Journal of Bacteriology and Virology 2013. Vol. 43, No. 2 p.99 110 http://dx.doi.org/10.4167/jbv.2013.43.2.99 Original Article Characterization of Community-Associated Methicillin-Resistant Staphylococcus aureus in Gwangju, Korea Hye-Young Kee, Min Ji Kim, Sun Hee Kim, Se Mi Lee, Sun Kyoung Kim, Dong-Ryong Ha, Eun Sun Kim and Jae Keun Chung * Health Research Department, Health and Environment Institute of Gwangju, Gwangju, Korea Methicillin-resistant Staphylococcus aureus (MRSA) is one of the most important nosocomial pathogens worldwide. This study was performed to investigate the characterization of MRSA isolated from healthy persons in Gwangju area. A total of 404 nasal swab samples was collected during October 2011 and May 2012 in Gwangu, Korea. A survey on MRSA was conducted with meat distributors (n=230), pre-school children (n=108), officers (n=66), respectively. To confirm the MRSA, polymerase chain reaction (PCR) for the S. aureus specific gene and meca gene was performed. A total of 34 (8.4%) MRSA isolates was isolated from 404 nasal swab samples: 6.1% (14/230) from meat distributors, 16.7% (18/108) from pre-school children, and 3.0% (2/66) from officers samples, respectively. The most prevalent antimicrobial resistance observed in the MRSA isolates was to ampicillin 100% (34/34), followed by penicillin 97.1% (33/34), oxacillin 94.1% (32/34) and erythromycin 52.9% (18/34). All MRSA isolates were then characterized by panton-valentine leukocidin (pvl) gene detected by PCR, staphylococcal cassette chromosome mec (SCCmec) typing, and pulsed-field gel electrophoresis (PFGE) with Sma I digestion. 34 MRSA isolates from nasal carriage were pvl gene negative, SCCmec type IV; 73.5% (25/34), type II; 17.6% (6/34), type III; 2.9% (1/34), and untypable; 5.9% (2/34), respectively. 34 MRSA isolates showed 16 PFGE patterns. These results indicated that isolation rates of communityassociated methicillin-resistant S. aureus (CA-MRSA) from healthy persons were low (8.4%), but continuous surveillance and monitoring should be performed to prevent the spread of MRSA in the community. Key Words: Community-associated methicillin-resistant S. aureus, meca gene, Staphylococcal cassette chromosome mec type, Pulsed-field gel electrophoresis 서론황색포도알균 (Staphylococcus aureus) 은그람양성알균으로병원성이강하고조직침습성이높아사람과동물에화농성질환, 패혈증, 뇌수막염및식중독등을일으키는것으로알려져있다 (1). 황색포도알균의치료를위해 1960년에메티실린이개발되어이용되었으나, 항생제의빈번한사용으로 1961년영국에서 methicillin-resistant S. aureus (MRSA) 가처음보고된후세계여러나라에서보고되었다 (2). 우리나라에서도 1960년대이전에는 MRSA 가분리되었다는보고가없었으나, 1980년대부터시작해현재국내 3차의료기관에서분리되는황색포도알균중 MRSA의비율이 70~80% 를넘는다고보고되었다 (3, 4). MRSA는항생제를많이사용하는병원환경이나기구를통해얻게되는대표적인병원내감염으로 (healthcareassociated MRSA, HA-MRSA), 지역사회에서는보균율이낮고감염을잘일으키지않는것으로알려져있다 (5). Received: March 19, 2013/ Revised: May 21, 2013/ Accepted: May 24, 2013 * Corresponding author: Jae Keun Chung. Health & Environment Institute of Gwangju, 898 Hwajung-dong, Seo-gu, Gwangju 502-837, Korea. Phone: +82-62-613-7540, Fax: +82-62-613-7549, e-mail: jkchung@korea.kr ** This research was supported by Health & Environment Institute of Gwangju Metropolitan City. CC This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/license/by-nc/3.0/). 99
100 H-Y Kee, et al. 그러나, 최근외국에서는 MRSA 감염의위험인자가없는사람에서 MRSA 감염이지속적으로증가하는것으로보고되고있다 (6). 이중폐렴이나패혈증등감염의중등도가심각한사례도발생하는것으로나타나 (7), 지역사회관련메티실린내성황색포도알균 (communityassociated MRSA, CA-MRSA) 의역학적변화에대한관심이점차커져가고있는실정이다. MRSA는 β-lactamase에안정하도록개발된항생제인메티실린에내성을보일뿐아니라세파계항생제등 β-lactam을기본구조로하는대다수의 β-lactam계항생제및 aminoglycoside, macrolide, quinolone 등거의모든종류의항생제에대해광범위한내성을나타내는경우가많아보건및건강분야에서중요한문제로대두되고있다 (8). 또한, MRSA에감염되면사용할수있는항생제가극히제한되므로치료에어려움을겪을수있으며심한경우생명이위태로울수도있어사회적문제를야기할수있다. MRSA의내성기전은 β-lactam 계열항생제에대한친화성이낮은 penicillin-binding protein 2a (PBP 2a) 의유도생산에의한것으로황색포도알균유전체중 Staphylococcal cassette chromosome mec (SCCmec) 이라는이동성유전자에위치한 meca 유전자에의해결정된다 (9). SCCmec 유전자복합체는 meca 유전자복합체와 chromosomal cassette recombinase (ccr) 유전자복합체를포함한여러인자의조합에따라 5가지 SCCmec type (I~V) 과여러가지아형으로분류한다 (10~12). 또한 HA- MRSA와 CA-MRSA에따라 SCCmec type간에차이가있어 MRSA 균주의역학관계를파악하는데많이이용되고있다 (13, 14). 최근국내에서는다양한황색포도알균감염사례들이보고되고있으며, 황색포도알균감염증의후향적연구등을통해의료기관과관련한위험인자가없는 CA-MRSA 발생에관한연구가활발히진행되고있으며 (15, 16), HA-MRSA와 CA-MRSA간의연관관계를규명하고자하는연구들이수행되고있다. 따라서, 본연구에서는광주지역에거주하는건강인의비강에존재하는황색포도알균을분리하여 MRSA 분포양상과항생제내성및특성을조사함으로써, 주변에상재되어있을것으로예상되는 CA-MRSA 감염증에대한체계적인연구와 MRSA균관리를위한기초자료로활용하고자하였다. 재료및방법검체채취및전처리 2011년 11월부터 2012년 5월까지광주지역축산업종사자 230명, 취학전아동 108명, 사무직종사자 66명등 404명을대상으로연구참여협조를요청하였고, 참여의사를밝힌사람을대상으로연령, 성별등의자료를작성하였다. 검체채취는비강양쪽에서 Amies transport medium (Yuhan Lab tech, Korea) 을이용하여비강분비물을충분히묻힌후채취하였으며, 채취한검체는가능한 2시간이내에냉장상태를유지하여운반한후즉시실험하였다. MRSA균분리동정균분리동정면봉을이용하여채취한검체를 NaCl (6.5%) 이함유된 muller hinton broth (MHB, Oxoid, England) 에접종하여 37, 16~20시간동안 1차배양하였다. 배양된균액은 cefoxitin (3.5 mg/l) 이함유된 9 ml의 tryptic soy broth (TSB, Oxoid, England) 에 1 ml을접종하여 37, 16~20시간동안 2차증균배양하였다. 2차배양균액을백금이로 chromogenic MRSA agar (Oxoid, Hampshire, UK) 에도말배양후형태, 색깔등이의심되는 colony를시료당 4개이상을선택하여 tryptic soy agar (TSA, Oxoid, England) 에 37, 16~20시간동안순수배양하였다. 배양된균주에대하여황색포도알균균종확인검사를하였고, 특이 primer를이용한 PCR법 (17) 을이용하여최종확인하였다. 유전자확인시험순수분리된 MRSA 균주의단독 colony를각각 tryptic soy agar (TSA, Oxoid, England) 에 37, 24시간동안계대배양한다음, 일정량의특이집락을멸균증류수 1 ml에현탁시키고 14,000 rpm에서 5분간원심분리한후상층액을버리고 0.5 ml의멸균증류수를첨가하여완전히현탁시켰다. 이를끓는물에서 10분간중탕하여세포를완전히파쇄하였고, 14,000 rpm에서 10분간원심분리한후그상층액을 template DNA로사용하였다. meca 내성유전자의검출은 Mason 등 (17) 의방법에따라실험하였으며, polymerase chain reaction (PCR) 반응후, 최종산물의확인은반응액 5 μl를취하여 2% agarose gel에전기영동한후 ethidium bromide (EtBr) 로염색하여
Characterization of CA-MRSA in Gwangju 101 Table 1. Primers used in the multiplex polymerase chain reaction (PCR) Name SCCmec a primer Sequence (5' 3') Target Length SCCmec a type B ATTGCCTTGATAATAGCCYTCT ccras-b 937 bp II, IV a3 TAAAGGCATCAATGCACAAACACT ccrc 518 bp III, V IS1272 415 bp I, IV meca/is431 359 bp V Name PVL b toxin primer Sequence (5' 3') Length 433 bp a Staphylococcal cassette chromosome mec, b panton-valentine leukocidin ccrcf 1272F1 5RmecA luk-pv-1 CGTCTATTACAAGATGTTAAGGATAAT GCCACTCATAACATATGGAA TATACCAAACCCGACAACTAC ATCATTAGGTAAAATGTCTGGACATGATCCA ccrcr 1272R1 5R431 luk-pv-2 CCTTTATAGACTGGATTATTCAAAATAT CATCCGAGTGAAACCCAAA CGGCTACAGTGATAACATCC GCATCAASTGTATTGGATAGCAAAAGC ultra violet (UV) 하에서확인하였다. 항생제감수성검사확인된 MRSA 균주의항생제감수성시험은 Kirby- Bauer의 Disc diffusion method (18) 로실험하였다. 먼저 tryptic soy agar (TSA, Oxoid, England) 에서균이순수분리되었음을확인한후탁도계를이용하여균액을 McFarland 0.5로조정하여보정된균액을 muller hinton agar (MHA, Oxoid, England) 에면봉으로골고루도말한후, 디스펜서를이용하여항생제디스크를접종하고 37 에서 18~24시간동안배양하였다. 판독은 Clinical and Laboratory Standards Institute M100-S20 (CLSI, 2008) 기준에따라균억제대를측정하여감수성여부를확인하였다. 시험에사용한항생제 (BD; Becton Dickinson and Company, Cockeysville, MD) 의종류는다음과같다. ampicillin (AM, 10 μg), cefepime (FEP, 30 μg), cefotetan (CTT, 30 μg), ciprofloxacine (CIP, 5 μg), chloramphenicol (C, 30 μg), clindamycin (CC, 2 μg), erythromycin (E, 15 μg), amikacin (CN, 10 μg), imipenem (IPM, 10 μg), oxacillin (OX, 1 μg), penicillin (P, 10 unit), rifampin (RA, 5 μg), tetracycline (TE, 30 μg), trimethoprim/sulfamethoxazole (SXT, 1.25 μg/23.75 μg), vancomycin (Va, 30 μg), cefoxitin (FOX, 30 μg), ceftriaxone (CRO, 30 μg), telithromycin (TEL, 15 μg), amoxicillin/ clavulanic (AmC, 20 μg/10 μg), linenzolid (LZD, 30 μg), cephalothin (CF, 30 μg) 등 21종을사용하였다. MRSA로 확인된균주에대하여 E-test strips (AB BioDisk, Solona, Sweden) 을사용하여 oxacillin (6 μg/ml, Sigma, USA) 의최소억제농도 (MIC) 를검사하였고, S. aureus ATCC 25923을 positive control로사용하였다 (19). MRSA균유전학적특성조사 Staphylococcal cassette chromosome mec (SCCmec) type 분석 MRSA로확인된균주들에대한 SCCmec type 분석은 multiplex PCR법 (20) 을이용하여 Table 1과같이 I-V형의 type을결정하였다. PCR 기기는 GeneAmp PCR system 9700 (Applied Biosystems, MA, USA) 을이용하여 94 에서 4분간 denaturation 후 94 /30초, 53 /30초, 72 /1분의 cycle을 30회실시하고, 72 에서 4분간반응시켰다. PCR 을수행한후 5 μl의 PCR 산물을 2% agarose gel에전기영동한후 EtBr로염색하여 UV 하에서확인하였다. MRSA 독소유전자검출분리된 MRSA로부터병독소유전자인 Panton-Valentine Leukocidin (PVL) 독소를검출하기위해 Lina 등 (21) 의방법에따라실험하였다 (Table 1). PCR 조건은 95 에서 5분간 denaturation 후, 95 /30초, 50 /30초, 72 /1분의 cycle을 35회실시하고, 72 에서 5분간반응시켰다. PCR 을수행한후 5 μl의 PCR 산물을 2% agarose gel에전기영동한후 EtBr로염색하여 UV 하에서확인하였다.
102 H-Y Kee, et al. Pulsed-Field Gel Electrophoresis (PFGE) PulseNet Korea network에서사용되는표준시험법으로미국통제예방센터 (CDC; Centers for Disaease Control and Prevention) 의 PulseNet USA와아시아지역 13개국이참여하는 PulseNet Asia Pacific의표준시험법을근간으로제한효소 Sma I (5,000 U, Roche, Penzberg, Germany) 을사용하였다. Agarose plug의제조순수분리된균을 tryptic soy agar (TSA, Oxoid, England) 에접종하여, 표준균주 (Salmonella Breandrup, BAA-664) 와함께 37 에서 16~18시간동안배양하여실험에사용하였다. 1.2% plug용 agarose solution (Seakem gold agarose, Cambrex, Rockland, ME, USA), plug wash TE buffer를 55 항온수조에보관하고, 균주 1개당 12 75 mm 폴리에틸렌튜브 1개, 1.5 ml 용량의 microcentrifuge 튜브각 2개, plug mold (Biorad, Hercules, CA, USA) 2 well 씩준비하였다. 폴리에틸렌튜브에 2 ml의 cell suspension TE buffer 를넣고멸균면봉을사용하여 TSA 평판배지로부터균을묻혀 15~20% 의투명도로부유시켰다. 균현탁액 170 μl, lysostaphin (Sigma, USA) 20 μl, lysozyme (Sigma, USA) 10 μl 를잘혼합하여 37 에서 10분간반응한후, proteinase K (20 mg/ml, Invitrogen, Carlsbad, CA, USA) 를첨가하여 micropipette으로천천히 4회정도섞은후바로 plug mold 에넣었다. 섞는횟수를늘리거나거칠게섞을경우에는선명한결과를얻는데방해되므로주의하면서섞어주었다. Plug mold를 4 에서 5분정도굳히면서 ES buffer 1.5 ml과 proteinase K (20 mg/ml, Invitrogen, Carlsbad, CA, USA) 40 μl를 2 ml microcentrifuge tube에준비하였다. Plug lysis 및세척굳은 plug를 plug mold에서꺼내어미리준비해둔 ES buffer로옮기고 96 well microcentrifuge rack에꽂아뚜껑을덮었다. 55 진탕항온수조에 rack을잘고정시킨후 tube가물속에완전히잠기도록하여 150~175 rpm으로 1~1.5시간방치하였다. Plug 세척을위하여 lysis가끝난 plug를 screen cap (Biorad, Hercules, CA, USA) 에옮기고이것들을연결하여플라스틱밀폐용기에넣고 20분동안 5회반복하여세척하였다. 이때밀폐용기가물속에완전히잠기도록하고 150~175 rpm으로 20분을넘기지않도록하였다. 세척이끝난 plug는 2 ml microcentrifuge tube 에 plug wash TE buffer를 1.5 ml씩넣고 4 에보관하거나다음단계로진행하였다. 제한효소처리세척이끝난 plug를슬라이드글라스위에올려놓고 70% 에탄올로닦은 razor blades를이용하여 1 mm 두께로자른다음, 자른절편 2개를 1.5 ml microcentrifuge tube에옮겨 100 μl의제한효소반응액을넣고 37 항온수조에서 4시간동안반응시켰다. 제한효소반응액의조성은 10 restriction enzyme buffer 10 μl, 100 BSA 1 μl, Sma I 40 unit (Roche, Penzberg, Germany) 에멸균증류수를이용하여최종 100 μl를맞추었다. 반응이끝나면제한효소반응액을제거하고 TE buffer를 200 μl를채워넣었다. 전기영동 0.5 TBE (Bioneer, Daejeon, Korea) 를사용하여 1% agarose solution을 gel 크기에맞추어녹여서 55 항온수조에보관하고, 제한효소처리가끝난 plug 절편을꺼내어 agarose gel 성형용 comb (Biorad) 의끝부위에맞춰올려놓은다음여과지로주변의물기를제거하였다. plug가 comb의 lane 끝에일직선이되도록잘배치하여상온에서 2분정도추가로건조시키고항온수조에보관한 1% agarose solution을꺼내어 gel 성형틀안에부었다. 이때 agarose solution을약 1~2 ml 정도남겨서다시항온수조에보관하였다. Gel 성형틀에 plug 절편이붙어있는 comb을제자리에위치시키고, gel을상온에서 30분정도굳힌후 comb을뽑아냈다. Comb에의해만들어진 well에남아있는소량의 agarose solution을넣어채웠다. 이렇게만들어진 gel을 CHEF-Mapper system (Biorad, USA) 을이용하여 0.5 TBE, 6 V/cm, 14 에서 initial time 5.16 초, final time 40.17초의조건으로 18시간동안전기영동하였다. 전기영동이완료되면 500 ml의 EtBr (0.5 μg/ml) 에 gel을넣어 15~20분염색하고, 증류수를이용하여매회 30분씩 2회탈색하였다. 염색및탈색단계는모두빛이차단된상태에서실시하였다. Dendrogram 작성 PFGE 결과는 Tenover 등 (22) 의방법에따라각각의 DNA 위치가다른절편의수에따라서 group을결정하였고, DNA 절편유형을 software Bionumerics version 5.0으로분석하였다. 또한 Dice coefficient similarity (tolerance, 1.5%) 로 Unweighted Pair Group Method with Arithmetic mean (UPGMA) 법에의하여 dendrogram을작성하여균주간의상관관계를비교분석하였다.
Characterization of CA-MRSA in Gwangju 103 Table 2. Prevalence of community-associated methicillin-resistant S. aureus (CA-MRSA) isolates from meat distributors, pre-school children and officers Total Meat distributors Pre-school children Officers No. of positive samples / No. of samples (%) No. of samples No. of positive samples (%) No. of samples No. of positive samples (%) No. of samples No. of positive samples (%) Male 16/210 (7.6) 119 10 (8.4) 56 6 (10.7) 35 0 (0) Female 18/194 (9.3) 111 4 (3.6) 52 12 (23.1) 31 2 (6.5) Total 34/404 (8.4) 230 14 (6.1) 108 18 (16.7) 66 2 (3.03) Figure 1. Antimicrobial resistance patterns of community-associated methicillin-resistant S. aureus (CA-MRSA) isolates. S, susceptible; I, intermediate; R, resistant; AM ampicillin; FEP cefepime; CTT cefotetan; CIP ciprofloxacinem; C chloramphenicol; CC clindamycin; E erythromycin; CN amikacin; IPM imipenem; OX oxacillin; P penicillin; RA rifampin; TE tetracycline; SXT trimethoprim/sulfamethoxazole; VA vancomycin; FOX cefoxitin; CRO ceftriaxone; TEL telithromycin; AmC amoxicillin/clavulanic; LZD linenzolid; KF, cephalothin 결과 MRSA균분리광주지역에거주하는 404명의비강도말액을대상으로선택배지를이용하여 MRSA를동정한결과 34주 (8.4%) 가분리되었고, 동정된모든균주에서 MRSA 특이유전자인 clfa와 methicillin 내성에관여하는유전자인 meca 를확인하였다. 이를직업군별로살펴보면축산업종사자 230명중 14주 (6.1%), 취학전아동 108명중 18주 (16.7%), 사무직종사자 66명중 2주 (3.03%) 가분리되었다 (Table 2). 항생제감수성검사 MRSA로동정된 34주에대한항생제감수성검사결 과, ampicillin의내성률이 100%(34주 ) 로가장높게나타났고. 그외 penicillin 97.1%(33주 ), oxacillin 94.1%(32주 ), erythromycin 52.9%(18주 ) 의순으로나타났다 (Fig. 1). Cephalosporin 계열항생제내성은 cefoxitin 94.1%(32 주 ), cefotetan 91.2%(31주 ) 로강한내성을보였으며, ceftriaxone 73.5%(25주 ), cephalothin은 26.5%(9주 ) 의내성을보여내성률분포에뚜렷한차이를보였다. 그러나 chloramphenicol, trimethoprim/sulfamethoxazole, imipenem, rifampin, vancomycin, linenzolid 등 6가지항생제에서는전혀내성이관찰되지않았다. 항생제내성양상으로는항생제 1제내성률 2.9%(1주 ), 4제내성률 2.9%(1주 ), 6제내성률 2.9%(1주 ), 8제내성률 23.5%(8주 ), 9제내성률 41.2%(14주 ), 10제내성률 20.6% (7주), 11제내성률 5.9%(2주 ) 순으로나타났다. 즉, 1개균주를제외한모든균주가항생제 2제이상에내성을
104 H-Y Kee, et al. Table 3. Antimicrobial resistance patterns of community-associated methicillin-resistant S. aureus (CA-MRSA) isolates No. of antimicrobials Resistance Patterns No. of isolates (%) 1 AM 1 (2.9) 4 AMP-E-P-AMC 1 (2.9) 6 AMP-CTT-CN-OX-P-FOX 1 (2.9) 8 AMP-FEP-CTT-OX-P-FOX-CRO-AMC 8 (23.5) subtotal 14 (41.2) 9 10 AMP-CIP-DA-E-OX-P-TE-FOX-TEL 1 (2.9) AMP-CTT-DA-E-CN-OX-P-FOX-TEL 2 (5.9) AMP-CTT-DA-E-CN-OX-P-FOX-TEL 1 (2.9) AMP-FEP-CTT-E-OX-P-FOX-CRO-AMC 5 (14.7) AMP-FEP-CTT-OX-P-FOX-CRO-AMC 1 (2.9) AMP-FEP-CTT-OX-P-FOX-CRO-AMC-KF 4 (11.8) subtotal 7 (20.6) AMP-CTT-DA-E-CN-OX-P-FOX-TEL-AMC 2 (5.9) AMP-FEP-CTT-CN-OX-P-FOX-CRO-AMC-KF 1 (2.9) AMP-FEP-CTT-E-CN-OX-P-TE-FOX-CRO 1 (2.9) AMP-FEP-CTT-E-OX-P-FOX-CRO-AMC-KF 3 (8.8) subtotal 2 (5.9) 11 AMP-FEP-CTT-E-CN-OX-P-FOX-CRO-AMC-KF 1 (2.9) AMP-CTT-DA-E-CN-OX-P-FOX-CRO-TEL-AMC 1 (2.9) Total 34 AM, Ampicillin; FEP, Cefepime; CTT, Cefotetan; CIP, Ciprofloxacinem; C, Chloramphenicol; CC, Clindamycin; E, Erythromycin; CN, Amikacin; IPM, Imipenem; OX, Oxacillin; P, Penicillin; RA, Rifampin; TE, Tetracycline; SXT, Trimethoprim/Sulfamethoxazole; VA, Vancomycin; FOX, Cefoxitin; CRO, Ceftriaxone; TEL, Telithromycin; AmC, Amoxicillin/Clavulanic; LZD, Linenzolid; KF, Cephalothin 보이는다제내성균 (97.1%) 으로확인되었으며, 10제이상내성률은 26.5%(9주 ) 를보였다. 특히 9제의항생제에내성률을보이는균주의패턴이 6가지유형으로가장다양한결과를보여주었고 (Table 3), oxacillin (6 μg/ml, Sigma, USA) 에대한최소억제농도측정결과 2주를제외한나머지 32주모두내성 (>4 μg/ml) 을보였다. MRSA균 genotyping SCCmec type MRSA로동정된 34주에대해 SCCmec typing을조사한결과 25주 (73.5%) 에서 SCCmec type IV 양상을보였으며, type II는 6주 (17.6%), type III는 1주 (2.9%) 순으로분류되었으나, 2주 (5.9%) 는분석이불가능하였다 (Table 4). PVL 유전자 MRSA로동정된 34주에서병독소유전자인 pvl 유전자는모두검출되지않았다. PFGE 분석이들균주의역학적연관성을확인하기위해 PFGE 분석을실시한결과 STAS16.010(1주 ), STAS16.011(1주 ), STAS16.012(1주 ), STAS16.013(1주 ), STAS16.014(8주 ), STAS16.015(1주 ), STAS16.016(9주 ), STAS16.017(2주 ), STAS16.018(1주 ), STAS16.019(1주 ), STAS16.020(1주 ), STAS16.021(1주 ), STAS16.022(3주 ), STAS16.023(1주 ), STAS16.024(1주 ), STAS16.025(1주 ) 로총 16개의유형으로분류되었으며, 그중 STAS16.016형이가장우세하였다. 또한각유형간유사도는 94.8~52.2% 범위로나타났다 (Fig. 2).
Characterization of CA-MRSA in Gwangju 105 Strain Table 4. Characteristics of community-associated methicillin-resistant S. aureus (CA-MRSA) isolates from nasal swabs Characteristics MIC (µg/ml) OX meca a PVL a SCCmec b PFGE GJ-12-N-21 Meat distributor 64 + - IV STAS16.017 GJ-12-N-22 Meat distributor 64 + - IV STAS16.017 GJ-12-N-50 Meat distributor 48 + - IV STAS16.014 GJ-12-N-53 Meat distributor 64 + - IV STAS16.014 GJ-12-N-96 Meat distributor 64 + - IV STAS16.016 GJ-12-N-121 Meat distributor 64 + - IV STAS16.014 GJ-12-N-142 Meat distributor 0.75 + - - STAS16.010 GJ-12-N-159 Meat distributor 64 + - IV STAS16.014 GJ-12-N-175 Meat distributor 64 + - IV STAS16.014 GJ-12-N-180 Meat distributor 64 + - IV STAS16.014 GJ-12-N-198 Meat distributor 48 + - IV STAS16.019 GJ-12-N-213 Pre-school children 64 + - IV STAS16.015 GJ-12-N-233 Officer 0.25 + - - STAS16.021 GJ-12-N-236 Pre-school children 64 + - IV STAS16.016 GJ-12-N-249 Meat distributor 48 + - IV STAS16.016 GJ-12-N-252 Meat distributor 128 + - IV STAS16.014 GJ-12-N-257 Meat distributor 64 + - III STAS16.013 GJ-12-N-262 Pre-school children 64 + - IV STAS16.016 GJ-12-N-268 Pre-school children 64 + - IV STAS16.014 GJ-12-N-275 Pre-school children 128 + - IV STAS16.011 GJ-12-N-289 Pre-school children 48 + - II STAS16.022 GJ-12-N-300 Pre-school children 128 + - II STAS16.023 GJ-12-N-301 Pre-school children 64 + - II STAS16.025 GJ-12-N-302 Pre-school children 96 + - II STAS16.022 GJ-12-N-305 Pre-school children 64 + - IV STAS16.016 GJ-12-N-314 Pre-school children 64 + - II STAS16.022 GJ-12-N-335 Pre-school children 64 + - IV STAS16.016 GJ-12-N-337 Pre-school children 64 + - IV STAS16.016 GJ-12-N-339 Pre-school children 96 + - IV STAS16.024 GJ-12-N-340 Pre-school children 96 + - IV STAS16.016 GJ-12-N-341 Pre-school children 96 + - IV STAS16.016 GJ-12-N-342 Pre-school children 32 + - II STAS16.012 GJ-12-N-343 Pre-school children 64 + - IV STAS16.018 GJ-12-N-401 Officer 32 + - IV STAS16.020 a +, detected; -, not detected b -, untypable
106 H-Y Kee, et al. GJ-12-N-289 STAS16.022 GJ-12-N-302 STAS16.022 Pre-school childr Pre-school childr GJ-12-N-314 STAS16.022 Pre-school childr GJ-12-N-300 STAS16.023 Pre-school childr GJ-12-N-339 STAS16.024 Pre-school childr GJ-12-N-233 STAS16.021 Officer GJ-12-N-301 STAS16.025 Pre-school childr GJ-12-N-275 STAS16.011 Pre-school childr GJ-12-N-342 STAS16.012 Pre-school childr GJ-12-N-142 STAS16.010 Meat distributor GJ-12-N-257 STAS16.013 Meat distributor GJ-12-N-50 STAS16.014 Meat distributor GJ-12-N-53 STAS16.014 Meat distributor GJ-12-N-121 STAS16.014 Meat distributor GJ-12-N-159 STAS16.014 Meat distributor GJ-12-N-175 STAS16.014 Meat distributor GJ-12-N-180 STAS16.014 Meat distributor GJ-12-N-252 STAS16.014 Meat distributor GJ-12-N-268 STAS16.014 Pre-school childr GJ-12-N-213 STAS16.015 Pre-school childr GJ-12-N-96 STAS16.016 Meat distributor GJ-12-N-341 STAS16.016 Pre-school childr GJ-12-N-236 STAS16.016 Pre-school childr GJ-12-N-249 STAS16.016 Meat distributor GJ-12-N-262 STAS16.016 Pre-school childr GJ-12-N-305 STAS16.016 Pre-school childr GJ-12-N-335 STAS16.016 Pre-school childr GJ-12-N-337 STAS16.016 Pre-school childr GJ-12-N-340 STAS16.016 Pre-school childr GJ-12-N-21 STAS16.017 Meat distributor GJ-12-N-22 STAS16.017 Meat distributor GJ-12-N-343 STAS16.018 Pre-school childr GJ-12-N-198 STAS16.019 Meat distributor GJ-12-N-401 STAS16.020 Officer Figure 2. Dendrogram of Sma I-digested pulsed-field gel electrophoresis (PFGE) profiles of community-associated methicillin-resistant S. aureus (CA-MRSA) isolates. 직업군별로는축산업종사자 14명중 7명이 STAS- 16.014형, 취학전아동 18명중 7명에서 STAS16.016형 이가장많음을알수있었다 (Fig. 3).
Characterization of CA-MRSA in Gwangju 107 Figure 3. Pulsed-field gel electrophoresis (PFGE) Sma I-pattern of community-associated methicillin-resistant S. aureus (CA-MRSA) isolates. 고찰 MRSA는병원내감염을일으키는중요한세균으로주로병원감염 MRSA가알려져있으나, 최근들어지역사회일반인에서도보고되고있다 (6). 광주지역에거주하는축산업종사자, 집단생활을하는어린이집소아및사무직종사자 404명을대상으로비강분비물을채취하여 MRSA를분리한결과 34주 (8.4%) 가분리되었다. Kim 등 (23) 은지역사회성인의전비공조사결과전체조사대상자의 33% (227/689) 에서황색포도알균을분리하여그중 2.2% (5/227) 의 CA-MRSA를확인하였고, Cho 등 (24) 도지역사회일반인들로부터 MRSA를조사한결과 2.9% 의분리율을보고하였다. 그러나 Kwon 등 (25) 은지역별로무작위선출된일반인의비강에서 27.5% 의황색포도알균을검출하였으나, MRSA는검출되지않았음을보고하였다. 본연구결과에서는앞선연구결과와비교했을때높은양성률을보였으며, 그이유로는동물에존재하는 MRSA가동물에서사람으로인수공통감염병의전파가능성이있음을고려할때검사대상자중에축산업종사자가포함되어있어 MRSA 양성률을높였을가능성이있을것으로사료된다. 하지만, 국내종합병원입원환자의 MRSA 분리율 ( 약 70%) (26, 27) 과비교했을때지역사회를대상으로한본연구결과에서는상당히낮은 MRSA 분리율을보였다. 직업군별분류결과, 취학전아동 108명중 18명 (16.7%) 이 MRSA로분리된것은, Kim 등 (28) 이서울북 부지역어린이집소아 428명중 38명 (8.8%) 의비강에서 MRSA를분리한것에비해높은분리율을보였다. 이를연령별로 3개군으로구분한결과, 2세미만 1명 (0.9%), 2~5세미만 5명 (4.6%), 6세이상에서 12명 (11.1%) 으로본연구는소아들의입원력과수술력등의조사가보호자및선생님들을통해이루어져객관성이부족하다는점과비강내보균여부를 1회만조사하였기때문에 MRSA 보균기간여부를정확하게파악하지못한것이제한점이라생각되지만, Kim 등 (28) 의결과인생후 12~23개월에서 0명, 생후 24~59개월 21명 (10.1%), 생후 60개월이상 12명 (8.1%) 의결과와유사하였고, 연령이증가함에따라비강내 MRSA 분리율이증가하는추세를보였다. 이와같은결과를종합해볼때소아를대상으로한비강내 CA-MRSA 보균율은국가및지역등여러환경적요인에따라다른것으로추측된다. 외국의경우타이완에서는약 10% 전후 (29, 30), 미국에서는 0.5~24% (31) 로나타났고, 국내의경우 Ko 등 (32) 이외래방문소아를대상으로시행한 MRSA 및 CA-MRSA 보균자를조사한결과 6.1% 와 4.7% 로분리율이다양하게나타남을알수있다. 또한, 축산업종사자에대한 MRSA 분리율조사결과, 230명중 14명 (6.1%) 에서 MRSA가분리되었다. 이는황색포도알균이동물의피부에도존재하는균이므로도축과정중가죽에서오염되었을경우, 도축된식육은가공, 소분등의과정을통해유통되는과정에서식육에오염된황색포도알균이식육과접촉한사람으로전이되어상재균화될수있으며, 이과정에서 MRSA의전이가가능했을거라생각된다. 따라서축산물취급시도축과정에
108 H-Y Kee, et al. 서부터판매업자까지황색포도알균등의병원균이오염되지않도록철저한위생관리에노력을기울여야할것으로판단된다. 한편, 축산업종사자의근무기간에따른 MRSA 분리율조사결과 5년미만 10명 (7.1%), 10년미만 2명 (5.6%), 15년미만 2명 (5.1%), 15년이상불검출로나타났고근무기간에따른연관성은없는것으로나타났다. 본연구대상에서조사된 8.4% 의 MRSA는 CA-MRSA 감염증의빈도및중요성이상대적으로낮았던국내상황에서향후 CA-MRSA 감염증에대한인식을새로이하는데중요한정보를제공하고있다고생각된다. Choi 등 (15) 이 2004년 ~2007년까지서울대학교어린이병원에서분리된 CA-MRSA에대한항생제내성률조사결과 ciprofloxacin 31%, clindamycin 28%, erythromycin 66%, gentamycin 31% 의내성률을보고하였는데, 본연구에서도 ampicillin, penicillin 100%, oxacillin 94.1%, cefoxitin 94.1%, erythromycin 52.9%, clindamycin 20.6% 의내성률을보여앞선보고와유사한결과를확인했으나, ciprofloxacin (2.9%) 과 trimethoprim-sulfamethoxazole은각각높은감수성을나타내는것으로확인되었다. SCCmec 유전자형은 MRSA의클론성과연관성이있는것으로알려져있어 MRSA 균주의역학분석에많이이용되고있다 (14). SCCmec은 I-V형으로나누어지며 SCCmec I형, II형및 III형은원내감염인반면, SCCmec IV형은지역사회감염과관련이있는것으로알려져있다 (13, 33). 본연구에서 CA-MRSA 34주에대한 SCCmec 유형을분석한결과 type IV가 25주 (73.5%) 를차지하였고, type II가 6주 (17.6%), type III가 1주 (2.9%), 유형분석이불가능한경우가 2주 (5.9%) 였다. 이는 Lee 등 (34) 이보고한서울지역어린이집소아 428명을대상으로한, 비강에서분리한 40주의 CA-MRSA 연구에서 SCCmec type IV가 32주 (80%), SCCmec type II가 8주 (20%) 의결과와비교했을때비슷한양상을보였다. 또한 Kim 등 (35) 은다중시설을이용한시민의손에서분리한 MRSA 11주에대한유형분석결과, SCCmec type IV가 13주, type I 1주가분리되었음을보고하였다. 본연구에서는조사대상의차이에도불구하고병원유래주로알려진 type II, type III 및지역사회유래주인 type IV가모두분리된것은 CA- MRSA와 HA-MRSA와의전파가능성이있음을보여주는것이라생각되며, 향후 CA-MRSA가토착화되지않도록적절한예방대책과지속적인감시가필요하다고생각 된다. PVL 유전자는피부및연조직감염의병독성에중요한역할을하고, 최근에는높은사망률을보이는지역사회관련폐렴에도관련이있는것으로알려져있다 (21). 이유전자는미국의경우 CA-MRSA 대부분에서발견된다고보고되고 (36) 있으나, 아시아지역에서는낮은양성률을보이고 (37), 국내에는대부분존재하지않는것으로보고되고있다. Kim 등 (38) 은입원환자의혈액에서분리된 305개의 MRSA 균주중 1주가 pvl 유전자양성과 SCCmec type IV였음을보고한바있다. 그러나본연구에서는 pvl 유전자가전혀검출되지않았으며, 이는본연구와동일한지역을대상으로한 Kim 등 (35) 의연구에서손에서분리한 MRSA 균에서 pvl 유전자검사결과 ( 음성 ) 와동일한결과를보여, 분리균주간의유전적차이가있음을알수있었다. MRSA로확인된 34주의역학적연관성을알아보기위해 PFGE를실시한결과 STAS10.010 1주를비롯하여총 16개의유형으로구분되었으며, 그중 STAS10.016형이가장우세하였다. 직업군별로는축산업종사자 14명중 7명에서 STAS16.014형이, 취학전아동 18명중 7명에서 STAS16.016형이가장많았고, 직업군별역학적연관성은없는것으로나타났다. 미국 CDC에서는 PFGE를이용하여황색포도알균을 Pulsed-field types (PFTs) 8개로분류하여 ( 예, USA 100 PFT, USA 200 PFT, USA 800 PFT) 전국적인데이터베이스를구축운영하고있다 (39). 그러나아직국내에는전국적인데이터베이스가확립되지않아 CA-MRSA 균주간연관성을비교하기가어려웠으며, 향후 PFGE를이용한비강정착균주간의역학적연관성비교나황색포도알균감염증을일으키는균주간의비교및국내외균주를비교하기위해서는황색포도알균에대한 PFGE pattern을표준화해야할필요가있다. 또한이들자료를근거로손이나비강등을통해감염되는 CA-MRSA간역학적연관성비교및 HA-MRSA와 CA- MRSA간의분자유전학적관계등을정확히파악함으로써 MRSA의효율적관리에기여할수있을것이라생각된다. 참고문헌 1) Timoney JF, Gillespie JH, Scott FW, Barlough JE. Hagan and Bruner's Microbiology and Infectious Disease of Domestic
Characterization of CA-MRSA in Gwangju 109 Animals. 8th ed. Ithaca: Comstock Publishing Associates; 1988. p. 171-96. 2) Diederen BM, Kluytmans JA. The emergence of Infections with community-associated methicillin resistant Staphylococcus aureus. J Infect 2006;52:157-68. 3) Chong Y, Lee K. Present situation of antimicrobial resistant in Korea. J Infect Chemother 2000;6:189-95. 4) Kim HB, Jang HC, Nam HJ, Lee YS, Kim BS, Park WB, et al. In vitro activities of 28 antimicrobial agents against Staphylococcus aureus isolates from tertiary-care hospitals in Korea: a nationwide survey. Antimicrob Agents Chemother 2004;48: 1124-7. 5) Goetz A, Posey K, Fleming J, Jacobs S, Boody L, Wagener MM, et al. Methicillin-resistant Staphylococcus aureus in the community: a hospital-based study. Infect Control Hosp Epidemiol 1999;20:689-91. 6) Kallen AJ, Driscoll TJ, Thornton S, Olson PE, Wallace MR. Increase in community-acquired methicillin-resistant Staphylococcus aureus at a Naval Medical Center. Infect Control Hosp Epidemiol 2000;21:223-6. 7) From the Centers for Disease Control and Prevention. Four pediatric deaths from community-acquired methicillin-resistant Staphylococcus aureus-minnesota and North Dakota, 1997-1999. JAMA 1999;282:1123-5. 8) Lee JS, Park O, Woo HJ, Jung HJ, Kim WJ, Kim MJ, et al. A Longitudinal Molecular Epidemiologic Study of Methicillinresistant Staphylococcus aureus (MRSA) Isolates from a University Hospital. Korean J Infect Dis 2001;33:32-9. 9) Chambers HF. Methicillin resistance in Staphylococci: molecular and biochemical basis and clinical implications. Clin Microbiol Rev 1997;10:781-91. 10) Boyle-Varva S, Ereshefsky B, Wang CC, Daum RS. Successful multiresistant community-associated methicillin-resistant Staphylococcus aureus lineage from Taipei, Taiwan, that carries either the novel staphylococcal chromosome cassette mec (SCCmec) type VT or SCCmec type IV. J Clin Microbiol 2005; 43:4719-30. 11) Ito T, Ma XX, Takeuchi F, Okuma K, Yuzawa H, Hiramatsu K. Novel type V staphylococcal cassette chromosome mec driven by a novel cassette chromosome recombinase, ccrc. Antimicrob Agents Chemother 2004;48:2637-51. 12) Oliveira DC, de Lencastre H. Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother 2002;46:2155-61. 13) Cha EK, Chang KS, Hwang SM. Correlation between staphylococcal cassette chromosome mec type and coagulase serotype of methicillin-resistant Staphylococcus aureus. J Bacteriol Virol 2009;39:71-8. 14) Chongtrakool P, Ito T, Ma XX, Kondo Y, Trakulsomboon S, Tiensasitorn C, et al. Staphylococcal cassette chromosome mec (SCCmec) typing of methicillin-resistant Staphylococcus aureus strains isolated in 11 Asian countries: a proposal for a new nomenclature for SCCmec elements. Antimicrob Agents Chemother 2006;50:1001-12. 15) Choe YJ, Lee SY, Sung JY, Yang MA, Lee JH, Oh CE, et al. A review of Staphylococcus aureus infections in children with an emphasis on community-associated methicillin-resistant S. aureus infections. Korean J Pediatr Infect Dis 2009;16:150-61. 16) Park JY, Kim HO, Jeong YG, Kim S, Bae IG. Clinical characteristics and risk factors of community-acquired methicillinresistant Staphylococcus aureus infections: comparison of community-acquired methicillin-susceptible Staphylococcus aureus infections. Infect Chemother 2006;38:109-15. 17) Mason WJ, Blevins JS, Beenken K, Wibowo N, Ojha N, Smeltzer MS. Multiplex PCR protocol for the diagnosis of staphylococcal infection. J Clin Microbiol 2001;39:3332-8. 18) Bauer AW, Kirby WM, Sherris JC, Turck M. Antibiotic susceptibility testing by a standardized single disk method. Am J Clin Pathol 1966;45:493-6. 19) Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; Eighteenth information supplement, M100-S18. Wayne, PA: CLSI, 2008. 20) Boye K, Bartels MD, Andersen IS, Møller JA, Westh H. A New multiplex PCR for easy screening of methicillin-reistant Staphylococccus aureus SCCmec types I-V. Clin Microbiol Infect 2007;13:725-7. 21) Lina G, Piémont Y, Godail-Gamot F, Bes M, Peter MO, Gauduchon V, et al. Involvement of Panton-Valentine leukocidin-producing Staphylococcus aureus in primary skin infections and pneumonia. Clin Infect Dis 1999;29:1128-32. 22) Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, et al. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 1995;33: 2233-9. 23) Kim HB, Shin DH, Park KU, Oh MD, Kim EC, Choe KW. The methicillin-resistance rate of Stapylococccus aureus
110 H-Y Kee, et al. isolated from anterior nares of healthy adults in the community. Infect Chemother 1998;30:527-31. 24) Cho JK, Kim JH, Sung MS, Kim KS. Genetic characterization of methicillin-resistant Staphylococcus aureus from humans and animals within the community. Korean J Vet Res 2011; 51:267-75. 25) Kwon YI, Kim TW, Kim HY, Chang YH, Kwak HS, Woo GJ, et al. Monitoring of methicillin resistant Staphylococcus aureus from medical environment in Korea. Korean J Microbiol Biotechnol 2007;35:158-62. 26) Kim JS, Kim HS, Song W, Cho HC, Lee KM, Kim EC. Antimicrobial resistance profiles of Staphylococcus aureus isolated in 13 Korean hospitals. Korean J Lab Med 2004;24: 223-9. 27) Lee HW, Yoon JH, Sohn JH, Lee KH, Yeh BI, Park DW, et al. Detection of meca gene in clinical isolates of Staphylococcus aureus by multiplex-pcr, and antimicrobial susceptibility of MRSA. J Microbiol Biotechnol 2003;13:354-59. 28) Kim YM, Oh CE, Kim SH, Lee J, Choi EH, Lee HJ. Nasal carriage of Staphylococcus aureus from healthy Children Attending Day Care Center. Korean J Pediatr Infect Dis 2010; 17:9-15. 29) Lo WT, Lin WJ, Tseng MH, Lu JJ, Lee SY, Chu ML, et al. Nasal carriage of a single clone of community-acquired methicillin-resistant Staphylococcus aureus among kindergarten attendees in northern Taiwan. BMC Infect Dis 2007;7:51. 30) Lu PL, Chin LC, Peng CF, Chiang YH, Chen TP, Ma L, et al. Risk factors and molecular analysis of community methicillinresistant Staphylococcus aureus carriage. J Clin Microbiol 2005;43:132-9. 31) Alfaro C, Mascher-Denen M, Fergie J, Purcell K. Prevalence of methicillin-resistant Staphylococcus aureus nasal carriage in patients admitted to Driscoll Children's Hospital. Pediatr Infect Dis J 2006;25:459-61. 32) Ko KS, Lee JY, Baek JY, Peck KR, Rhee JY, Kwon KT, et al. Characterization of Staphylococcus aureus nasal carriage from children attending an outpatient clinic in Seoul, Korea. Microb Drug Resist 2008;14:37-44. 33) Ko KS, Lee JY, Suh JY, Oh WS, Peck KR, Lee NY, et al. Distribution of major genotypes among methicillin-resistant Staphylococcus aureus clones in Asian countries. J Clin Microbiol 2005;43:421-6. 34) Lee J, Sung JY, Kim YM, Oh CE, Kim HB, Choi EH, et al. Molecular characterization of methicillin-resistant Staphylococcus aureus obtained from the anterior nares of healthy Korean children attending daycare centers. Int J Infect Dis 2011;15:558-63. 35) Kim TS, Kim MJ, Kim SH, Kee HY, Seo JJ, Kim ES, et al. Profile of Antimicrobial resistance of Staphylococcus aureus and molecular epidemiologic characterization of methicillinresistant Staphylococcus aureus (MRSA) isolated from hands of people using multitude facilities. Infect Chemother 2012; 44:289-98. 36) Vandenesch F, Naimi T, Enright MC, Lina G, Nimmo GR, Heffernan H, et al. Community-acquired methicillin-resistant Staphylococcus aureus carrying Panton-Valentine leukocidin genes: worldwide emergence. Emerg Infect Dis 2003;9:978-84. 37) Song JH, Hsueh PR, Chung DR, Ko KS, Kang CI, Peck KR, et al. Spread of methicillin-resistant Staphylococcus aureus between the community and the hospitals in Asian countries: an ANSORP study. J Antimicrob Chemother 2011;66:1061-9. 38) Kim JS, Park JS, Song W, Kim HS, Cho HC, Lee KM, et al. Panton-Valentine Leukocidin Positive Staphylococcus aureus Isolated from Blood in Korea. Korean J Lab Med 2007;27: 286-91. 39) McDougal LK, Steward CD, Killgore GE, Chaitram JM, McAllister SK, Tenover FC. Pulsed-field gel electrophoresis typing of oxacillin-resistant Staphylococcus aureus isolates from the United States: establishing a national database. J Clin Microbiol 2003;41:5113-20.