cell NO Lf RAW264.7 cell NO Lf K-Lf (1 / ) 3 NO B-Lf NO (Fig. 30-A). Fig. 30-B K-Lf NO B-Lf (Fig. 30-B, 30-C). TNF- LPS(100ng/ ) NO, LPS IFN- (10 units/ ) IFN- NO synergistic effect NO. Lf LPS K-Lf B-Lf NO. IFN-, K-Lf Lf NO B-Lf NO (Fig. 31-A, 31-B). Lf IFN- LPS NO IFN-. K-Lf TNF- NO B-Lf NO. Lf LPS IFN- NO Lf IFN- LPS K-Lf B-Lf. Sorimachi (1997) bone marrow macrophage Lf NO, LPS NO. 117

118 Fig. 29. Standard curve for measurement of nitric oxide using sodium nitrite 118

119 A Fig. 30. NO production of RAW264.7cells by lactoferrin purified from Korean native cow's colostrum and commercial bovine lactoferrin. A : RAW264.7 cells were incubated with lactoferrin at 1mg/ml in DMEM with 10% FBS B, C : RAW264.7 cells were B incubated with different level of C lactoferrin(at 0 to 1000 /ml) 119

120 A B Fig 31. NO production of RAW264.7cells by lactoferrin purified from Korean native cow's colostrum(a) and commercial bovine lactoferrin(b) with stimulants Concentration of lactoferrin was 1mg/ml, respectively LPS : 100ng/ml, IFN- : 10unit/ml, LPS+IFN- : combination of equivalent amounts LPS and IFN- 120

121 5.6. Lactoferrin RAW264.7 cell TNF- Lf Lf-h macrophage cell TNF- TNF- bioassay TNF-. K-Lf-h K-Lf K-Lf-h TNF- (Fig. 32-A)., K-Lf 22% K-Lf-h 43% TNF-. Lf-h LPS K-Lf-h B-Lf-h LPS TNF- Lf-h TNF- (Fig. 32-B). Lf-h, K-Lf-h TNF- B-Lf-h K-Lf-h (Fig. 32-C, 32-D). Lf-h TNF- K-Lf 75 %. Lf, TNF-. Lf Lf. 121

122 5.7. Lactoferrin RAW264.7 cell NO Lf Lf-h macrophage cell NO Fig. 33. Lf-h Fig. 33-A K-Lf-h NO B-Lf-h. LPS Lf NO IFN- IFN- LPS Lf (Fig. 33-B, 33-C). Lf Lf macrophage cell NO TNF- NO. Lfcin Human monocytic cell endotoxin IL-6 Mattsby-baltzer (1996) human polymorphonuclear leukocytes IL-8 (Shinoda, 1996) Lf-cin TNF- NO 122

123 A B Fig 32. TNF- production of RAW264.7 cells by peptic hydrolysate of Korean native cow's lactoferrin and peptic hydrolysate of commercial bovine lactoferrin A : RAW cells were incubated with peptic lactoferrin hydrolysate at 1mg/ml in DMEM with 10% FBS B : RAW cells were incubated with peptic lactoferrin hydrolysate at C D 1mg/ml with 1 /ml LPS C, D : RAW264.7 cells were incubated with different level of peptic lactoferrin hydrolysate(at 0 to 1000 /ml) TNF- production was expressed by growth inhibition of L929 cells Survival rates were measured by MTT assay in which supernatant of cultured RAW264.7 cells for 6hrs was applied to L929 cells 123

124 A Fig. 33. NO production of RAW264.7cells by peptic hydrolysate of Korean native cow's lactoferrin and peptic hydrolysate of commercial bovine lactoferrin A : RAW264.7 cells were incubated with peptic lactoferrin hydrolysate at 1mg/ml in DMEM with 10% FBS B C B, C : RAW264.7 cells were incubated with peptic hydrolysate of lactoferrins with stimulants Concentration of lactoferrin was 1mg/ml, respectively LPS : 100ng/ml, IFN- : 10unit/ml, LPS+IFN- : combination of equivalent amounts LPS and IFN- 124

125 6. Lf, Demian (1998) Lf. H-Lf, B-Lf, K-Lf human 8 in vitro 1 / 1 / 96hrs MTT Fig.34, 35, 36, 37, 38, 39, 40, %. Fig / K-Lf A427 71%, b-lf 53%, H-Lf 48%. Fig. 39 MCF-7 k-lf 62%, b-lf 50%, h-lf 38%. Fig. 37, Fig. 40 HepG2 Sk-Hep-1 K-Lf 1 / 50%, K-Lf 0.1 / 51%, 47% b-lf 1 / 38%, 42%, K-Lf b-lf, H-Lf. K-Lf b-lf, H-Lf. Furmanski(1994) Lf mechanism iron chelation, K-Lf b-lf, h-lf K-Lf b-lf, h-lf. 125

126 Fig. 34. Cytotoxicity of Lactoferrin on A427 Fig. 35. Cytotoxicity of Lactoferrin on A