( ) : : :,,,,,,,, 1 : : ( ) 2 : : ( ) 3 :, : - 2 -
|
|
- 효연 상
- 6 years ago
- Views:
Transcription
1 BSAG890M ( ) Research on lactoferrin from Korean native livestock and development of its utilization technique
2 ( ) : : :,,,,,,,, 1 : : ( ) 2 : : ( ) 3 :, : - 2 -
3 . ( )..,,,,., ( ) -. - (, lactoferricin)
4 cdna. 3. transformation transformants (, ). 1. ( ) - ( ) CM-Toyopearl 650 ion exchange AF-Heparin Toyopearl 650 ion enchange SDS-page, 80kD. - Circular dichroism(cd) spectra lactoferrin 2. - helix 24.5%, -structure 36%, - turn 13.5%, Unordered 26%. Fe 30.6% - E. coli0111, Minimal Inhibitory Concentration(MIC) 5mg/, MIC 0.1mg/, HPLC MIC 30 /. - (lactoferricin-kng) - 4 -
5 (YQWQRRMRKLGAPSIT). - - ( ) CM-Sephadex C-50 ion exchange Heparin-agarose. - 81,000Da 0.56mg/g 40.6%. pi 9 (K-Lf) (B-Lf) H-Lf. - E. coli O111 (B-Lf) (K-Lf), B-Lf-h( ) K-Lf-h( ). MIC E. coli O111 B-Lf 1.5mg/ml, K-Lf 2.75mg/ml B-Lf-h 0.125mg/ml, K-Lf-h 0.25mg/ml B-Lf-h. Lf lysozyme. - K-Lf K-Lf RAW264.7 cell TNF-, LPS TNF-. - K-Lf TNF- NO. - K-Lf-h Lf TNF- NO
6 Total RNA Le Provost primer RT-PCR cdna 2.4kb. Genbank Data Library accession number U Total RNA BM TitanTM one tube RT-PCR kit cdna template cdna Aspergillus niger cloning, 3 (psgt, psnt, psct) - A. niger (150 colonies) - Southern blot (9/150) - Northern blot (1/9) - A. oryzae cloning pblf - A. oryzae (30 colonies) - PCR, ( 130/150, 10/30) % - 6 -
7 . -. (, ) - KLFC Salmonella typhimurium KLFC. -.,.,,
8 SUMMARY The present study aims at identifying lactoferrin from milk of Korean native livestock, cow and black goat, in the level of molecule, and developing mass production system by genetic engineering. Application techniques have been studied to extend its usage. The results are as follows. 1. Purification of lactoferrin proteins from milk of Korean native cow and its characterization. The molecular weight of the purified Korean native cow lactoferrin(k-lf) was 81kDa, and the content of iron was 0.56mg/g indicating 40.6% of iron saturation. The isoelectric point was 9. Bovine lactoferrin(b-lf) showed a higher antibacterial activity level than that of K-Lf. The Minimal Inhibitory concentration(mic) of B-Lf was 1.5mg/ml and the MIC of B-Lf was 1.6mg/ml in E. coli The same result was also observed between B-Lf-h(hydrolysate)(0.125mg/ml) and K-Lf-h(0.25mg/ml) Even though K-Lf increased the production of TNF- in RAW264.7 cells with dose-dependency, it didn't affect on the production of TNF- in LPS-stimulated RAW264.7 cells. K-Lf induced the production of NO similar to its role on the TNF- production. Despite K-Lf-h has higher level of antibacterial activity comparing to Lf, it seems that Lf-h didn't significantly affect the production of TNF- and NO in RAW264.7 cells. 2. Purification of lactoferrin proteins from milk of Korean native goat and its characterization. Lactoferrin, 80kD, was purified from colostrum of Korean native goat by CM-Toyopearl 650 ion exchange and AF-Heparin Toyopearl 650 ion exchange. -helix was 24.5%, -structure was 36%, -turn was 13.5% and unordered - 8 -
9 form was 26% in KN goat lactoferrin. MIC against E.Coli was 5 / in KN goat lactoferrin, 0.1 / in pepsin hydrolysate of KN goat lactoferrin and 30 / in KN goat lactoferrin peptide derived by HPLC from pepsin hydrolysate. Lactoferricin amino acid sequence was identified as YQWQRRMRKLGAPSIT. 3. Clonning of KN cow lactoferrin gene and development of mass production system in yeast. Lactoferrin gene was clonned by RT PCR using KN cow testis RNA and primer set derived from already reported bovine lacroferrin cdna as a template. Its sequence was very similar to bovine lactoferrin sequence reported already by showing 97% homology. Its pepide sequence corresponding to lactoferricin region was ligated into pichia pastori expression vector ppic9 and recombinant peptide was produced in yeast transformants by inducing with alcohol. Transformant SLK-6 was verified to show strong anti-microbial activity against various pathogenic microorganism. 4. Clonning of KN goat lactoferrin gene and development of mass production system in fungus. Lactoferrin was clonned by RT-PCR using KN goat mammary gland RNA and primer set derived from the reported goat lactoferrin cdna sequence as a template. The nucleotide sequence of the lactoferrin gene of KN goat was found to differ in 15 sites from that of the goat lactoferrin reported earlier. The antibacterial activity of KN goat lactoferrin was found to be greater than that of Sannen goat. Lactoferrin cdna was ligated into Fungus expression vector containing -amylase promoter and signal peptide sequence, and KN goat lactoferrin expressing transformants were obtained. 5. Application study of lactoferrin - 9 -
10 Lactoferrin has exhibited various biological function. Anticancer activity of lactoferrin was tested in transgenic mice exhibiting hepatocellular carcinoma by feeding waters containing lactoferrin for 8 months. However, any significant results were not obtained in the experiment. Rat liver treated with lactoferrin for 2 weeks exhibited significant anti-inflammation effect when injected by CCL4 compared to control rat liver. KN cow recombinant lactoferrin peptide addition was also significant in growth inhibit of Salmonella typhimurium
11 CONTENTS Abstract Summary Contents(English) Introduction Purification of lactoferrin from Korean native livestock milk and study of its biological function Lactoferrin gene clonning of Korean native livestock and determination of its primary sequence Studies on production of recombinant lactoferrin Studies on application of lactoferrin Reference
12 ( )
13 Carlsberg Brewery Soren Peter Lauritz Sorensen Margarethe Sorensen (Sorensen 1939).,,,, secondary granules.,,,,....,..,
14 (Lf) Lf, Lf,, macrophage TNF- NO, Lf cytokine. 2. Lf,,, Chromatography Lf ( ) 2. HPLC lactoferin ( ) 3 1. Lf ( ) 4 1. ( )
15 1. RAW264.7 cell macrophage ( ) 2. ( ) 3. Lf Cytokine ( ) 4. Lf ( ) 6 * (Nam MS,1998) 1. 5kg. ( / ). 2.. whey protein 3 (3,000 rpm, 20 ) ph 4.6 casein Whey( ). whey protein 50g.. CM-Toyopearl 650 ion exchange CM-Toyopearl 650 ion exchange resin column starting buffer 0.005M sodium phosphate buffer(ph 6.0) whey protein starting buffer column. Starting buffer column 0.1M NaCl 0.005M sodium phosphate buffer elution 0.3M NaCl 0.005M sodium phosphate buffer elution 0.5M NaCl 0.005M sodium phosphate elution peak band 0.5M NaCl elution crude Lf.. AF-Heparin Toyopearl 650 ion enchange
16 Lf AF-Heparin Toyopearl column 0.1M Nacl, 0.3M Nacl, 0.5 M Nacl step elution Goat Lf SDS-PAGE Lf SDS-PAGE. Fig. 1 CM-Toyopearl 650 Chromatography profile 3 peak. 0.5M Nacl peak Lf peak Fig. 2. Fig. 3 Fig M Nacl fraction(82 94 ) AF-Heparin Toyopearl 650 Chromatography profile, Fig. 4 AF-Heparin Toyopearl 650 Chromatography 0.5M Nacl peak, band Lf. Fig. 5 bovine lactoferrin Western blotting sannen goat bovine lactoferrin
17 Fig. 1. Fractionation of Korean Native goat whey protein on CM-Toyopearl 650M chromatography. Whey protein dissolved in 0.005M sodium phosphate buffer(ph 6.0) was applied to the column. The column was washed with the same buffer and then eluted with a step gradient of NaCl as indicated. The flow rate was 20ml/hr and detection was performed by UV absorbance measurement at 280mm
18 Fig. 2. Profiles of SDS-PAGE of fractions from CM-Toyopearl 650M chromatography. 1. MW Standard marker proteins ; 2. KN goat whey protein ; 3. Unbounded whey protein ; 4. Fraction No. 20 ; 5. Fraction No. 62 ; 6. Fraction No. 68 ; 7. Fraction No. 86 ; 8. Fraction No. 88 ; 9. Fraction No
19 Fig. 3. Profile on AF-Heparin Toyopearl 650M chromatography of peak 3 fraction from CM-Toyopearl chromatography. Lactoferrin-enriched fractions dissolved against 0.005M sodium phosphate buffer(ph 6.0) was applied to the column. The column was washed with the same buffer and then eluted with a step gradient of NaCl as indicated. The flow rate was 20ml/hr and detection was performed by UV absorbance measurement at 280nm. Fig. 4. Profiles of SDS-PAGE after AF-Heparin 650M chromatography. 1. MW Standard marker protein ; 2. Fraction No. 35 ; 3. Fraction No. 36 ; 4. Fraction No. 37 ; KNG LF ; Korean Native goat lactoferrin
20 Fig. 5. Western blotting comparison of the KN goat lactoferrin, goat(saanen) lactoferrin and bovine lactoferrin. KNG ; Korean Native goat. 1. MW Standard marker protein(pre-stained marker, Bio-Rad) ; 2. KN goat lactoferrin ; 3. Goat(Saanen) lactoferrin ; 4. Bovine lactoferrin
21 7 Circular dichroism(cd) spectra lactoferrin 2. Fig. 6 CD Spectra nm, -helix 24.5%, Saanen 15% -structure 36%, Saanen 40% Saanen. -turn 13.5%, Saanen 12%. Unordered 26%, Saanen 33% Saanen. Fig nm Saanen, Tyrosine, Phenylalanine. Fig Fe 30.6% Saanen 36%. Fig.6. CD Spectra nm
22 Fig.7. CD Spectra nm Fig.8. CD Spectra nm
23 1. E. coli Tomita (1991), 1% bactopeptone / E. coli incubator E. coli., 1 (Saanen) 7.5 /, 5 /. 1. E. coli (mg/ml ) (Saanen) : positive - : negative N HCl PH / pig pepsin 37 4, N NaOH PH. Reverse-phase HPLC fraction, fraction E coli 0111,
24 9. HPLC E. coli 0111, 280 / MIC. 2. peptide E.coli O111 peptide N,, 23mer Fmoc TSK gel ODS-prep HPLC E.coli O111. peptide Sequence : CYQWQRRMRKLGAPSITCIRRTS
25 : / 30 / 35 / 40 / 45 / 50 / KNgLf peptide : positive antibacterial activity - : negative antibacterial activity
26 Sequencing( ) 3 1. cdna (Schanbacher, F.L. et al., J Dairy Sci 76, , 1993). cdna, (involution), (Chirgwin et al., Biochem., 18, 5294, 1979) RNA. 1 RNA 75mM KCl, 1mM dithiothreitol, 3mM MgCl2, 0.5mM each of dntp, 100pM hexanucleotide primer (Promega), 10 U AMV reverse transcriptase (Promega) 50mM Tris, ph ul 42'C, 2 cdna. cdna 3ul 1mM MgCl2, 100pM , 200 M each of dntp, 2 U vent DNA polymerase (New England Biolabs)
27 10mM Tris, ph 8.4, 94 5, 94 1, 56 1, , PCR 10 1% (Fig.10). Fig 10. Amplification of lactoferrin gene fragments in mammary gland tissues. lanes : 1, pbr322/bstni digest ; 2, negative control ; 3, 5` region of goat lactoferrin ; 4, 3` region of goat lactoferrin ; 5, pbr322/bstni digest primer ( le Provost et al. ),. primer 1; 5'-GACCC CAGAC ATGAA GCTC-3' (64-83 ) primer 2; 5'-CCTCC GCGGT TTCCC TGAGG TT-3' ( ) primer 3; 5'-AAACC GCGGA GGAGT TGAAG-3' ( ) primer 4; 5'-AGGGA ATGAA AATCA ACAGC A-3' ( ) PCR DNA dideoxy nucleotide chain termination procedure (Sanger et al., Proc. Natl. Acad. Sci. USA, 74, 5463, 1977)
28 Sequencing Version 2.0 DNA sequencing Kit (US Biochemical) DNA ( 11). 11 cdna, cdna,. ( Saanen ) (Le Provost, 1994) 99%, 98%. 6, 15 ( 3). Genbank Data Library accession number U CCCCAGAC 9 ATG AAG CTC TTC GTC CCC GCC CTG CTG TCC CTT GGA GCC CTT GGA CTG TGT CTG Met Lys Leu Phe Val Pro Ala Leu Leu Ser Leu Gly Ala Leu Gly Leu Cys Leu 63 GCT GCC CCG AGG AAA AAC GTT CGA TCG GTG TGC ATC TCA CTG CCG GAG TGG TCC Ala Ala Pro Arg Lys Asn Val Arg Ser Val Cys Ile Ser Leu Pro Glu Trp Ser 117 AAA TGC TAC CAA TGG CAG AGG AGG ATG AGG AAG CTG GGT GCT CCC TCT ATC ACC Lys Cys Tyr Gln Trp Gln Arg Arg Met Arg Lys Leu Gly Ala Pro Ser Ile Thr G G 171 TGT ATA AGG AGG ACC TCT GCC TTG GAA TGT ATC CGG GCC ATC GCG GGA AAA AAT Cys Ile Arg Arg Thr Ser Ala Leu Glu Cys Ile Arg Ala Ile Ala Gly Lys Asn Val G 225 GCG GAT GCT GTG ACC CTG GAT AGT GGC ATG GTG TTT GAG GCG GGC CTG GAC CCC Ala Asp Ala Val Thr Leu Asp Ser Gly Met Val Phe Glu Ala Gly Leu Asp Pro Arg 279 TAC AAA CTG CGG CCA GTA GCG GCA GAG ATC TAT GGG ACA GAA AAA TCT CCC CAA Tyr Lys Leu Arg Pro Val Ala Ala Glu Ile Tyr Gly Thr Glu Lys Ser Pro Gln A 333 ACC CAC TAT TAT GCT GTG GCC GTC GTG AAG AAG GGC AGC AAC TTT CAG CTG GAC Thr His Tyr Tyr Ala Val Ala Val Val Lys Lys Gly Ser Asn Phe Gln Leu Asp Lys T 387 CAG CTG CAA GGC CAG AAG TCC TGC CAC ATG GGC CTT GGC AGG TCC GCT GGG TGG Gln Leu Gln Gly Gln Lys Ser Cys His Met Gly Leu Gly Arg Ser Ala Gly Trp CC 441 AAC ATC CCT GTG GGA ATC CTT CGC CCG TTC TTG AGC TGG ACA GAG TCG GCC GAG Asn Ile Pro Val Gly Ile Leu Arg Pro Phe Leu Ser Trp Thr Glu Ser Ala Glu Pro 495 CCC CTC CAG GGA GCT GTG GCT AGA TTC TTC TCT GCC AGC TGT GTT CCC TGC GTT Pro Leu Gln Gly Ala Val Ala Arg Phe Phe Ser Ala Ser Cys Val Pro Cys Val 549 GAT GGA AAA GCG TAC CCC AAC CTG TGT CAA CTG TGC AAG GGG GTG GGA GAG AAC Asp Gly Lys Ala Tyr Pro Asn Leu Cys Gln Leu Cys Lys Gly Val Gly Glu Asn 603 AAG TGT GCC TGC TCC TCC CAG GAA CCA TAC TTT GGT TAT TCT GGT GCC TTC AAG Lys Cys Ala Cys Ser Ser Gln Glu Pro Tyr Phe Gly Tyr Ser Gly Ala Phe Lys 657 TGC CTG CAG GAC GGG GCT GGA GAC GTG GCT TTT GTC AAG GAG ACG ACA GTG TTT Cys Leu Gln Asp Gly Ala Gly Asp Val Ala Phe Val Lys Glu Thr Thr Val Phe 711 GAG AAC TTG CCA GAG AAG GCT GAC AGG GAC CAG TAT GAG CTT CTC TGC CTA AAC Glu Asn Leu Pro Glu Lys Ala Asp Arg Asp Gln Tyr Glu Leu Leu Cys Leu Asn
29 765 AAC ACT CGG GCG CCA GTG GAT GCA TTC AAG GAG TGC CAC CTG GCC CAG GTC CCT Asn Thr Arg Ala Pro Val Asp Ala Phe Lys Glu Cys His Leu Ala Gln Val Pro 819 TCT CAT GCT GTT GTG GCC CGC AGT GTG GAT GGC AAG GAG AAC TTG ATC TGG GAG Ser His Ala Val Val Ala Arg Ser Val Asp Gly Lys Glu Asn Leu Ile Trp Glu C 873 CTT CTC AGG AAG GCA CAG GAG AAG TTT GGA AAA AAC AAG TCT CAG AGC TTC CAG Leu Leu Arg Lys Ala Gln Glu Lys Phe Gly Lys Asn Lys Ser Gln Ser Phe Gln Arg 927 CTC TTT GGC TCT CCA GAA GGC CGG AGG GAC CTG CTA TTC AAA GAC TCT GCC CTT Leu Phe Gly Ser Pro Glu Gly Arg Arg Asp Leu Leu Phe Lys Asp Ser Ala Leu 981 GGG TTT GTG AGG ATC CCC TCA AAA GTA GAT TCG GCG CTG TAC CTG GGC TCC CGT Gly Phe Val Arg Ile Pro Ser Lys Val Asp Ser Ala Leu Tyr Leu Gly Ser Arg 1035 TAC TTG ACC GCC TTG AAG AAC CTC AGG GAA ACC GCG GAG GAG TTG AAG GCG CGG Tyr Leu Thr Ala Leu Lys Asn Leu Arg Glu Thr Ala Glu Glu Leu Lys Ala Ala 1089 TGC ACG CGG GTC GTG TGG TGC GCG GTG GGA CCC GAG GAG CAG AGT AAG TGC CAG Cys Thr Arg Val Val Trp Cys Ala Val Gly Pro Glu Glu Gln Ser Lys Cys Gln 1143 CAG TGG AGC GAG CAG AGC GGC CAG AAC GTG ACC TGT GCC ACG GCC TCC ACC ACC Gln Trp Ser Glu Gln Ser Gly Gln Asn Val Thr Cys Ala Thr Ala Ser Thr Thr G 1197 GAC GAC TGC ATC GCC CTG GTG CTG AAA GGG GAA GCG GAC GCC CTG AGC TTG GAT Asp Asp Cys Ile Ala Leu Val Leu Lys Gly Glu Ala Asp Ala Leu Ser Leu Asp Gly 1251 GGA GGA TAT ATC TAC ACT GCC GGC AAG TGC GGC CTG GTG CCT GTC ATG GCA GAG Gly Gly Tyr Ile Tyr Thr Ala Gly Lys Cys Gly Leu Val Pro Val Met Ala Glu 1305 AAC CGG AAA TCC TCC AAA TAC AGT AGC CTA GAT TGT GTG CTG AGA CCA ACG GAA Asn Arg Lys Ser Ser Lys Tyr Ser Ser Leu Asp Cys Val Leu Arg Pro Thr Glu 1359 GGG TAC CTT GCC GTG GCA GTT GTC AAG AAA GCA AAT GAG GGG CTC ACT TGG AAT Gly Tyr Leu Ala Val Ala Val Val Lys Lys Ala Asn Glu Gly Leu Thr Trp Asn 1413 TCT CTG AAA GGC AAG AAG TCG TGC CAC ACC GCC GTG GAC AGG ACT GCA GGC TGG Ser Leu Lys Gly Lys Lys Ser Cys His Thr Ala Val Asp Arg Thr Ala Gly Trp 1467 AAC ATC CCC ATG GGC CTG ATC GCC AAC CAG ACA GGC TCC TGC GCA TTT GAT GAA Asn Ile Pro Met Gly Leu Ile Ala Asn Gln Thr Gly Ser Cys Ala Phe Asp Glu 1521 TTC TTT AGT CAG AGC TGT GCC CCT GGG GCC GAC CCG AAA TCC AGC CTC TGT GCA Phe Phe Ser Gln Ser Cys Ala Pro Gly Ala Asp Pro Lys Ser Ser Leu Cys Ala 1575 TTG TGT GCC GGC GAT GAC CAG GGC CTG GAC AAG TGT GTG CCC AAC TCT AAG GAG Leu Cys Ala Gly Asp Asp Gln Gly Leu Asp Lys Cys Val Pro Asn Ser Lys Glu 1629 AAG TAC TAT GGC TAC ACC GGG GCT TTC AGG TGC CTG GCT GAG GAC GTT GGG GAC Lys Tyr Tyr Gly Tyr Thr Gly Ala Phe Arg Cys Leu Ala Glu Asp Val Gly Asp A 1683 GTT GCA TTT GTG AAA AAC GAC ACA GTC TGG GAG AAC ACG AAT GGA GAG AGC TCT Val Ala Phe Val Lys Asn Asp Thr Val Trp Glu Asn Thr Asn Gly Glu Ser Ser 1737 GCA GAC TGG GCT AAG AAC TTG AAT CGC GAG GAC TTC AGG CTG CTC TGC CTC GAT Ala Asp Trp Ala Lys Asn Leu Asn Arg Glu Asp Phe Arg Leu Leu Cys Leu Asp 1791 GGC ACC ACG AAG CCT GTG ACG GAG GCT CAG AGC TGC TAC CTG GCG GTG GCC CCG Gly Thr Thr Lys Pro Val Thr Glu Ala Gln Ser Cys Tyr Leu Ala Val Ala Pro 1845 AAT CAC GCT GTG GTG TCT CGG AGC GAT AGG GCA GCG CAC GTG GAA CAG GTG CTG Asn His Ala Val Val Ser Arg Ser Asp Arg Ala Ala His Val Glu Gln Val Leu T 1899 CTC CAC CAG CAG GCT CTG TTC GGG AAA AAT GGA AAA AAC TGC CCG GAC CAG TTT Leu His Gln Gln Ala Leu Phe Gly Lys Asn Gly Lys Asn Cys Pro Asp Gln Phe 1953 TGT TTG TTC AAA TCT GAA ACC AAA AAC CTT CTG TTC AAT GAC AAC ACT GAG TGT Cys Leu Phe Lys Ser Glu Thr Lys Asn Leu Leu Phe Asn Asp Asn Thr Glu Cys 2107 CTG GCC AAA CTT GGA GGC AGA CCA ACG TAT GAA AAA TAT TTG GGG ACA GAG TAT Leu Ala Lys Leu Gly Gly Arg Pro Thr Tyr Glu Lys Tyr Leu Gly Thr Glu Tyr 2161 GTC ACG GCC ATT GCC AAC CTG AAA AAA TGC TCA ACC TCC CCG CTT CTG GAA GCC Val Thr Ala Ile Ala Asn Leu Lys Lys Cys Ser Thr Ser Pro Leu Leu Glu Ala 2215 TGC GCC TTC CTG ACG AGG TAA AGC CTG CAA AGA AGC TAG CCT GCC TCC CCG GGC Cys Ala Phe Leu Thr Arg *** *** G GA 2269 CTC AGC TCC TCC CTG CTC TCA GCC CCA GTC TTC AGA CGC GAG GAC CCT TCC TCT CCC TTC CTG AAG TCG GAT TTT TGC CAA GCT CAT CAG TAT TCA CAA TTC CCT GCT T 2377 GTC ATC TTA GCA AGA AAT AAA ATT AGA AAT GCT GTT GAT TTT CAT TCC CT 3'
30 cdna cdna Le Provost, sequence Le Provost. 3. Nucleotice Goat KN goat (Amino acid) (le Provost et. al. 1994) (our results) 174; ; (56) (88) (124) (130) (154) (304) (414) (571) (637) GTG(Val) CGG(Arg) AAG(Lys) GGT(Gly) CCC(Pro) CGC(Arg) GGT(Gly) ACA(Thr) TTT(Phe) G G A T ATA(Ile) CTG(Leu) CAG(Gln) GGC(Gly) TTC(Phe) AGC(S er) GAT(Asp) ACG(Thr) TTC(Phe) A A C A flanking
31 5 flanking genomic DNA Seyfert et al(1994) bovine lactoferrin 5' flanking sequence template 2 primer PCR, 1kb PCR product, pgem-t vector clone sequence 13. Seyfert 91.4%. primer sequence PCR. primers forward primer ; 5' -GCTGCAATGGAAGCGCCAGG-3' Reverse primer ; 5' GGAAGCAAGGCCTCAGCG-3' PCR 94 5min 94 1min, 60 1min 30sec, 72 2min (30cycles) 72 7min -1021BOP GATCTTAGTTCCCCCAAATGGGTCTGAACCTACACATGCTGCAATGGAAGCGCCAGGGAA ::::::::::::::::: ::::: KNG GCTGCAATGGAAGCGCCCGGGAA -961 BOP GTCCT-CCCCCACCCCTTGGGGGACACTTAGTTTGCTTGCAATCAGTGAACGATAAGCAG ::::: ::::::::::::: ::::: :::::::: :::::::::::::: ::::::::: KNG GTCCTGCCCCCACCCCTTGATGGACATTTAGTTTGTTTGCAATCAGTGAATGATAAGCAG -901 BOP GGCTGCACTGGAGACCCCTGCGTGGGAGTTGTTGTGCTTCAAGGGAGTGTCTT-CAAGGA ::::::::::::::::::::::::::::: ::::::::::::::::::: :: : :::: KNG GGCTGCACTGGAGACCCCTGCGTGGGAGTCATTGTGCTTCAAGGGAGTGTATTTCGAGGA -841 BOP TGCAGAGCAGAGTTCTAGCTT-AGAACTGAAAACCAGCCTCCTGAAACAGGGTCAGCCTG ::::::::::: ::::::: :::: ::::::::::: ::::::::::::::::::::: KNG TGCAGAGCAGA---CTAGCTTTAGAATTGAAAACCAGCTTCCTGAAACAGGGTCAGCCTG -781 BOP TGTACTGAGGACAAAATAGGACATTTATCAAAATGAGGTTCCTGTCTCCCACCTCATATT ::::::::::::::::::::::::::::::::::::::::::: :::::::::::::::: KNG TGTACTGAGGACAAAATAGGACATTTATCAAAATGAGGTTCCTATCTCCCACCTCATATT -721 BOP GCCACAAAACAACACAAGGGGTAGGATATCCTTTTCATTGGCAAATGAGGGACCAGGAGA :::::::::::: ::::: :::::::::::::::::::::::::::::::::::::::: KNG GCCACAAAACAAAACAAGTGGTAGGATATCCTTTTCATTGGCAAATGAGGGACCAGGAG BOP CAGCCTTTGGGCACTTAGGCCTCTGGTTCTGTTTTCTGGGAGCTGTATTTCGGTCTCAGG :::::::::::::::::::::::::::::::::::::::::::::::: ::::::::: KNG -AGCCTTTGGGCACTTAGGCCTCTGGTTCTGTTTTCTGGGAGCTGTATTA-GGTCTCAGG -601 BOP AGGACTCCAGGGGCAGTCTGGGTCAGACTCTGGGCAGC CTCTGCCAGCTGGAC
32 ::: : :::: ::::::::::::::::::::::::::: ::::::::: ::::: KNG AGGGCCCCAGAGGCAGTCTGGGTCAGACTCTGGGCAGCATATTGCCTCTGCCAGTTGGAC -541 BOP CAGGCTGCCGTGGACCCCGGGCCAGGCAGCGGGCCCTCTTTCAAAACTCCAGGCTGGCT- :: ::::: :::::::::::::::::::::::: : ::::::::::::::::::::::: KNG CAAGCTGCTGTGGACCCCGGGCCAGGCAGCGGGTCTTCTTTCAAAACTCCAGGCTGGCTG -481 BOP CTGCGTGCAGATGCAAGGGTCTCCGTCTGTCTTAACTGGTTCCCAAGCACTTTAGATACC ::::::::::: :::::: :::::::::: :: ::::: ::::::::::::::::::::: KNG CTGCGTGCAGACGCAAGGATCTCCGTCTGCCTCAACTGTTTCCCAAGCACTTTAGATACC -421 BOP TTCTCTATAGTCAAGCTGATCCGCAAAGATTCACCCTAGGACCCCTGCTCTGGATCCCGC ::: :: ::::::::::::::::::::::::::: ::::::::::::::: : : ::: KNG ATCTGTACAGTCAAGCTGATCCGCAAAGATTCACCTTAGGACCCCTGCTCTAGGTGCCGA -361 BOP TCTCTAGGAGGCACTGAGACCGGAGCGGGGACAAAACCCAGGGACTGCCACTCCCGAAGG :::: :: ::::::::::::: ::: ::::::::::: ::::::::::::::::::: :: KNG TCTCCAGAAGGCACTGAGACCAGAGAGGGGACAAAACTCAGGGACTGCCACTCCCGA-GG -301 BOP GCTGCGGACAAGTGGGAAAGAAAGAGCACCCCCCAACTAGGCAGCGCTGGGGA-ACTTGA :::::::::::::::::: ::::::::: ::::::::::::::::::::::: :::::: KNG GCTGCGGACAAGTGGGAAGGAAAGAGCATCCCCCAACTAGGCAGCGCTGGGGGGACTTGA -241 BOP GAGGTGGGTGTGGGTTGGGTATCCTCTCCCCGAGCGCCAAGCCCCGCCCGGGCACCTTTC :::::::::::::::::::::::::::::: ::::::::: : :::::::::::::::: KNG GAGGTGGGTGTGGGTTGGGTATCCTCTCCC-GAGCGCCAA--CGCGCCCGGGCACCTTTC -181 BOP TCGCTCCCTCGGTCTCCACCCCCGCTCTTCCCCCTTCCCCCCGGTTTTCCCCCTCTAGGA ::::::::: ::::: ::::: : :: :::::::::::: : : :::::: ::::::: KNG CTGCTCCCTCGTTCTCCGCCCCCAC-CTCCCCCCTTCCCCCAGTTCTTCCCC-TCTAGGA -121 BOP ACCAGCAGACCTCGGGAGAGGGGAGGAGGGAGGC-TGGGGCGCTTATAGGACCACAGGGC :: ::::::::::::::: :::::::::::::: ::::::::::::::::::::::::: KNG ACTAGCAGACCTCGGGAGGAGGGAGGAGGGAGGCCTGGGGCGCTTATAGGACCACAGGGC -60 BOP GGGGCAAACCTCGTGAGGTCACCGAGCACTGGCTAAAGGGACGCAGAACGAGCGCAGGTG :::::::::::::::::: ::::::::::::: ::::::::::::::::::: ::::::: KNG GGGGCAAACCTCGTGAGGCCACCGAGCACTGGATAAAGGGACGCAGAACGAGGGCAGGTG +1 BOP GCAGAGCCTTCGTTCCGGAGTCGCCCCAGGACGCCAGCCATGAAGCTCTTCGTCCCCGCC ::::::::::::::::::::::: KNG -CAGAGCCTTCGTTCCGGAGTCGC BOP CTGCTGTCCCTCGGAGCCCTTGGTGAGTGCAGGTATGAGTGGGGGCGGGGCATGC KNG flanking (KNG) Seyfert (1994) 5' flanking (BOP)
33 4 Northern blot 14.,,. Fig 14. Northern blot hybridization of total RNA isolated from tissues of mammary gland. Total RNAs were transferred to a nylon membrane, and then hybridized with the 32P labeled lactoferrin probe (A) and rehybridized with -actin probe as the control for RNA loading (B). Lanes : V, virgin mammary gland; P, pregnancy mammary gland; L, lactation mammary gland; I, involution mammary gland
34 5 1 ( )... proteinase.,. awamori, strain ( ) 3 1. Korean native goat lactoferrin(knglf). Promoter inducing promoter Aspergillus oryze -amylase promoter signal sequence A. oryze -amylase terminator glucose
35 oxidase pagt. TATA box inverted repeat sequence promoter 99bp 327bp enhancer 1copy 2copy pagt promoter ligation paegt17 paegt16. selection, pan7-1 transformation. Fig. 15. Fig. 15 Map of selection vector, pan7-1 and expression vectors, pagt, paegt17 and paegt transformant 2-1. Protoplast (NRRL3) Northern Regional Research Laboratories. CM-plate(2% glucose, 2% malt extract, 0.1% peptone, 1.5% agar) A. niger 10ml 0.01% Tween ml CD(Czapeck's dox) / 0.025%(W/V) casamino acid rpm
36 Myracloth filter filtering. 200ml MP-buffer I(0.6M MgSO4.7H2O, 10mM potassium phosphate(ph5.8, 100mM KH2PO4, 100mM K2HPO4.3H2O)). 1g 5ml MP-buffer II(1.5M MgSO4. 7H2O, 10mM potassium phosphate (ph5.8)). 1g 20mg Novozyme 15,000unit -glucuronidase rpm ml cortexglass ST-buffer I(0.6M Sorbitol, 0.1M Tris.Cl, ph7.5). 6,000rpm protoplast tube 10ml ST-buffer II(1M Sorbitol, 10mM Tris.Cl, ph7.5) 4,000rpm. 10ml STC-buffer (1M Sorbitol, 10mM Tris.Cl ph7.5, 50mM CaCl2) 4,000rpm pellet STC-buffer protoplast protoplast /200 STC buffer Transformation 200 protoplast selection vector, pan7-1 expression vector pagt, paegt17, paegt PTC-buffer(60% Polyethylenglycol 6,000, 10mM Tris.Cl(pH7.5), 50mM CaCl2) PTC-buffer 20. microcentrifuge 5. Pellet 1ml STC-buffer 200 3ml top agar selection plate(cd-media + 1M sucrose /ml Hygromycin B) colony CM-hygromycin B plate 3 pagt, paegt17, paegt16 28, 38, 42 colony Transformant Southern blot analysis
37 Transformation colony 50ml CD 2 genomic DNA. -70 pre-cooling. Lysis buffer(0.5% SDS, 50mM EDTA) 30 phenol : chloroform : isoamylalcohol(25:24:1). ethanol TE buffer pellet RNase RNA. genomic DNA Southern blot analysis. Transformation 106 colony Southern blot. PCR DNA copy detection multicopy Southern blot. Southern blot DIG probe PCR DIG probe synthesis kit(bm ). Template pagt vector promoter 510bp signal sequence 70bp N- 100bp 680bp probe(fig 16). Fig. 16 Map of probe genomic DNA 40 EcoRI. 1% agarose gel loading 80volt 4 ethidium bromide(etbr) polaroid. Nitrocellulose membrane DNA transfer gel 0.5N NaOH, 1.5 M NaCl denaturation 1M
38 Tris Cl(pH8), 1.5M NaCl neutralization. pyrex dish transfer buffer(10x SSC) 3MM paper bridge gel gel membrane transfer buffer gel. gel 1cm 3MM paper buffer. paper towel 500g capillary transfer DNA membrane transfer 5X SSC washing. UV(254nm) 2 cross-linking. Membrane 42 2 prehybridization (hybridization ; 2% Blocking reagent, 0.1% N-lauroylsarcosine, 0.2% SDS, 50% formamide) boiling probe 16 hybridization. washing solution I(2X SSC, 0.1% SDS) II(0.5X SSC, 0.1% SDS) membrane washing. Membrane washing buffer(3% Tween 20 in Maleic acid buffer; 100mM maleic acid, 150mM NaCl, ph 7) 1 equilibration blocking solution(1% blocking reagent in maleic acid buffer) 1 blocking. membrane blocking buffer 5,000 anti-dig-alkaline phosphatase 1 washing buffer 15 2 washing. Detection buffer(45 NBT and 35 X-phosphate solution in 10ml detection buffer. Detection buffer; 100mM Tris Cl, 100mM NaCl ph9.5) 2 equilibration color substrate. Fig. 17 probe vector hybridization band
39 Fig. 17 Analysis of vectors for Southern blot Southern blot analysis pagt clone 10, paegt17 11 paegt Kb, 2.3Kb, 2.5Kb band. Fig. 4 Southern blot transformant. Positive Fig. 18 panel A transformant 12-O 47, panel B 11 20, 40, 47 panel C 11 15, 29, copy
40 Fig. 18 Southern blot analysis of Transformants Panel A, Transformants of pagt; panel B, Transformants of paegt17; panel C, Transformants of paegt16 (3) Southern blot clone transcription Northern blot analysis. RNA CD(Czapek' dox) 37 2 SY (5% starch, 2% yeast extract, 0.2% tryptone, 0.1% MgSO4, 0.1% K2HPO4, 0.05% KCl, 0.001% FeSO4, 1.5% CaCO3, ph 5.5) mg Trizol(Gibco ) 1ml. 5 Trizol 1ml 0.2ml chloroform ,000xg, 4 15 tube. 0.5ml isoprophanol 10 12,000xg, % 1ml vortex 7,500xg, 4 5 pellet. RNase RNA. RNA 20 DEPC-water sample buffer(65% formamide, 8.1% formaldehyde, 1.3X MOPS) loading dye 1% agarose gel loading. 80 volt 4 EtBr Southern blot transfer. Hybridization 5X SSC 2% blocking solution, 0.1% N-lauroylsarcosine, 0.2% SDS, 50% formamide. Probe 2.1kb LF cdna 32P-dCTP labeling
41 hybridization washing solution I(2x SSC, 0.1% SDS), II(1x SSC, 0.1% SDS) membrane washing X-ray film 24. Northern blot total RNA transformant pagt12-o mrna. vector clone, pagt47, paegt17-11, paegt kb band (Fig 19). Northern blot analysis copy genomic DNA integration DNA mrna transcription Fig. 19 Northern blot analysis of transformants Panel A is Northern blot and panel B is total RNA. 1, NRRL3 (control); 2, pagt12-o; 3, pagt18; 4, pagt19; 5, pagt20; 6, pagt-12-n; 7, pagt47; 8, paegt17-11; 9, paegt Western blot
42 E. coli O111 test. 50ml NRRL3, pagt-12-o, pagt-12-n, pagt-47, paegt17-11, paegt /ml rpm 100ml SY 30, 200rpm ml ph E. coli O111 test. test E. coli O111 survival rate(%). 1% peptone 100 SY 200 1X105 /ml E. coli O E. coli O111 (595nm) 100% sample. Fig pagt-12-o, pagt-12-n, pagt-47, paegt17-11, paegt17-40 E. coli O111 survival rate 60% 140 E. coli survival rate 10 20%. ph 4 survival rate protein ph 4, 90,. survival rate. SY ph 4, 30, 200rpm 90. Fig. 20. Survival Rate of Transformants against E. coli O111 and ph
43 6 1.,. (SK-1) : 1994 Furumanski solid tumor, Tsuda 1997 colon cancer. Hepatitis B virus X (HBx ) lactoferrin. 2. : - : HBx (8 ) 7 ( 3 ) - : HBx (8 ) 7 ( 3 ) C57BL/6 (8 ) - : bovine lactoferrin 2 g/ liter( )
44 - : : HBx 6 displastic nodule 1 85% ,., HBx. 10 4,.,3 C57BL/6,. HBx 7 nodule 8 1 mm 4 mm % : (CCl4) 2. : 1) : 8 Sprague-Dawly %
45 1 ml/kg (1 3 ) 0.5 ml/kg (2 4 ) 24. 2) :, 14, 15 GOT, GPT, TG, AKP automatic chemical analyzer (Ciba-Corning, Express 550). 3) : 10%. 3 4 Hematoxylin & Eosin % 1, 25 50% 2, 51 75% 3, % ) :.. 2) : 24 GOT U/ 2, U/ ( 0.01 P ), GPT U/ 1, U/ ( 0.01 P ) ( 21)
46 Figure 21. Serological assays of experimental rats. The levels of GOT and GPT raised very high after administration of 1 ml/kg CCL4 I.P. Note that the CCL4 effect was diminished in lactoferrin treated rats. 2) : ( 0.05 P ). 4. 2%. 4 Salmonella typhimurium ( ) 5 ( )
47 1. Tomita M., Bellamy W., Takase M., Yamauchi K., Wakabayashi H., Kamase K. (1991) Journal of Dairy Science 74, Le Provost, F. LE., Nocart, M., Guerin, G., and Martin, P. (1994) Biochem. Biophys. Res. Commun., 203, Kakuta, I., Kurokura, H., Nakamura, H., and Yamauchi, K. (1996) Suisanzoshoku, 44, Masada, S., Yamane, Y., Shimoda, K., Shimoda, T., Nakaniwa, S., Uno, T., Hirose, T., Ishikawa, K., Kijima, M., and Yonezawa, H. (1995) J. Anim. Clin. Res. Found., 3(2), Fujihara, T., and Hayashi, K. (1995) Arch. Virol., 140, T H Lee, K Shimazaki, S l Yu, M S Nam, S J Kim, K K Lee, D Y Yu(1997) Polymorphic sequence of korean native goat lactoferrin exhibiting greater antibacterial activity. Animal Genetics, 28, Seyfert, H. M., Tuckoricz, A., Interthal, H., Koczan, D. and Hobom, G.(1994) Gene, 143, Nam MS, Yu DY. Purification of Korean Native Goat Lactoferrin by using ion-exchange chromatography and affinity chromatography. Korean J. Dairy S -ci (3) : Nam MS, Yu DY, Shimazaki K. Comparison of antibaterial activities on Ko -rean native goat, bovine, sheep and horse lactof-errin. Korean J. Dairy S -ci (3) : Nam MS, Shimazaki K, Kumura H, Lee KK, Yu DY. Characterization of Kor -ean native goat lactoferrin. Comparative Biochemistry and physiology part B , Kimura M, Nam MS, Ohkouchi Y, Kumura H, Shimazaki K and Yu DY. Antimicrobial peptide of Korean native goat lactoferrin and identification of the part essential for this activity. Biochem. Biophys. Res. Comm. 2000, 268,
48 12.Sorenson, M. and S.P.L. Sorensen, C.R. Lab.(Carlsberg)(1939) [Ser Chim], 23 : Schanbacher, F.L., Goodman, R.E. and Talhouk, K.S. (1993) J.Dairy Sci., 76 : Sekine K, Watanabe E, Nakamura J, Takasuka N, Kim DJ, Asamoto M, et al. Jpn. J. Cancer Res. 1997, 88, Bezault J, Bhimani, R, Wiprovnick J, Furmanski P. Cancer Res , Chirgwin et al. Biochem., 1979, 18, Sanger et al. PNAS USA, 1977, 74,
49 lactoferrin peptide
50 lactoferrin peptide : :
51 ( ) : : ( ) :,,,,
52 Lf Lf, macrophage TNF- NO liter lactoferrin 65mg 29.4%. 2. K-Lf 81,000Da 0.56mg/g 40.6%. pi 9 K-Lf B-Lf H-Lf. 3. E. coli O111 B-Lf K-Lf, B-Lf-h K-Lf-h. MIC E. coli O111 B-Lf 1.5mg/ml, K-Lf 2.75mg/ml B-Lf-h 0.125mg/ml, K-Lf-h 0.25mg/ml B-Lf-h. Lf lysozyme. 4. K-Lf K-Lf RAW264.7 cell TNF-, LPS TNF-. 5. K-Lf TNF- NO. 6. K-Lf-h Lf TNF- NO
53 Summary The purpose of this study is to demonstrate biochemical properties and antibacterial activity of the Lf obtained from the colostrum of Korean native cow by the process of isolation purification and also verify the effect of K-Lf on the productions of TNF- and NO in RAW264.7 cells by K-Lf. The results are as follows; 1. The amount of Lf collected from a liter of colostrum of Korean native cattle was 65mg and the recovery rate was 29.4%, showing relatively a high purity in K-Lf. 2. The molecular weight of the purified K-Lf was 81kDa, and the content of iron was 0.56mg/g indicating 40.6% of iron saturation. The isoelectric point was 9. In the immunodiffusion test and Western blotting, cross-reactivity was observed between K-Lf and B-Lf not between K-Lf and H-Lf. 3. In the measurement of anitibacterial activity to E. coli 0111 and other microorgainisms, B-Lf showed a higher antibacterial activity level than that of K-Lf. The MIC of B-Lf was 1.5mg/ml and the MIC of B-Lf was 1.6mg/ml in E. coli The same result was also observed between B-Lf-h(0.125mg/ml) and K-Lf-h(0.25mg/ml): the antibacterial activity of B-Lf-h was higher than that of K-Lf-h. In addition, mixture of Lf and lysozyme raised the antibacterial activity level higher as well. 4. Even though K-Lf increased the production of TNF- in RAW264.7 cells with dose-dependency, it didn't affect on the production of TNF- in LPS-stimulated RAW264.7 cells. 5. K-Lf induced the production of NO similar to its role on the TNF- production. 6. Despite K-Lf-h has higher level of antibacterial activity comparing to Lf, it seems that Lf-h didn't significantly affect the production of TNF- and NO in RAW264.7 cells
54 . 58 II Lactoferrin lactoferrin lactoferrin RAW264.7 cell macrophage Lf Lf cytokine Lf 81 III Chromatography Lf HPLC lactoferin Lf RAW264.7 cell macrophage Lf Cytokine Lf
55 . immunoglobulin, lactoferrin(lf) lactoperoxidase, lysozyme, superoxide dismutase (Reiter, 1975). Lf,, (Arnold, 1977; Oseas, 1981; Mansson, 1990). Lf lactotransferrin (Montreuil Mullet, 1960), transferrin family (Aisen Listowsky, 1980; Brock, 1985 ; Rose, 1986),,, mucous neutrophil secondary granules. Lf 1960 Groves, Johansson Montreuil. Human-Lf(H-Lf) glycoprotein 2 glycan chain 691 (Metz-Boutigue, 1984), Pierce (1991) Bovine Lf(B-Lf) peptide 689. B-Lf 76KDa, 83KDa (, 1993). 2 lobe, lobe 1 2 Fe3+. Lf, coliform enterobacteria free iron chelating (Arnold, 1977; Bullen, 1981; Nemet Simonovits, 1985)., Lf lipopolysaccharide(lps), 55
56 (Ellison, 1988; Nikaido, 1989). Lf (Arnold, 1977) (Nemet Simonovits, 1985), myelopoiesis (Broxemeyer, 1980), (Oseas, 1981; Mansson, 1990), lympocytes (Hashizume, 1983) macrophage glanulocyte, neutrophil, leukocyte (Ambruso Johnston, 1981; Bullen Amstrong, 1979). Lf (hemopoietic progenitor cell) complex regulatory network (Malmquist, 1978). macrophage Lf, tumor necrosis factor- (TNF- ) interleukin-8(il-8), nitric oxide(no) (Sorimachi, 1997), in vivo Lf TNF- interleukin-6 cytokine (Machnicki, 1993). TNF- LPS phorbol-12-myristate-13-acetate macrophage monocyte proinflammatory cytokine (Manogue, 1992) apoptosis antitumor, TNF- (Vileek Lee, 1991). TNF- (Beutler, 1992) immunological liver injury (Tiegs, 1989),, (Firestein, 1994) autoimmune disease. TNF- HIV(human immunodeficiency virus) DNA, (Sekut Connolly, 1996). NO (Nathan, 1992) NO 56
57 acetylcholine (Ignarro, 1990; Moncada Higgs, 1991), cytokine (Furchgott Vanhoutte, 1989). Lf Lf lactoferrin hydrolysate(lf-h) Tomita (1991) Bellamy (1992) pepsin B-Lf N-terminal amino acid 3,126Da domain lactoferricin(lfcin). B-Lf (MIC) 2000 / Lfcin 6 / 300, H-Lf Lfcin 16. Lfcin. Lf,,,,. Lf Lf Lf-h Holstein Lf. B-Lf Lf. Holstein (, 1998) Lf. Lf, Lf,, macrophage TNF- NO, Lf cytokine. 57
58 II. 1. Lf 2 3. Bovine lactoferrin human lactoferrin Sigma Co. bovine lactoferrin, 2. Lactoferrin 4 5,000 g 30, 20 1N HCl ph 4.6 casein, 5,000 g 10 whey. whey 1N NaOH ph 8.0 5,000 g Batch extraction( 1 ) Dionysius (1991) (1994), whey 1 liter 50mM Na-phosphate buffer(ph 8.0) CM-Sephadex C-50(Sigma. Co.) 200, 1 1. slurry aspirator funnel, buffer, 0.2M NaCl buffer 200 slurry. slurry column( 3cm 30cm) 0.5M NaCl buffer /hr 10 UV monitor system(econo system: Bio-rad, USA) 280nm. 4 cold room ultrafiltration system(amicon, USA). 58
59 2.2. Ion exchange chromatography( 2 ) 1 crude Lf fraction 50mM Na-phosphate buffer(ph 8.0), buffer CM-sephadex C-50 column( 3cm 30cm). gradient stepwise gradient 1 0.1M NaCl 50mM Na-phosphate buffer(ph 8.0) 250, 2 0.3M NaCl buffer 250, 3 0.5M NaCl buffer /hr 10 /tube, 4 UV monitor system 280nm. 4 cold room ultrafiltration Gel filtration chromatography( 3 ) 2 crude Lf 50mM Na-phosphate buffer(ph 8.0), Sephadex G-150(Pharmacia, Sweden) column( 2.5cm 40cm) loading, 50mM Na-phosphate buffer(ph 8.0) 1 liter 30 /hr 10 /tube. 4 UV monitor system 280nm cold room ultrafiltration Heparin agarose affinity chromatography( 4 ) Chen (1991) affinity chromatography. Heparin-agarose binding buffer(5mm Tris-HCl containing 50mM NaCl, ph 8.0) column( 3cm 20cm), 3 Lf binding buffer loading. Washing buffer(5mm Tris-HCl, containing 0.2M NaCl, ph 8.0) 0.2M 0.7M NaCl 30 /hr 10. UV monitor 280nm, cold room ultrafiltration. 59
60 2.5. 1) Sodium dodecyl sulfate polyacrylamide gel electrophoresis Lactoferrin Laemmli (1970), Mini-Protein II(Bio-rad, USA) sodium dodecyl sulfate polyacrylamide gel electrophoresis(sds-page). SDS-PAGE 0.1% SDS 10% acrylamide gel 0.025M Tris, 0.192M glycine electrode buffer(ph 8.3) well constant current 4mA, gel 0.25% coomassie blue R-250 methanol acetic acid water(3 1 6, v/v/v) staining solution 1 acetic acid methanol water(1 3 6) destaining solution. 2) High performance liquid chromatography Lf Lf HPLC(SP8800, Spectra-Physics, USA) reverse phase column chromatography Table Lactoferrin Lf-hydrolysate Tomita (1991) Lf 5%(w/v) 3, ph mM HCl pepsin Lf 3%(w/w) 37 shaking water bath water bath 15 ph ,000 g
61 3. lactoferrin 3.1. lactoferrin HPLC Lf HCl Pico-Tag HPLC(Waters, USA).. 61
62 colostrum Centrifugation 5,000 g for 30 min at 4 Skim Milk adjust to ph 4.6 at 20 with HCl Whey Casein adjust to ph 8.0 with 1N NaOH additon of 200 of CM-Sephadex C-50 Agitation 4, 1hr Precipitation Elution (batch type) Lactoferrin-rich fraction CM-Sephadex C-50 column Fraction I Fraction II Dialysis Freeze Drying Sephadex G-150 column Dialysis Freeze Drying Heparin Agarose column Dialysis Freeze Drying Fig. 1. Schematic diagram of purification lactoferrin 62
63 Table 1. Gel preparation for SDS-PAGE Stock solution deionized water 30% acrylamide solution 1.5M Tris (ph 8.8) 10% SDS 10% ammonium persulfate TEMED 10% gel
64 Table 2. Operation condition of HPLC Column Detector Flow rate Mobile phase Symmetry(C18reverse, Waters) UV 280nm 1.00 /min (A) 0.1% TFA/H2O (B) 0.1% TFA/CH3CN Gradient 0 min A B (80 : 20) 35 min A B (55 : 45) 64
65 Table 3. Gel preparation for isoelectric focusing Stock solution 5% gel deionized water 30% acrylamide mix ampholytes(3.5/10) glycerol 10% ammonium persulfate TEMED
66 3.2. (isoelectric focusing) Lf Robertson (1987). 5% acrylamide gel (3.3%, ph ) Mini-Protein II(Bio-rad) IEF-PAGE. cathode buffer 20mM NaOH anode buffer 10mM phosphoric acid current voltage 200V 1 30, 400V % trichloroacetic acid 20. 1% trichloroacetic acid 2 SDS-PAGE Lf serum iron analysis kit (Wako Pure Chemical Industries, Japan). (L-ascorbic acid) 15 buffer(tween M Acetic acid, ph 5.0) 2. 1% Lf 0.5 blank 535nm (ESBI) (bathopenanthroline sulfonic acid disodium salt, 19mM/liter) 535nm (ES). (Fe 200g/dl) (ESTD) (EBI) Lf. ( / ) = 3.4. Circular dichroism Es- ESBI- EBI ESTD- EBI 200 Circular dichroism(cd) Shimazaki (1993) PS 150J power supply JASCO J-715 automatic recording spectro- polarimeter(, Japan). cell 1 mm, 150 / CD. 66
67 3.5. lactoferrin 1) 1 K-Lf 500 / PBS Freund's complete adjuvant(difco, USA) (New Zealand White) 1 immuno diffusion test. 1 2 Freund's incomplete adjuvant(difco, USA) K-Lf 1 2 K-Lf K-Lf ) Ouchterlony immunodiffusion test PBS buffer 1% agarose gel 1.5 well rabbit anti-k-lf-antiserum 10 Lf ) Antibody titer 0.05M carbonate buffer(ph 9.0) 2 / EIA 96-well plate C overnight coating. Tween % PBS(PBST) PBST 3. 2 (horse radish peroxidase-conjugated anti-rabbit IgG) PBST 1 10, PBST 3. (TMB substrates buffer, 30% H2O2, TMB 1 / methanol) M H2SO4 50 ELISA reader(elx800 : Bio-tec, USA) 450nm. 67
68 4) Western blot analysis Lf SDS-PAGE gel transfer buffer (25mM Tris, 192mM glycine, 20% methonal, ph 8.3) nitrocellulose membrane electrotransfer kit(bio-rad, USA) transfer buffer constant voltage 100V membrane blocking buffer(tbs buffer+5% BSA) ,000 TBS buffer primary antibody solution 4 overnight TBS buffer 10 3 biotinylated secondary antibody reagent 30 TBS buffer straptavidin alkaline phosphatase reagent 30 TBS buffer 10 3 BCIP/NBT(5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium). 4. lactoferrin 4.1. E. coli O111, Staphylococcus aureus ATCC25923, Salmonella typhimurium ATCC13311, Candida tropicalis KCTC7221 Difco Co.. nutrient 37, 1% peptone % peptone 0.45 filter (Millipore Co.) Lf 6 106cfu/
69 4.3. Minimum inhibitory concentration nutrient % peptone Lf 106cfu/ colony Lysozyme Lf lysozyme E. coli O cfu/ Transmission electron microscopy 1% peptone Lf 5 / Lf-h 1 / Candida tropicalis KCTC cfu/ mM phosphate buffer (ph 6.8) 1% agar 1mm 1mm 3mm Karnnovsky's. washing buffer (50mM cacodylate buffer, ph 7.2) 1% OsO4 buffer 3 washing buffer 0.5% uranyl acetate overnight. 50, 75, 90, 95, 100% ethanol propylene oxide 1 epon propylene oxide epon embedding diamond knife ultrathin section uranyl acetate lead citrate 75kV Transmission electron microscopy(tem)(h-800: Hitachi, Japan) Lactoferrin peptide Lf-h 5 / HPLC C18 column 1 69
70 evaporator filtration(0.45 ). HPLC Table 3. 70
71 5. RAW264.7 cell macrophage 5.1. cell line (KCLB) culture medium Gibco/BRL Co., Sigma Co.. RAW264.7(KCLB 40071) cell murine macrophage cell 10%(v/v) fetal bovine serum(fbs) (penicillin(100units/ )/streptomycin (100 / )) DMEM culture medium(ph 7.2) culture dish( 100) 90% scraping L929(KCLB 10001:NCTC clone 929) cell murine fibroblast cell 10%(v/v) FBS 1% penicillin/streptomycin RPMI1640 medium(ph 7.2) culture dish( 100) 90% 1% trypsin/edta cell Lf Lf-h culture medium 10 / 0.22 filter(millipore, USA), LPS actinomycin D 100 / PBS(Phosphate buffer saline). MTT(3-(4,5-Dimethylthiazol -2-yl)-2,5-diphenyltetrazolium bromide) 5 / PBS (cytotoxicity) RAW264.7 cell 1 105cells/well, L929 cell 3 104cells/well 96-well mocroplate 37, 5% CO2incubator 4. well volume MTT (5 / )
72 well PBS buffer % SDS 50 CO2incubator 24. ELISA microplate reader(elx800 : Bio-tec, USA) 540nm in vitro TNF- TNF- (1998). Lf LPS RAW264.7 cell TNF- 96-well plate RAW264.7 cell 2 105cells/well. well Lf Lf-h LPS 1 / well , 5% CO2incubator 6. TNF- TNF- L929 cell L929 cell 3 104cells/well 96-well microplate % CO2incubator 4 75 RAW264.7 cell 25. actinomycin D(4 / ) 25 37, 5% CO2incubator MTT(5 / ) well 5 4 CO2incubator. 4 PBS buffer % SDS solution 50. CO2incubator 24 ELISA microplate reader TNF- RAW264.7 cell TNF- R&D systems(usa) mouse TNF- immunoassay Quntikine M ELISA kit in vitro Nitric oxide Lf RAW264.7 cell NO 72
73 cell scraping cells/well 96-well microplate Lf Lf-h ( / ) interferon- (IFN- ) 10unit/, LPS 100ng/, well volume , 5% CO2incubator well microplate Griess reagent (0.2% naphthyethylene diamine) (10% phosphoric acid containing 2% sulfanilamade) ELISA microplate reader 540nm sodium nitrite nitric oxide nitrite. 6. Lf Lf (KCLB). human A427(lung carcinoma, KCLB 30053), A498(kidney carcinoma, KCLB 30044), HeLa(cervix adenocarcinoma, KCLB 10002), HepG2(liver hepatoblastoma, KCLB 58065), HT29(colon adenocarcinoma, KCLB 30038), MCF7(breast adenocarcinoma, KCLB 30022), SK-HEP-1(liver adenocarcinoma, KCLB 30052), WiDr(colon adenocarcinoma, KCLB 10218) Cytotoxicity A427, A498, SK-HEP-1, WiDr heat inactivation 10 (v/v) fatal bovine serum(fbs) (penicillin(100units/ )/streptomycin(100 / )) Dulbecoo's modified Eagle's medium(dmem, ph 7.2), HeLa, HT29, HepG2, MCF heat inactivation 10 (v/v) fatal bovine serum(fbs) (penicillin(100units/ )/streptomycin(100 / )) RPMI1640(pH 7.2)medium. culture dish( 100) % trypsin/edta 1 : 5. 73
74 6.2. in vitro cytotoxicity Lf cytotoxic effect MTT assay cells/well 96 well plate plate 37, 5 CO2incubator / 1 / H-Lf, B-Lf, K-Lf 20 37, 5 CO2incubator MTT (5 / ) well PBS % SDS solution 50 37, 5 CO2incubator 24 ELISA microplate reader(elx800 : Bio-tec, USA) 540nm. (Growth inhibitory effect(%)=[( - / )]
75 7. Lf cytokine Cytokines Lf T cell cytokine IL-2, IL-4, IL-6, IFN- cytokine. mouse T cell EL-4(KCLB 40039) heat inactivation 10 (v/v) horse serum (penicillin(100units/ )/streptomycin(100 / )) Dulbecoo's modified Eagle's medium(dmem, ph 7.2), culture flask (T-75) 1 : well plate 3 106cells/well, Lf 1mg/ml. Cytokine PMA(phorbol-12-myristate-13-acetate) 100ng/ml, 3 7 5% CO2 incubator 24, cytokine Total RNA Lf cytokines EL-4 cell total RNA AGPC(acid guanidinium thiocyanate-phoh-chloroform extraction)., Lf 24 EL-4 cell, 0.5% sarcosyl RNA total RNA. total RNA isopropyl alcohol, 70% ethanol 3. Total RNA 260nm, RT-PCR RT-PCR Cytokines RT-PCR (reverse transcriptase polymerase chain reaction). AGPC total RNA 15 cdna, cdna cytokines primer (Table. 1) PCR. PCR 94 /3, 94 /30, 58 /1, 72 /2 25, 72 /5. PCR PCR % agarose, cytokines. 75
76 76
77 Table. 4. Nucleotides sequences of oligosaccharide primers for RT-PCR. IL-2 IL-4 IL-6 Upstream 5'-CCTTGCTAATCAC TCCTCAC-3' 5'-AGGACCACGATTA TGAGC-3' 5'-GAGTTGTGCAATG GCAATTC-3' Downstream 5'-TTTGAAGGTGAGCA TCCTGG-3' 5'-TTGTTGAGTGCCAT CTGG-3' 5'-TGGATGGTCTTGGT CCTTAG-3' IFN- 5'-CAGCTGTCACCAG AATCTAGCC-3' 5'-CAGCACCTCACGGG GTCATTGC-3' 77
78 8. Lf Mouse C57BL/6 (6-7 weeks, ), kidney Staphylococcus.aureus(ATCC 25923). Lf(10mg/ml) 0.22um, 1 0.1ml(1mg/mouse). 0.9% saline. Kidney infection Lf 1 S.aureus 0.1ml (106cell/ml nutrient broth), 14 kidney. kidney, 3ml PBS homogenizer ( ). salt mannitol agar, Staphylococcal colony counting. Mouse diets. Lf, 2% ( ), 50ml/day. 78
79 III. 1. Chromatography Lf Lf Nagasawa (1972) DEAE-Cellulose, Spik (1982) SP-Sephadex, Dionysius (1991) CM-Sephadex C-50 ion exchange chromatography, Ena (1990) -lactoglobulin affinity chromatography, batch lactoferrin. 1 batch K-Lf rich fraction 280nm 0.294, Dionysius (1991) Lf lactoperoxidase buffer NaCl Lf lactoperoxidase. 2 2 (Fig. 2), fraction 0.3M NaCl fraction 0.5M NaCl. fraction Fig. 5 2 Lf fraction Lf Lf. 3 gel filtration chromatography, Fig. 3 peak SDS-PAGE Lf. 4 Fig. 4 heparin agarose affinity chromatography Lf, 0.5M NaCl peak SDS-PAGE, Sigma Co. bovine lactoferrin 79
80 . K-Lf SDS-PAGE Fig. 5. logarithm K-Lf 81KDa, B-Lf 80KDa. K-Lf Table 4 whey 1 65 K-Lf. 29.4% Lf affinity lactoferrin. Lf sephadex G-150 gel filtration heparin agarose affinity chromatography. Lf 5 /, Tsuchi (1990) Lf 0.5 /. K-Lf. Tsuchi (whole milk) Lf. Lf
81 Fig. 2. CM-sephadex C-50 ion exchange chromatography of lactoferrin purified from Korean native cow's colostrum following batch extraction with CM-sephadex C-50 Fig. 3. Sephadex G-150 gel filtration chromatography of lactoferrin purified from Korean native cow's colostrum following CM-sephadex C-50 ion exchange chromatography 81
82 Fig. 4. Heparin agarose affinity chromatography of lactoferrin purified from Korean native cow's colostrum following sephadex G-150 gel filtration chromatography 82
83 Table 5. Recovery rate of lactoferrin from Korean native cow's whey by purification steps Purification Step ( ) ( ) Recovery rate(%) whey 1L
84 Fig. 5. SDS-PAGE anyalysis of lactoferrin purified from Korean native cow's colostrum by purification step Lane 1 molecular weight marker(sigma. Co.) Lane 2 lactoferrin purified from Korean native cow's colostrum by CM-sephadex ion exchange chromatography Lane 3 lactoferrin purified from Korean native cow's colostrum by G-150 gel filtration chromatography Lane 4 commercial bovine lactoferrin Lane 5 lactoferrin purified from Korean native cow's colostrum by heparin agarose affinity chromatography A -galactosidase (MW 116,000) B fructose-6-phosphate kinase (MW 84,000) C pyruvate kinase (MW 58,000) D ovalbumin (MW 45,000) E lactic dehydrogenase (MW 36,500) F triosephosphate isomerase (MW 26,000) 84
85 2. HPLC lactoferin Lf HPLC. 1 peak (Fig. 6) 2 peak batch peak (Fig. 7). ion exchange chromatography Lf HPLC pattern retention time. 3 HPLC pattern(fig. 8) peak Lf peak peak. 4 peak (Fig. 9) 4 pattern chromatography. K-Lf B-Lf HPLC pattern SDS-PAGE affinity chromatography peak retention time (Fig. 10). H-Lf HPLC pattern(fig. 11) H-Lf retention time K-Lf B-LF peak K-Lf B-LF. Fig. 6. HPLC analysis pattern of crude lactoferrin purified from Korean native cow's colostrum following batch extraction with CM-sephadex C-50 Fig. 7. HPLC analysis pattern of crude lactoferrin purified from Korean native cow's colostrum following CM-sephadex C-50 ion exchange chromatography 85
86 Fig. 8. HPLC analysis pattern of crude lactoferrin purified from Korean native cow's colostrum following G-150 gel filtration chromatography 86
87 Fig. 9. HPLC analysis pattern of lactoferrin purified from Korean native cow's colostrum following heparin agarose affinity chromatography 87
88 Fig. 10. HPLC analysis pattern of commercial bovine lactoferrin Fig. 11. HPLC analysis pattern of commercial human lactoferrin 3. Lf 3.1. lactoferrin amino acid K-Lf amino acid Pierce (1991) B-Lf amino acid lysine, K-Lf amino acid B-Lf amino acid K-Lf B-Lf K-Lf pi isoelectric focusing Lf pi 9 (Fig. 12). (1994) K-Lf pi 8.7 B-Lf pi 8.9 K-Lf H-Lf pi 8.8 Moguilevsky (1985) 8.7, Foley (1987), O'connor (1987) H-Lf pi Lf Serum iron analysis Kit Lf Lf (Table 7). K-Lf B-Lf 40.6% 34.2% B-Lf H-Lf 15.4% 10.8%. K-Lf B- Lf 88
89 Frasson (1980) 1 4% Lf Circular dichroism spectra Circular dichroism(cd) Fig helix K-Lf 18% -helix B-Lf 15 % -helix. Brown (1974) B-Lf -helix 15% Shimazaki (1991) B-Lf 12%, apo-b-lf 14%, holo-b-lf 12% -helix B-Lf -helix. -helix K-Lf B-Lf Ouchterlony immunodiffusion test K-Lf lactoferrin K-Lf K-Lf B-Lf, K-Lf, H-Lf, B-Lf-h BSA Ouchterlony immunodiffusion test (Fig. 14) B-Lf K-Lf B-Lf-h K-Lf. B-Lf-h K-Lf. K-Lf H-Lf. Lf. Shimazaki (1991) immunodiffusion B-Lf sheep-lf goat-lf H-Lf horse-lf H-Lf Lf. 89
90 3.6. Antibody titer 3 boosting 4 boosting 3 boosting 4 boosting. ELISA. Antibody titer (Fig. 15) Western blot analysis B-Lf, K-Lf H-Lf SDS-PAGE Lf cross-reactivity K-Lf Western blotting Fig. 16. B-Lf, K-Lf H-Lf. ouchterlony test B-Lf K-Lf H-Lf lactoferrin. 90
91 Table 6. Amino acids composition of Korean native cow's lactoferrinand A bovine lactoferrin B C Amino acids D B-Lf K-Lf Alanine Arginine Asparagine 29 E 59 Aspartic acid 36 Cysteine F Glutamine G 29 Glutamic H acid Glycine I Histidine 9 8 Isoleucine Leucine Lysine Methionine J 4 1 Phenylalanine Proline Serine Threonine Tryptophan Tyrosine Valine Total A.A. residues Data were calculated from the amino acid sequence of bovine lactoferrin(pierce, 1991) Fig. 12. Isoelectric focusing gel electrophoresis of lactoferrins 1. pi standard marker 2. K-Lf 3. B-Lf 91
92 4. H-Lf A : Trypsinogen(pI 9.3) B : Lectin (pi 8.8) C : Lectin (pi 8.6) D : Lectin (pi 8.2) E : Myoglobulin(pI 7.2) F : Carbonic Anhydrase(pI 6.6) G : Carbonic Anhydrase(pI 5.9) H : -lactoglobulin A(pI 5.1) I : Trypsin inhibitor(pi 4.6)J : Amyloglucosidase(pI 3.6) Table 7. Iron content and iron saturation of different kinds of lactoferrin B-Lf H-Lf K-Lf B-Lf (normal (normal (colostrum) (colostrum) milk) milk) Fe content( /g) F e saturation(%) K-Lf Fe saturation 100% = 1.38 /g Lf B-Lf Fe saturation 100% = 1.43 /g Lf 92
93 Fig. 13. CD-spectra of Korean native cow's lactoferrin and commercial bovine lactoferrin 93
94 Fig. 14. Ouchterlony immunodiffusion pattern of rabbit anti-k-lf -antiserum against B-Lf, K-Lf, H-Lf, B-Lf-h and BSA c : rabbit anti-k-lf-antiserum 1 : B-Lf 2 : K-Lf 3 : H-Lf 4 : B-Lf-h 5 : BSA 94
95 Fig. 15. Quantitative analysis of K-Lf and its antibody complex by ELISA on the basis of amount of the rabbit anti-k-lf-antiserum 95
96 Fig. 16. Western blot analysis comparision of lactoferrins 1. H-Lf 2. K-Lf 3. B-Lf 96
97 Lf Lf-h B-Lf K-Lf 1, 2, 3, 4 /, B-Lf-h K-Lf-h 0.05, 0.1, 0.5, 1 / E. coli O111. B-Lf K-Lf Lf. B-Lf 1 /. K-Lf B-Lf (Fig. 17, 18). K-Lf B-Lf. Lf Fig. 19 Fig. 20 B-Lf-H 0.5 / E. coli O111 K-Lf-H 0.5 /, 1 / B-Lf-H (Minimum inhibitory concentration) B-Lf K-Lf, B-Lf-h, K-Lf-h E. coli O111, Staphylococcus aureus, Salmonella typhimurium, Candida tropicalis (MIC). E. coli O111, MIC B-Lf 1.50 /, K-Lf 2.75 /, B-Lf-h 0.12 /, K-Lf-h 0.25 / Lf MIC 2 (Table 7). Tomita (1991) Bellamy (1992) B-Lf MIC 2 /, B-Lf-h 0.1 / MIC. Staphylococcus aureus B-Lf, K-Lf 50 /. lactoferrin Staphylococcus aureus B-Lf-H 0.70 /, K-Lf-H 1.80 / B-Lf-h K-Lf-h 2 97
98 (Table 8). Salmonella typhimurium Lf B-Lf MIC 0.3 / (Table 9), Candida tropicalis K-Lf B-Lf Lf (Table 10). B-Lf K-Lf B-Lf-h K-Lf-h Lactoferrin lysozyme Lysozyme 0.39 / (Gurr, 1981) lysozyme Lf, lysozyme Lf (Suzuki, 1989). lysozyme E. coli O111 Table 11. Lf lysozyme E. coli O111 MIC B-Lf 1.5 /, K-Lf 2.75 /, lysozyme 0.25 / Table Lf lysozyme synergistic effect, Ellison(1991)., K-Lf B-Lf lysozyme B-Lf lysozyme K-Lf TEM Lf 1% peptone Lf 5 / Lf-h 1 / Candida tropicalis KCTC cfu/
99 Transmission electron microscopy (TEM). (Fig.21). Lf Lf-h (Fig. 22, 23) cytoplasmic Bellamy (1993, 1994) lactoferricin B yeast fungi. yeast Lf Lf-h Lactoferrin peptide Lf peak HPLC gradient, peptide peak Fig. 24. K-Lf B-Lf retention time Tomita (1994) reverse phase column lactoferricin B gradient. 99
100 Fig. 17. Bacteriostasis of E. coli O111 by B-Lf in 1% peptone broth at
101 Fig. 18. Bacteriostasis of E. coli O111 by K-Lf in 1% peptone broth at
102 Fig. 19. Bacteriostasis of E. coli O111 by B-Lf-H in 1% peptone broth at
103 Fig. 20. Bacteriostasis of E. coli O111 by K-Lf-h in 1% peptone broth at
104 Table 8. Inhibitory sensitivity of lactoferrin and peptic lactoferrin hydrolysates to E. coli O111 MIC( / ) B-Lf K-Lf B-Lf-H K-Lf-H Table 9. Inhibitory sensitivity of lactoferrin and peptic lactoferrin hydrolysates to Staphylococcus aureus MIC( / ) B-Lf K-Lf B-Lf-H K-Lf-H >50 >
105 Table 10. Inhibitory sensitivity of lactoferrin and peptic lactoferrin hydrolysates to Salmonella typhimurium MIC( / ) B-Lf K-Lf B-Lf-H K-Lf-H Table 11. Inhibitory sensitivity of lactoferrin and peptic lactoferrin hydrolysates to Candida tropicalis MIC( / ) B-Lf K-Lf B-Lf-H K-Lf-H
106 Table 12. Minimum inhibitory concentration of lactoferrin purified from Korean native cow's colostrum and commercial bovine lactoferrin with or without lysozyme Lysozyme ( / ) control B-Lf( / ) K-Lf( / ) _ _ : no antibacterial effect + : antibacterial effect Fig. 21. Electron micrographs of Lf-untreated Candida tropicalis Cells were cultured in 1% peptone broth at 37 for 4hrs bar 1 106
107 Fig. 22. Electron micrographs of Candida tropicalis showing morphological changes induced by lactoferrins (A) Cells were cultured in 1% peptone broth supplemented with 5mg/ml commercial A bovine lactoferrin at 37 for 4hrs (B) Cells were cultured in 1% peptone broth supplemented with 5mg/ml Korean native cow's lactoferrin at 37 for 4hrs bar 1 A Fig. 23. Electron micrographs of Candida tropicalis showing morphological changes induced by peptic lactoferrin hydrolysates (A) Cells were cultured in 1% peptone broth supplemented with 1mg/ml peptic Bbovine lactoferrin hydrolysate at 37 for 4hrs (B) Cells were cultured in 1% peptone broth supplemented with 1mg/ml peptic Korean native cow's lactoferrin hydrolysate at 37 for 4hrs bar 1 B 107
108 Fig. 24. Reverse-phase HPLC profile of the lactoferrin hydrolysates A : K-Lf-h B : B-Lf-h Arrow indicates the position of the active peptide recovered for sequence analysis. 108
109 5. RAW264.7 cell macrophage 5.1. Lf Lf Lf-h RAW264.7 cell L929 cell Lf Lf-h /. RAW264.7 cell L929 cell 24 MTT Fig. 25, Fig % Lf RAW264.7 cell L929 cell Lf Lf RAW264.7 cell TNF- Macrophage LPS proinflammatory cytokine IL-1, IL-6, TNF-. Lf macrophage TNF- murine macrophage cell line RAW264.7 cell. LPS RAW264.7 cell Lf(K-Lf, B-Lf, H-Lf), TNF-. TNF- L929 cell cell survival rate (Fig. 27). 1mg/ml K-Lf, B-Lf, H-Lf RAW264.7 cell 6, K-Lf 22% (Fig. 27-A). B-Lf H-Lf 85% 90%, K-Lf. K-Lf, LPS. K-Lf bioassay L929 cell cytotoxic effect (Fig. 26). K-Lf macrophage TNF-. K-Lf TNF- Fig. 27-B. K-Lf TNF-. K-Lf 1 / 6%, 5 / 16% TNF-. 3%, 5 / K-Lf 109
110 TNF-. B-Lf H-Lf 11% 6%, 16% K-Lf TNF- (Fig. 27-C, 27-D). Lf macrophage TNF-. K-Lf macrophage TNF Lf LPS TNF- RAW264.7 cell LPS TNF-. Lf LPS RAW264.7 cell TNF-. 1 / LPS RAW264.7 cell 6 bioassay TNF-, 28% (Fig. 28-A)., K-Lf, B-Lf, H-Lf LPS RAW264.7 cell TNF- Fig. 30. LPS 28% K-Lf, B-Lf, H-Lf 31%, 51%, 63% (Fig. 28-A). TNF-, LPS K-Lf 3%, B-Lf 23%, H-Lf 35% TNF-. Lf TNF-, H-Lf TNF-., Lf. Fig. 28-B LPS K-Lf Lf. B-Lf H-Lf Lf LPS TNF- 110
111 H-Lf (Fig. 28-C, 28-D). Lf LPS TNF-., Lf bioassay TNF- L929 cell. Lf RAW264.7 cell TNF-, L929 TNF-. recombinant TNF- Lf L929 cell TNF- (Choe and Lee, unpublished data)., Lf LPS RAW264.7 cell TNF-. Lf LPS LPS. LPS Lf H-Lf 35% TNF-., Lf RAW264.7 cell TNF-. Lf DNA, Lf,. Lf Lf TNF-. Lf., Lf TNF- TNF- Nuclear Factor- B(NF- B). TNF-, TNF-. Zagulski (1989) B-Lf mouse 24 E. coli mouse TNF- 111
112 , Machnicki (1993) in vivo Lf TNF-. Sawatzki Rich(1989) LPS Lf (5 6 ) Guttenberg (1989) Lf Lf. Lf IL-1 (Silva Cohen, 1992), TNF- (Beutler, 1985) proinflammatory cytokine ELISA TNF- RAW264.7 cell Lf ELISA TNF-. TNF- 0 TNF-. Table 12 RAW264.7 cell LPS TNF- 212ng/ K-Lf B-Lf TNF- bioassay K-Lf TNF- B-Lf. LPS Lf ELISA reader TNF-. Lf LPS RAW264.7 cell Lf TNF- bioassay LPS Lf. 112
113 Fig. 25. Effect of lactoferrin purified from Korean native cow's colostrum, commercial bovine lactoferrin, peptic hydrolysate of K-Lf and peptic hydrolysate of B-Lf on the growth of RAW264.7 cells A : 1 / K-Lf C : 1 / B-Lf E : 1 / K-Lf-h G : 1 / B-Lf-h B : 1 / K-Lf D : 1 / B-Lf F : 1 / K-Lf-h H : 1 / B-Lf-h Fig. 26. Effect of lactoferrin purified from Korean native cow's colostrum, commercial bovine lactoferrin, peptic hydrolysate of K-Lf and peptic hydrolysate of B-Lf on the growth of L929 cells A : 1 / K-Lf C : 1 / B-Lf E : 1 / K-Lf-h G : 1 / B-Lf-h B : 1 / K-Lf D : 1 / B-Lf F : 1 / K-Lf-h H : 1 / B-Lf-h 113
114 Fig. 27. TNF- production A of RAW264.7 Bcells by different kinds of lactoferrin A : RAW cells were incubated with lactoferrin at 1mg/ml in DMEM with 10% FBS B-D : RAW264.7 cells were incubated with different lactoferrin (at 0 to 1000 /ml) level of TNF- production was expressed by growth inhibition of L929 cells C D Survival rates were measured by MTT assay in which supernatant of cultured RAW 264.7cells for 6hrs was applied to L929 cells 114
115 Fig. 28. TNF- production of RAW264.7 cells by different kinds of lactoferrin A with LPS stimulation B RAW264.7 cells were stimulated by 1 /ml LPS(A-D) A : RAW264.7 cells were incubated with lactoferrin at 1mg/ml in DMEM with 10% FBS B-D : RAW264.7 cells were incubated with different level of lactoferrin(at 0 to 1000 /ml) TNF- production was expressed by growth inhibition of L929 cells Survival rates were measured by MTT assay in which supernatant of cultured RAW 264.7cells for 6hrs was applied to L929 cells C D 115
116 Table 13. Quantitation of TNF- production from the stimulated RAW264.7 cells by lactoferrins Treatment conc. ( / ) K-L (ng/ ) B-Lf (ng/ ) LPS(1 / ) ng
117 5.5. Lf RAW264.7 cell NO Lf RAW264.7 cell NO Lf K-Lf (1 / ) 3 NO B-Lf NO (Fig. 30-A). Fig. 30-B K-Lf NO B-Lf (Fig. 30-B, 30-C). TNF- LPS(100ng/ ) NO, LPS IFN- (10 units/ ) IFN- NO synergistic effect NO. Lf LPS K-Lf B-Lf NO. IFN-, K-Lf Lf NO B-Lf NO (Fig. 31-A, 31-B). Lf IFN- LPS NO IFN-. K-Lf TNF- NO B-Lf NO. Lf LPS IFN- NO Lf IFN- LPS K-Lf B-Lf. Sorimachi (1997) bone marrow macrophage Lf NO, LPS NO. 117
118 Fig. 29. Standard curve for measurement of nitric oxide using sodium nitrite 118
119 A Fig. 30. NO production of RAW264.7cells by lactoferrin purified from Korean native cow's colostrum and commercial bovine lactoferrin. A : RAW264.7 cells were incubated with lactoferrin at 1mg/ml in DMEM with 10% FBS B, C : RAW264.7 cells were B incubated with different level of C lactoferrin(at 0 to 1000 /ml) 119
120 A B Fig 31. NO production of RAW264.7cells by lactoferrin purified from Korean native cow's colostrum(a) and commercial bovine lactoferrin(b) with stimulants Concentration of lactoferrin was 1mg/ml, respectively LPS : 100ng/ml, IFN- : 10unit/ml, LPS+IFN- : combination of equivalent amounts LPS and IFN- 120
121 5.6. Lactoferrin RAW264.7 cell TNF- Lf Lf-h macrophage cell TNF- TNF- bioassay TNF-. K-Lf-h K-Lf K-Lf-h TNF- (Fig. 32-A)., K-Lf 22% K-Lf-h 43% TNF-. Lf-h LPS K-Lf-h B-Lf-h LPS TNF- Lf-h TNF- (Fig. 32-B). Lf-h, K-Lf-h TNF- B-Lf-h K-Lf-h (Fig. 32-C, 32-D). Lf-h TNF- K-Lf 75 %. Lf, TNF-. Lf Lf. 121
122 5.7. Lactoferrin RAW264.7 cell NO Lf Lf-h macrophage cell NO Fig. 33. Lf-h Fig. 33-A K-Lf-h NO B-Lf-h. LPS Lf NO IFN- IFN- LPS Lf (Fig. 33-B, 33-C). Lf Lf macrophage cell NO TNF- NO. Lfcin Human monocytic cell endotoxin IL-6 Mattsby-baltzer (1996) human polymorphonuclear leukocytes IL-8 (Shinoda, 1996) Lf-cin TNF- NO 122
123 A B Fig 32. TNF- production of RAW264.7 cells by peptic hydrolysate of Korean native cow's lactoferrin and peptic hydrolysate of commercial bovine lactoferrin A : RAW cells were incubated with peptic lactoferrin hydrolysate at 1mg/ml in DMEM with 10% FBS B : RAW cells were incubated with peptic lactoferrin hydrolysate at C D 1mg/ml with 1 /ml LPS C, D : RAW264.7 cells were incubated with different level of peptic lactoferrin hydrolysate(at 0 to 1000 /ml) TNF- production was expressed by growth inhibition of L929 cells Survival rates were measured by MTT assay in which supernatant of cultured RAW264.7 cells for 6hrs was applied to L929 cells 123
124 A Fig. 33. NO production of RAW264.7cells by peptic hydrolysate of Korean native cow's lactoferrin and peptic hydrolysate of commercial bovine lactoferrin A : RAW264.7 cells were incubated with peptic lactoferrin hydrolysate at 1mg/ml in DMEM with 10% FBS B C B, C : RAW264.7 cells were incubated with peptic hydrolysate of lactoferrins with stimulants Concentration of lactoferrin was 1mg/ml, respectively LPS : 100ng/ml, IFN- : 10unit/ml, LPS+IFN- : combination of equivalent amounts LPS and IFN- 124
125 6. Lf, Demian (1998) Lf. H-Lf, B-Lf, K-Lf human 8 in vitro 1 / 1 / 96hrs MTT Fig.34, 35, 36, 37, 38, 39, 40, %. Fig / K-Lf A427 71%, b-lf 53%, H-Lf 48%. Fig. 39 MCF-7 k-lf 62%, b-lf 50%, h-lf 38%. Fig. 37, Fig. 40 HepG2 Sk-Hep-1 K-Lf 1 / 50%, K-Lf 0.1 / 51%, 47% b-lf 1 / 38%, 42%, K-Lf b-lf, H-Lf. K-Lf b-lf, H-Lf. Furmanski(1994) Lf mechanism iron chelation, K-Lf b-lf, h-lf K-Lf b-lf, h-lf. 125
126 Fig. 34. Cytotoxicity of Lactoferrin on A427 Fig. 35. Cytotoxicity of Lactoferrin on A
ƯÇãû
'' - 1 - - 2 - - 3 - - 4 - - 5 - ' - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - Super-Bio Co., Ltd. KWON, Suk-Tae Thermostable DNA Polymerase-encoding Gene from Thermus sp. X-1 an d Amino Acid Sequence
Technical/Specs Sequencing 서비스안내 Standard Sequencing Plasmid/PCR product 를 primer 를이용하여고객이원하는 region 을분석하는서비스이며, 대부분의 normal 샘플에대해 최적화되어있습니다. Full Len
Technical/Specs Sequencing 서비스안내 Standard Sequencing Plasmid/PCR product 를 primer 를이용하여고객이원하는 region 을분석하는서비스이며, 대부분의 normal 샘플에대해 최적화되어있습니다. Full Length Sequencing (Primer walking) 길이가긴 insert 를포함한 plasmid
01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
- 2 -
- 2 - - 3 - - 4 - ➀ - 5 - - 6 - α - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - μ - 21 - ➀ - 22 - - 23 - - 24 - α - 25 - - 26 - - 27 - μ - 28 - μ μ - 29
mau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
F. Sequencing FSequencing 01. Sequencing Service DNA sequencing Phone: (ext.4 4)
FSequencing 01. DNA sequencing Phone: 1588-9788 (ext.4 4) E-mail: sequencing@bioneer.co.kr 01. 242 FAQs 247 개요 상세 설명 바이오니아는 국내 최초로 를 시작하였으며, 매년 개선된 high-throughput sequencing service를 제공하고 있습니다. Plasmid
DBPIA-NURIMEDIA
Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun
- 2 -
- 2 - α - 3 - - 4 - α - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - 번호 유효성분 차나무오일 코퍼설페이트펜타하이드레이트 폴리옥신디 - 12 - - 13 - μ - 14 - α m α α μ - 15 - μ μ - 16 - m μ - 17 - - 18 - - 19 - μ - 20 - μ μ μ - 21 - -
이 발명을 지원한 국가연구개발사업 과제고유번호 G1111700300320000000000000 부처명 한국환경산업기술원 연구사업명 토양지하수오염방지기술개발사업 연구과제명 시데로포아(Siderophore)의 대량생산을 통한 토양 및 지하수의 친환경 중금속 제거기술 개 발
(19) 대한민국특허청(KR) (12) 공개특허공보(A) (11) 공개번호 10-2013-0029213 (43) 공개일자 2013년03월22일 (51) 국제특허분류(Int. Cl.) C12N 1/15 (2006.01) C12P 21/00 (2006.01) C12R 1/77 (2006.01) (21) 출원번호 10-2011-0092470 (22) 출원일자 2011년09월14일
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
김도희_HT protein expression 표준 보고서_v1.5
Production of Recombinant Proteins For Further Information, Please Contact Neurogenex Co., Ltd. Biotechnology Incubating Center "Golden Helix" Seoul Natl' Univ. Seoul 151-744, Korea TEL 82-2-875-8998 FAX
-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
항체 포털 서비스 Preparation Peptide 총 4주 소요 / 473,000 ~ 511,000 Free of charge 2~3 days 243,000 ~ 281,000 의뢰서 작성 Peptide epitope prediction 유전자 정보
Preparation Service AbFrontier Custom service 장점 실험 담당자와의 원활한 1:1 커뮤니케이션 (신속한 feedback을 통한 맞춤형 제작 서비스) 고객연구센터 - 개별 서비스의 진행 상황 및 결과 즉시 확인 http://center.abfrontier.com (e-mail & SMS 전송) 회원제 -연구자의 프로젝트 보안
Statistical Data of Dementia.
Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.
γ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
DBPIA-NURIMEDIA
Mass-production of Four Specific Proteins Originated from Deformed Wing Virus, Honeybee-viral Pathogen Joo-seong Lee, Giang Thi Huong Luong and Byoung-Su Yoon* Department of Life Science, College of Natural
MHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State
한약재품질표준화연구사업단 단삼 ( 丹參 ) Salviae Miltiorrhizae Radix 생약연구과
한약재품질표준화연구사업단 단삼 ( 丹參 ) Salviae Miltiorrhizae Radix 생약연구과 - 1 - KP 11 CP 2015 Salvia miltiorrhizae Radix Salviae Miltiorrhizae Radix et Rhizoma Salvia miltiorrhiza Bunge Salvia miltiorrhiza Bunge salvianolic
이발명을지원한국가연구개발사업 과제고유번호 부처명 농촌진흥청 연구관리전문기관 연구사업명 현장협력기술개발사업 연구과제명 저항성유전자의개발및이용 기여율 주관기관 경희대학교 연구기간 ~
(19) 대한민국특허청 (KR) (12) 공개특허공보 (A) (11) 공개번호 10-2010-0103000 (43) 공개일자 2010년09월27일 (51) Int. Cl. C12N 9/10 (2006.01) C12N 15/54 (2006.01) C07K 14/415 (2006.01) A01H 1/00 (2006.01) (21) 출원번호 10-2009-0021349
l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
03. In011.hwp
V 3+CD4+ T Selective Expansion of TCR V 3+CD4+ T Cells in Collagen-induced Arthritis in DBA/1 Mice Jae Seon Lee, Mi La Cho, Jung Eun Lee, So Youn Min, Chong Hyeon Yoon, Wan Uk Kim, Jun Ki Min, Sung Hwan
5
26 3 (2005 9 ) J Korean Oriental Med 2005;26(3):55-65 The Effcects of Psoraleae fructus Extract on Melanin Synthesis of B16 Melanoma Cells Jae-Ho Chung, Hyung-Sik Seo Dept. of Ophthamology, Otolaryngology
제 1 장연구개발과제의개요 1 (2002 2003) 2 (2003 2004) 3 (2004 2005) 제 2 장국내외기술개발현황 제 3 장종보존을위한동결및해동조건의최적화 μ μ μ μ Survival rate (%) 100 80 60 40 20 0 50%S.W.+DMSO 100%S.W.+DMSO 0 5 10 15 DMSO concentration
untitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
(....).hwp
연구기관 한국식품연구원 농림부 연구기관 한국식품연구원 농림부 Analytical Semi-preparative Solution A 1) Solution B 2) Mixing Spreading Coating medium Corona treated OPP 3) film Casting Drying
45(3)-10(048)p fm
The Korean Journal of Microbiology, Vol. 45, No. 3, September 009, p. 86-90 Copyright 009, The Microbiological Society of Korea s Semi-quantitative RT-PCR w v H9N y» ù» 1 Á Á 3 Á 4 Á x 5 Á 5 Á 5 Á 5 Á«x
- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
Microsoft Word - Genolution RNAi Manual.doc
1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000
NIER-SP 신속한노로바이러스진단을위한검사방법연구 Study for Rapid Diagnostics Methods of Norovirus
11-1480523-002206-01 NIER-SP2014-315 신속한노로바이러스진단을위한검사방법연구 Study for Rapid Diagnostics Methods of Norovirus 제출문 국립환경과학원장귀하 요약문 G.4 type.., rvlp (Recombination Virus-Like Particle). rvlp (hybridization)
ca_02.hwp
SPSPSPSP SPSPSPS SPSPSP SPSPS SPSP SPS 공기청정기 항균필터 SPS - KACA009-139 한국공기청정협회 2002년 12월 31일 제정 2016년 -월 -일 개정예정 http://www.kaca.or.kr 1.1 적용범위 이 표준은 에어필터로 공기중의 입자제거 및 미생물 제균 성능을 지닌 필터에 대하여
3월 온라인 교육
2013 년 2 분기대리점집체교육 - Protein - Takara Korea Biomedical Protein Workflow Chapter 1: 샘플준비 Chapter 2: Electrophoresis -Precast gel (Lonza/NuSep) -ProSieve EX running buffer -Protein marker Chapter 3: Staining
한약재품질표준화연구사업단 강활 ( 羌活 ) Osterici seu Notopterygii Radix et Rhizoma 생약연구과
한약재품질표준화연구사업단 강활 ( 羌活 ) Osterici seu Notopterygii Radix et Rhizoma 생약연구과 - 2 - - 3 - KP 11 Osterici seu Notopterygii Radix et Rhizoma Ostericum koreanum Maximowicz, Notopterygium incisum Ting, Notopterygium
<313630313032C6AFC1FD28B1C7C7F5C1DF292E687770>
양성자가속기연구센터 양성자가속기 개발 및 운영현황 DOI: 10.3938/PhiT.25.001 권혁중 김한성 Development and Operational Status of the Proton Linear Accelerator at the KOMAC Hyeok-Jung KWON and Han-Sung KIM A 100-MeV proton linear accelerator
(....).hwp
sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial
Cloning
Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군
(Establishment and Management of Proteomics Core Facility)
(Establishment and Management of Proteomics Core Facility) 1 sample running on SDS-PAGE Gel (10well) 163570 10 16357 1D size marker 225500 100 2255 Buffer(20X, 500ml) 119900 20 5995 Staining
Can032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
025~038-오공약침의
25 DOI : 10.3831/KPI.2008.11.4.025 A Study on Subchronic Toxicity Test and Method of Increasing Output of Scolopendrid Pharmacopuncture Kim Sung-chul *Dept. of Acupuncture & Moxibustion, Gwang-Ju Oriental
한약재품질표준화연구사업단 작약 ( 芍藥 ) Paeoniae Radix 생약연구과
한약재품질표준화연구사업단 작약 ( 芍藥 ) Paeoniae Radix 생약연구과 - 2 - KP 11 CP 2015 JP 16 Paeoniae Radix Paeoniae Radix Alba Paeoniae Radix Rubra Paeoniae Radix Paeonia lactiflora Pallas paeoniflorin, albiflorin 2.3% Paeonia
TOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme
PCR Enzyme 부터 qpcr 까지! PCR 실험은 TOYOBO 로해결하세요! 행사기간 : 7 월 15 일 ~ 9 월 13 일까지 TOYOBO Reagent PCR Enzyme High Quality PCR Enzyme cdna Synthesis Kit qpcr One-step RT Kit Immunoreaction Enhancer Solution 추가
<C7D1BDC4BFAC20B1E8B5BFBCF6B9DABBE7B4D4676C75636F20C3D6C1BE5B315D2E687770>
Glucomannan 을이용한 기능성소재화연구 Study on the Functional and Processing Properties of Glucomannan for Food Material 연구기관 한국식품개발연구원 농림부 - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12
<C8B2BCBABCF62DB8D4B0C5B8AEBFCDB0C7B0AD2E687770>
먹거리와 건강 황성수 인도주의실천의협의회(humandoctor.org) 황성수 의사님의 글 http://humandoctor.org/technote/main.cgi?board=whang 서적 곰탕이 건강을 말아먹는다 로도 출판되어 있음. lightworker.kr 편집 1. 이 글을 읽는 분들에게 황성수의 먹거리와 건강 을 읽는 모든 분들에게 인사드립니다.
슬라이드 1
LC-MS 단백질분석을위한 SDS-PAGE staining protocol 및주의할점 Proteomics Core Facility 2017.12.28 Contents LC-MS 분석의뢰용 protein SDS-PAGE staining 시주의할점 Coomassie Blue R-250 을이용한 gel staining (general protocol) Coomassie
한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26
2015 한국전지학회 춘계학술대회 2일차 한국전지학회 춘계 학술대회(신소재 및 시장동향 관련 주제 발표) 시간 제목 비고 세션 1 차세대 이차전지용 in-situ 분석기술 좌장 : 윤성훈 09:00~09:30 Real-time & Quantitative Analysis of Li-air Battery Materials by In-situ DEMS 김동욱(한국화학연구원)
Microsoft PowerPoint - Chapter 3-2
Chapter 3 단백질의탐구및단백체학 (3) 겔거르기 (Gel filtration) chromatography: 크기에의한분리 - Resin: 다공성구슬 = Sephadex, Sepharose, Biogel = Bead size: 100 mm - 원리 : 분배 (partition) chromatograph = 분배 : 용질이이동상 (mobile phase)
Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
(079-088)Kjbt015.hwp
대한수혈학회지:제18권 제2호, 2007 다중 단일염기 시발체 확장반응을 이용한 ABO 유전자형 검사 현정원 1 장호은 2 허세란 2 송상훈 1 박경운 1,2 송정한 1,2 한규섭 1 = Abstract = 서울대학교 의과대학 검사의학교실 1, 분당서울대학교병원 진단검사의학과 2 ABO Genotyping using a Multiplex Single-base
316 Research in Plant Disease Vol. 21 No. 4, (Seo, 2009). Enzyme-Linked Immuno Sorbent Assay(ELISA) Reverse Transcription- Polymerase Chain Reaction(R
식물병연구 Research Article Open Access Res. Plant Dis. 21(4) : 315-320(2015) http://dx.doi.org/10.5423/rpd.2015.21.4.315 Reverse transcription Loop-mediated isothermal amplification Soybean mosaic virus Detection
α α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
발간등록번호 11-1470550-000330-01 식품중사용원료진위판별지침서 유전자분석법활용 2013. 12. - 유전자분석법활용 - 발간사 최근부당이익을얻기위하여값싼원료를사용하거나표시사항을허위로기재하는등의불량식품 가짜식품 제조 유통사례가증가하고있는실정입니다. 특히고추양념을혼합한불량고춧가루 다진마늘에양파혼합 홍삼분말에마분말혼합등의사례가언론등을통하여보도되면서식품에대한불안감이있는실정입니다.
슬라이드 제목 없음
물리화학 1 문제풀이 130403 김대형교수님 Chapter 1 Exercise (#1) A sample of 255 mg of neon occupies 3.00 dm 3 at 122K. Use the perfect gas law to calculate the pressure of the gas. Solution 1) The perfect gas law p
fm
J. Fd Hyg. Safety 20(1), 53 57 (2005) Ÿ w y, w s z w Á½ xá Á Á yá v w t œw Antioxidative, Antimutagenic and Cytotoxic Effects of the Mineral Water Seung-shi Ham, Soo-hyun Kim, Seon-young Moon, Mi-Sun Jeon,
Microsoft Word - 04-김택중.doc
J. Exp. Biomed. Sci. 2010, 16(2): 91~95 Anti-inflammatory Properties of Meso-dihydroguaiaretic Acid in Lipopolysaccharide-induced Macrophage Yong-Jae Kim *, Yeo-Jin Kang * and Tack-Joong Kim Division of
DNA의추출 Table 1. Sequences of oligonucleotide primers Primers L1 consensus primer Sequence CGT CCM ARR GGA WAC TGA TC Size of amplified products
KISEP Rhinology Korean J Otolaryngol 2000;43:836-43 비 부비동반전성유두종에서인유두종바이러스및 Epstein-Barr 바이러스의검출과 p53 단백및 Proliferating Cell Nuclear Antigen 의발현 조진희 서병도 전범조 장한성 양명재 윤희로 노우영 Detection of Human Papillomavirus
Western Blot Consumable Best Seller Protein Standards Dual Color All Blue Kaleidoscope TM Dual Xtra Prestained Ch
2018 년 4 월 16 일 ~ 6 월 15 일까지 2018 비엠에스할 인 행 사 AbD Serotec 이 Bio-Rad 와하나가되었습니다. 10,000 여종의 Primary Antibody 를검색해보세요! Western Blot 장비 & 시약 5+2 증정 Western Blot Consumable Best Seller - Protein Standards -
<343920C1F8C0CDB7C42DC7D1B1B9C0CE20BFECBDC4BEC6B5BFC0B8B7CEBACEC5CD2E687770>
한국산학기술학회논문지 Vol. 10, No. 7, pp. 1766-1772, 2009 강경희 1,3, 남진식 2, 진익렬 3* 1 건양대학교치위생학과, 2 수원여자대학식품영양과, 3 경북대학교대학원미생물학과 Expression of Acid Stress-Induced Proteins of Streptococcus mutans Isolated from Korean
06.hwp
-Original Paper-35 41. 2009. 토양으로부터분리한토착유효미생물을이용한음식물쓰레기의자원화 이상우 함선녀 신택수 김혜경 연익준 * 김광렬 * (2008 8 21, 2009 1 23 ) Resource of Food Waste using Indigenous Bacteria Isolated from Soils Sang-Woo Lee Sun Nyeoo
10 (10.1) (10.2),,
Chapter 16 Precipitation Equilibria Copyright 2001 by Harcourt, Inc. All rights reserved. Requests for permission to make copies of any part of the work should be mailed to the following address: Permissions
고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn
TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna
전체 목차 1. 주류 일반 2. 기능성 3. 숙취 4. 주세법 5. 주류 일반 상식 6. 우리술 즐기기
국순당 배중호 대표의 우리 술 강좌 : 백세주 성공신화, 그 비결 전체 목차 1. 주류 일반 2. 기능성 3. 숙취 4. 주세법 5. 주류 일반 상식 6. 우리술 즐기기 1. 주류 일반 술 소비량으로 본 세계지도 집값으로 본 세계지도 군사비 지출로 본 세계지도 1. 주류 일반 주류일반 전통주 정의 전통주 특징 전통주 역사 국순당과 전통주 계승 전통주 담그기
Original Articles Korean Circulation J 2000;30 6 : 심근경색의위험인자로서 Thrombomodulin 유전자변이의의의 박현영 1 김영미 1 권혁문 2 지선하 3 조승연 2 정남식 2 심원흠 2 장양수 2 Genetic
Original Articles Korean Circulation J 2000;306:702-715 심근경색의위험인자로서 Thrombomodulin 유전자변이의의의 박현영 1 김영미 1 권혁문 2 지선하 3 조승연 2 정남식 2 심원흠 2 장양수 2 Genetic Variants of Thromobomodulin Gene as Risk Factors for
歯모유수유지침서.PDF
- - 2002 / 1 / 3 / 3 / 3 / 3 1. 3 2. 7 3. 12 4. 16 5. 18 6. 22 7. 25 / 32 1. 32 2. 70 3. 94 4. 96 5. 99 6. 120 / 121 / 122 < > 1.,,,.,,,,.,,,,.,,. 1960, OECD,..,,,.,,,.,,,,,. 1 2 ( ) ( ), ( ),,,, CD..
Title: Biacore getting started kit 를이용한 KD 값도출방법 목차 1. 실험목적 2. 실험개요와필요한시약및소모품 2.1 실험개요 2.2 필요한시약및소모품 3. 실험방법과결과 3.1 ph-scouting for pre-concentration
Title: Biacore getting started kit 를이용한 KD 값도출방법 목차 1. 실험목적 2. 실험개요와필요한시약및소모품 2.1 실험개요 2.2 필요한시약및소모품 3. 실험방법과결과 3.1 ph-scouting for pre-concentration 3.2 Immobilization 3.3 Regeneration scouting 3.4 Interaction
1 1 10-0767050 2 10-1166045 3 10-0895586 4- - 10 4 10-1616887 11 5 10-1358259 12 6 10-0775080 7 10-0973839 8 10-1165269 15 9 10-1056952 16 10 10-1551559 11 10-1179175 12 10-1179177 19 13 10-1136822 20
2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.
2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.8.1. OIE 2012 ver. - EU ASF reference lab CISA-INIA(Spain)
주의내용 주 의 1. 이보고서는질병관리본부에서시행한학술연구용역사업의최종결 과보고서입니다. 2. 이보고서내용을발표할때에는반드시질병관리본부에서시행한 학술연구용역사업의연구결과임을밝혀야합니다. 3. 국가과학기술기밀유지에필요한내용은대외적으로발표또는공개 하여서는아니됩니다.
편집순서 1 : 겉표지 학술연구용역사업최종결과보고서 과 원외폐렴원인균조사및내성감시 시스템구축 주의 ( 주의내용기재 ) ( 글 14 point 고딕체 ) 제명 2 0 0 Microbiological Etiology of Community acquired pneumonia and Surveillance network of resistance 주관연구기관 : 울산대학교의과대학
Development of Genetic Resources and Breeding of High Value Lines in Codonopsis lanceolata
Development of Genetic Resources and Breeding of High Value Lines in Codonopsis lanceolata . 2000. 12. 15. : : : : : : : : : - i - . :..,., 40.,,,, (, ),,,,,. Saponin, Inulin, Triterpene,,,. (C. lanceolata),
,,,,,,,, (), BOD,,,,,,,,,
- 1 - ,,,,,,,, (), BOD,,,,,,,,, - 2 - - 3 - 3) 4) 5) 6) 7) - 4 - - 5 - (Analytical Spectrum) 1 Biosensors 2 Electro Analysis 3 Environmental 4 Drug Discovery 5 Food Quality and Safety 6 Gas and Liquid-phase
Introduction 신뢰성 있는 결과 높은 품질의 제품을 생산하기 위해서는 제품의 공정 시스템이 중요 품질관리실험실은 품질보증과정에서 매우 중요한 역할 분석시스템은 품질관리실험실의 매우 중요한 요소 분석시스템의 결과를 기본으로 하여 제품의 품질을 결정 R&D 실험실
적정의 올바른 분석방법 Kopack Seminar May 2012 Agenda Introduction Risks and Measures Summary 1 1 Introduction 신뢰성 있는 결과 높은 품질의 제품을 생산하기 위해서는 제품의 공정 시스템이 중요 품질관리실험실은 품질보증과정에서 매우 중요한 역할 분석시스템은 품질관리실험실의 매우 중요한 요소
한약재품질표준화연구사업단 금은화 ( 金銀花 ) Lonicerae Flos 생약연구과
한약재품질표준화연구사업단 금은화 ( 金銀花 ) Lonicerae Flos 생약연구과 - 2 - KP 11 Lonicerae Flos Lonicera japonica Thunberg - CP 2015 JP 16 Lonicerae Japonicae Flos Lonicerae Folium Cum Caulis Lonicera japonica Thunberg - Lonicera
lastreprt(....).hwp
pheophytin Jukart.. 서론 재료및방법 . 650 nm (10). 3. 124 15 3 68 2 3 124 2, 3, 43 5, 5 23 (5). 4. 5 4 5 53. 650 nm (10),..,. 16 pheophytin Jukart.. IC 50 1mg/ml.. pheophytin Jukart.. IC 50 1mg/ml.
_....
2009 I Winter PLASTICS news HANWHA CHEMICAL CORPORATION http://hcc.hanwha.co.kr CONTENTS 04 08 24 42 50 62 74 2009 WINTER 3 2009 Winter HANWHA NEWS 4 PLASTICS NEWS 2009 WINTER 5 2009 Winter HANWHA NEWS
Microsoft PowerPoint - d ppt [호환 모드]
전기영동 ( SDS-PAGE ) 개 요 전기영동과그목적 실험전준비 실험과정 실험결과및분석 전기영동과그목적 전기영동 단백질의순도나성질의분석및분리등에사용하는방법 -> 단백질의정성적인분석 SDS-PAGE ( Sodium Dodecyl Sulphate Polyacrylamide Gel Electrophoresis ) : SDS 와 Polyacrylamide 를사용한전기영동전기영동의목적
Subject : 귀사의 일익번창하심을 진심으로 기원합니다.
1. 18 D-303 Tel : () 031-711-1560 Fax : 031-711-1563 www.iontec.co.kr e-mail : ion@iontec.co.kr (organic reaction). (esterification) (hydrolysis of ester). Porous type (alkylation) system. ( gel type ).
Alloy Group Material Al 1000,,, Cu Mg 2000 ( 2219 ) Rivet, Mn 3000 Al,,, Si 4000 Mg 5000 Mg Si 6000, Zn 7000, Mg Table 2 Al (%
http://wwwtechnonetcokr (Aluminum & Aluminum BasedAlloy) : LG 1 Aluminum Table 1, 2 1000 7000 4 Al 990% Al 1XXX AlCu 2XXX AlMn 3XXX AlSi 4XXX AlMg 5XXX AlMgSi 6XXX AlZn(Mg, Cu) 7XXX 8XXX ( ) 9XXX Fig 1
Pierce-Plus-Alpha.pdf
Save 40% on antibodies Primary antibody 전제품 40% 할인가로만나보세요 Count on Invitrogen 42,000 antibodies highly validated primary and secondary antibodies in our portfolio and growing 4,500 primary conjugated antibodies
[ 화학 ] 과학고 R&E 결과보고서 나노입자의표면증강을이용한 태양전지의효율증가 연구기간 : ~ 연구책임자 : 김주래 ( 서울과학고물리화학과 ) 지도교사 : 참여학생 : 원승환 ( 서울과학고 2학년 ) 이윤재 ( 서울과학고 2학년 ) 임종
[ 화학 ] 과학고 R&E 결과보고서 나노입자의표면증강을이용한 태양전지의효율증가 연구기간 : 2013. 3 ~ 2013. 12 연구책임자 : 김주래 ( 서울과학고물리화학과 ) 지도교사 : 참여학생 : 원승환 ( 서울과학고 2학년 ) 이윤재 ( 서울과학고 2학년 ) 임종찬 ( 서울과학고 2학년 ) 소재원 ( 서울과학고 2학년 ) 1,.,.,.... surface
성공적인 Western Blot 을위한 Total Solution 기간 : 2013 년 4 월 22 일 ~ 6 월 14 일 Mini-PROTEAN Tetra & Power Supply 구매시, 전기영동 Plastic 소모품, Acrylamide/Bis Solution
성공적인 Western Blot 을위한 Total Solution 기간 : 2013 년 4 월 22 일 ~ 6 월 14 일 Mini-PROTEAN Tetra & Power Supply 구매시, 전기영동 Plastic 소모품, Acrylamide/Bis Solution TGX Gel 6 box 구매시, 전기영동장치 LaboGene tube 50 ml 1 box
Microsoft Word doc
KISEP Rhinology Korean J Otolaryngol 2006;49:307-12 사람정상코점막상피세포에서겔형성점소 (Gel-Forming Mucin) 분비에대한 Prostaglandin E 2 의효과 김진국 1 김창훈 2,3 김규보 2 장현종 1 김현직 2 윤주헌 2,3,4 Effect of Prostaglandin E 2 on Gel-forming
01 Automated Protein Expression and Purification: ExiProgen Selection Guide 3 Protein Synthesis Kit ExiProgen EC Protein Synthesis Kit 4 ExiProgen EC-
Automated Protein Expression and Purification: ExiProgen TM Manual Protein Expression and Purification: AccuRapid TM & MagListo TM Preparation of Template DNA for Protein Expression Protein Service Protein
( )Jkstro011.hwp
비인강암의방사선치료결과및생존율에관한예후인자분석 2005 2 1 2005 3 28. :, Tel: 053)250-7665, Fax: 053)250-7984 E-mail: jhkim@dsmc.or.kr 정영연외 2 인 : 비인강암의예후인자분석 정영연외 2 인 : 비인강암의예후인자분석 Carcinoma of the nasopharynx treated by radiotherapy
歯49손욱.PDF
2002 14 C Inventory An Estimation of 14 C Inventory on Each Unit of Wolsong NPP,,, 103-16 14 C 14 C Inventory 14 C Inventory 14 C 14 C, [Inventory] = [ 14 C ] - [ 14 C ] 14 C 14 C 13 C, 14 N 17 O [ 13
歯Trap관련.PDF
Rev 1 Steam Trap Date `000208 Page 1 of 18 1 2 2 Application Definition 2 21 Drip Trap, Tracer Trap, 2 22 Steam Trap 3 3 Steam Trap 7 4 Steam Trap Sizing 8 41 Drip Trap 8 42 Tracer Trap 8 43 Process Trap
25(6)-21(김유곤).fm
Printed in the Republic of Korea "/"-:5*$"- 4$*&/$& 5&$)/0-0(: Vol. 25, No. 6, 483-491, 2012 http://dx.doi.org/10.5806/ast.2012.25.6.483 Study on stability test of in process sample of recombinant Protein
Electropure EDI OEM Presentation
Electro Deionization: EDI Systems. Electro Pure EDI, Inc.: High technology water tm www.cswaters.co.kr : EDI Electro Deionization 1. EDI Pure Water System? 2. EDI? 3. EDI? 4. EDI? 5. EDI? Slide 2 EDI 1.
, 2 4 Ⅰ, Ⅱ 2013,,. Bio-ethanol, 2013 STEAM R&E Stropharia rugosoannulata Bio-ethanol Bio-ethanol ISEF-K Cellulose Bio-ethanol
1. 2010 6 1, 2 4 Ⅰ, Ⅱ 2013,,. Bio-ethanol, 2013 STEAM R&E Stropharia rugosoannulata Bio-ethanol Bio-ethanol 30 2014 ISEF-K. 2014 Cellulose Bio-ethanol., Bio-ethanol,. 2010 10 ABS(Access to genetic resource
2011 I Summer PLASTICS news HANWHA CHEMICAL CORPORATION http://hcc.hanwha.co.kr CONTENTS 04 10 31 45 70 74 85 2011 SUMMER 3 2011 Summer HANWHA NEWS 4 PLASTICS NEWS 2011 SUMMER 5 2011 Summer HANWHA NEWS
2011 I Winter PLASTICS news HANWHA CHEMICAL CORPORATION http://hcc.hanwha.co.kr CONTENTS 04 08 27 40 59 64 75 2011 WINTER 3 2011 Winter HANWHA NEWS 4 PLASTICS NEWS 2011 WINTER 5 2011 Winter HANWHA NEWS
01 Automated Protein Expression and Purification Using ExiProgen Selection Guide 267 ExiProgen EC Protein Synthesis Kit 268 ExiProgen EC-Maxi Protein
Automated Protein Expression and Purification Using ExiProgenTM Manual Protein Expression and Purification Preparation of Template DNA for Protein Expression Protein Service Protein Expression and Purification
발간등록번호 상황버섯으로유도된 FMO3 와 Corin 에의한 농약분해및혈압저하유도
발간등록번호 11-1543000-002003-01 상황버섯으로유도된 FMO3 와 Corin 에의한 농약분해및혈압저하유도 농림축산식품부장관귀하 본보고서를 상황버섯으로유도된 FMO3 와 Corin 에의한농약분해및혈압저하유도 ( 개발기 간 :2014. 09. ~ 2017. 09.) 과제의최종보고서로제출합니다. 2017. 11.. 주관연구기관명 : 서울시립대학교산학협력단
40.6-(15) fm
KOREAN J. FOOD SCI. TECHNOL. Vol. 40, No. 6, pp. 696~701 (008) The Korean Society of Food Science and Technology HepG s p l p z w y z w s y z ½ xá x Á xká 1 Á v Áw * w t œw œ, 1 w BK1 ( p pf ), w w t ww
한수지 51(2), , 2018 Original Article Korean J Fish Aquat Sci 51(2), ,2018 쏙 (Upogebia major) 효소가수분해물의면역증강효과 이지현 양지은 송재희 1 맹상현 김소연 윤나영 * 국립수
한수지 51(2), 135141, 18 Original Article Korean J Fish Aquat Sci 51(2),135141,18 쏙 (Upogebia major) 효소가수분해물의면역증강효과 이지현 양지은 송재희 1 맹상현 김소연 윤나영 국립수산과학원식품위생가공과, 1 서해수산연구소갯벌연구센터 Immunopotentiating Activities
(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re
EMF Health Effect 2003 10 20 21-29 2-10 - - ( ) area spot measurement - - 1 (Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern
환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
증정 Bio-Rad 가제안하는 FAST Western Blot! FAST Western Blot 기존 acrylamide/bis solution FastCast TM TGX acrylamide solution Gel 준비 (Gel solution 준비 - casting
Bio-Rad 연말할인행사 기간 : 2015 년 10 월 19 일 ~ 12 월 18 일까지 FAST Western Blot Best Western Blot 을위한시약 & 소모품 Real-Time PCR Reagents 행사제품 400 만원이상구매시, Integra PIPETBOY ACU 증정 ( 색상랜덤 ) 증정다양한 application 에따라흡입 / 분주속도조절가능
05052유식안101.hwp
제 출 문 식품의약품안전청장 귀 하 이 보고서를 유전자재조합식품 모니터링(부산광역시보건환경연구원/정구영) 과제의 연구 결과보고서로 제출합니다. 2005. 11. 30 주관연구기관명 : 부산광역시보건환경연구원 주관연구책임자 : 정구영 목 차 Ⅰ. 연구개발결과 요약문----------------------------------- 1 (한글)------------------------------------------
뉴스지14호-칼라
2 3 4 5 6 TaKaRa Taq TM / TaKaRa Ex Taq TM / TaKaRa LA Taq TM / Pyrobest TM DNA Polymerase/ TaKaRa Z -Taq TM TaKaRa Taq TM TaKaRa Ex Taq TM TaKaRa LA Taq TM TaKaRa Z-Taq TM Pyrobest TM DNA Polymerase 7
슬라이드 1
EVENT 퀴아젠인기상품연말특별가전 200203 Top Taq DNA Polymerase (250U) 90,000 72,000 200205 Top Taq DNA Polymerase (1000U) 331,000 281,350 200403 Top Taq Master Mix Kit(250U) 104,000 83,200 201203 Taq DNA Polymerase
석사논문.PDF
ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh
SMARTer 시리즈
SMARTer 시리즈 SMARTer Solutions 2014.12.17 다카라코리아바이오메디칼 SMART 하게실험하고 SMARTer 한결과를얻는방법 Clontech SMARTer 시리즈 Contents 1. Introduction 1. 역전사반응이란? 2. 기존역전사반응의한계 2. SMARTer 시리즈 1. SMARTer 란? 2. SMARTer 시리즈와적용