- 1 -
( 단위 : 건수 ) 특허 논문 구분 출원등록 SCI 비 SCI 기술실시 ( 이전 ) 상품화 ( 시제품 ) 기타 1차년도목표 1 1 1 달성 6 2 2 목표 1 0 2 2 2차년도 달성 0 4 1 2 3차년도목표 2 1 2 2 달성 3 1 3 2 계 목표 4 1 5 5 2 2 달성 9 5 10 4 3 2(5) l l l l - 2 -
l l l l l l l l - 3 -
l l l l l 따라서본연구를통하여시료내존재하는병원성대장균의신속검출을위한 PCR 키트개발을성공적으로달성하였음. l l l l l l l l l l l l l - 4 -
SUMMARY ( ) 1. multiplex PCR and real-time PCR detection kits for emetic and enterotoxigenic B. cereus l Bacillus cereus comprises the largest group of endospore-forming bacteria and can cause emetic and diarrheal food poisoning. It is widespread in nature and therefore, considered a major foodborne pathogen. There is a growing demand for fast, accurate, reliable and economic detection of potentially toxigenic B. cereus. A multiplex PCR assay for the rapid detection of enterotoxic and emetic strains in Bacillus cereus was developed and evaluated among B. cereus emetic and enterotoxic reference strains, B. cereus group members and non-target strains. l A total of 496 B. cereus strains isolated from various sources (food, environmental, clinical) were assessed by a multiplex PCR for the presence of enterotoxin genes. The prevalence rate of nhea, entfm, hblc, and cytk enterotoxin genes among all B. cereus strains was 92.33%, 77.21%, 59.47%, and 47.58%, respectively. Enterotoxigenic profiles were determined in emetic toxin- (8 patterns) and enterotoxin-producing strains (12 patterns). The results provide important information on toxin prevalence and toxigenic profiles of B. cereus from various sources. Our findings revealed that B. cereus must be considered a serious health hazard and Bacillus thuringiensis should be considered of a greater potential concern to food safety among all B. cereus group members. Also, there is need for intensive and continuous monitoring of products embracing both emetic-toxin and enterotoxin genes. l Design and verification of the 1st, 2nd and 3rd primer sets for PCR kits. All primer sets were designed specifically to target genes for B. cereus group (groel), diarrheal (cytk, nhea, hblc, entfm) and emetic strains (CER or ces) and the specificity, sensitivity and detection limits of the primer sets-based PCR approaches were confirmed on pure culture and inoculated foods. The minimum detection limits of PCR approaches using the 1st, 2nd and 3rd primer sets were respectively 20, 2, and 0.2 pg of DNA per reaction tube in pure culture and also respectively 10 3, 10 3 and 10 3 cfu/g in food samples in artificial contamination of seven different food matrices with distinct bacterial counts and improved approximately 10 1 cfu/g after 7 h enrichment. The sizes of PCR product using the 2nd or 3rd primer sets were 488, 376, 163, 106, and 70 bp, or 255, 163, 127, 97 and 81 bp for entfm, nhea, hbld, cytk and ces respectively. - 5 -
l Development and validation of multiplex PCR and real-time PCR kits. A highly sensitive pentaplex real-time PCR high resolution melt curve assay using the 3rd primer set was developed for simultaneous detection of 4 major enterotoxin and 1 emetic genes. The average melting temperatures (T m ) of PCR products were 72.20, 74.23, 76.55, 78.42 and 81.90 for ces, cytk, nhea, entfm and hbld, respectively. The inclusivity and exclusivity of the multiplex assay were evaluated using 71 bacterial strains including 17 emetic B. cereus reference strains, 9 enterotoxic B. cereus reference strains, 4 B. cereus group members, 23 wild B. cereus strains, 18 non-target strains, and was further tested on artificially inoculated foods. The DNA intercalating dye SYTO9 used in this study generated higher resolution melt curve peaks than SYBR Green dye for the target strains and genes in which the peaks were sharp and easily distinguishable from each other. The developed kits were validated by the same modified method based on the AOAC validation protocol in three independent laboratories from different cities. The validation results presented that the multiplex real-time kit was better than the multiplex PCR kit and the conventional culture method in sensitivity and specificity in pure cultures of B. cereus, artificially inoculated foods and naturally contaminated foods. Taken together, the developed multiplex PCR and multiplex real-time PCR kits can be the rapid and reliable tools for the simultaneous monitoring of both emetic and enterotoxic strains of B. cereus present in food and food-related samples. l To the best of our knowledge, this is the first time that an assay for simultaneous detection of B. cereus group, emetic and enterotoxic strains with such a wide range of detection target genes in food and environmental samples has been described. - 6 -
2. multiplex PCR detection kits for 5 pathotypes of pathogenic E. coli l Escherichia coli is the predominant facultative organism in the human gastrointestinal tract. Strains of pathogenic E. coli (PEC), which have acquired virulence factors, have the ability to cause foodborne and waterborne disease in human. Of the strains that cause diarrheal diseases, five pathotypes are recognized. But PEC strains display a heterogeneous range of phenotypic properties making it difficult to find a common agar to selectively and differentially recover these pathogens. Different molecular methods are used for identification of PEC, and these methods are based on genes related to the pathogenicity of each category. The prevent study was undertaken to establish a rapid PCR system for identification of the main five prevalent categories of PEC and a real-time PCR assay incorporating an internal amplification control (IAC). l To develop a PCR for PEC detection, we analyzed genetic information of virulence genes and established system of Conventional PCR and Real-time PCR which based genetic marker. And we developed and evaluated an IAC which could effectively eliminate false-negative results. Multiplex PCR kits, Real-time PCR kits and IAC kits for PEC were developed and validation testing was conducted using food samples spiked with PEC. l Therefore in this study, we developed Multiplex Conventional PCR and Real-time PCR for PEC detection. We established primer set and primer/probe set for the identification of PEC virulence genes (eaea, ipah, aggr, LT, STd, STp, stx1, stx2, bfp, lacy and 16s rrna) and developed IAC kit by using the Sequence of Viral Hemorrhagic Septicemia Virus enabling the distinction of true negative results from false negative results caused by PCR malfunction. The effectiveness of developed PCR kits were verified with detection of pathogenic E. coli, other foodborne pathogens and food samples artificial inoculation. Throughout this study it was successfully achieved the development of PCR kits for the rapid detection of pathogenic E. coli present in the sample. l The PCR kits for pathogenic E. coli can be used for rapid and an efficient detecting of PEC containing food samples. These kits are a useful tool to clarify the source and routes of Pathogenic E. coli. - 7 -
- 8 -
- 9 -
제 1 장연구개발과제의개요 1) 1) 농림수산식품기술기획평가원 본문작성요령 에따라본문의순서는장, 절, 1, 가, (1), ( 가 ), 1, 가등으로함 - 10 -
- 11 -
- 12 -
β 독소명칭유전자 / 단백질비고 용혈성독소 (HBL) 비용혈성장독소 (NHE) hblcda nheabc 독소는 1 개의오페론에있는 3 개의유전자에서코딩된 3 개의단백질로구성 세포독소 K (Cytotoxin K, CytK) CytK1,2 단일단백질 - 13 -
대장균은 Escherichia 속중대표적인균종으로장의정상적인생리기능을유지하는데주요한역할을하고있음. 그러나건강한분변의대장균과달리유유아의전염성설사증이나급성장염을일으키는특정혈청형의대장균이있어, 병원성대장균으로칭함. 사람이나동물의대장상주균과는달리외래성대장균으로식품및음용수에오염되어식중독을유발시킴. 병원성대장균의발생건수는국내식중독발생건수중최다를차지하므로, 식품내의대장균의검출및제어는가장시급한문제라할수있음 ( 표 1.2). 표 1.2 2009 국내병원성대장균발생현황 ( 식품의약품안전청 ) - 14 -
- 15 -
- 16 -
표 1.3 병원성대장균의특성및혈청형 특 성 병원성대장균 ETEC EPEC EIEC EHEC 톡신 (toxin) 이열성및베로톡신베로톡신내열성톡신 - (Verocytotoxin) (Verocytotoxin) (LT/ST) 장관침입성 - - + - 설 사 수양성 수양성및점액및혈액성혈액성 수양성 / 혈액성 용혈성요독증 - - - + 열 - + + - 주요감염장관 소장 소장 대장 대장 O6:H16, O8:H9 O20:H26 O26:H-, O28:H- O124:H30 O4:H- O26:H11 주요혈청형 O11:H27 O55:H6 O136:H- O91:H19 O20:H- O86:H27 O143:H- O111:H- O25:H42 29종이상 O111:H2 37종이상 O159:H- 12종이상 O157:H7 26종이상 감염량 많은량 많은량 적은량 적은량 - 17 -
1. 전통적배지법및생화학적테스트 1 차배양 2 차배양선택배지균동정 2. 면역항체법 1 일 1~2 일 1~2 일 1 차배양 2 차배양분석 18~24 시간 18~24 시간 10 분 ~2 시간 3. Real-time PCR 법 1.5~2 일 배양 DNA 추출 분석 1.5 시간 2 시간 7.5~11.5 시간 - 18 -
- 19 -
- 20 -
Company Kit Name Recognition 3M Microbiology Products Petrifilm E. coli Count Plate w AOAC Official Method 991.14 w AFNOR w FDA-BAM 8th ed., Rev. A w Health Protection Branch- CANADA MFHPB-34 w NMKL 147.1993 w USDA-FSIS: Pathogen/HACCP Final Rule ColiComplete w AOAC Official Method 992.30 BioControl Systems Inc. ColiTrak w AOAC Official Method 966.24 ColiTrak + w AOAC Official Method 988.19 SimPlate coliform/e. coli w EMMAS BioMerieux VIDAS E. coli O157 (ECO) Test w/ O157:H7 ID Agar w Performance Tested Method; Certificate no.010502 VIDAS Immunoconcentration System w Performance Tested Method; Certificate no.010502 Droege's Wholesale Food Service RapidChekTM for E.coli O157 (including H7) Lateral Flow Assay w Performance Tested Method; Certificate no. 070201 Dynal Biotech Dynal Anti-E. coli O157 w AFNOR Cert. no. DYN 16/2-0696 FDA-BAM, DIN 10167, w Health Canada, w NMKL Official Method of Japan IGEN International PATHIGEN E. coli O157 Test w PerformanceTested Method; Certificate no. 010301 Matrix MicroScience Ltd PATHATRIX E. coli O157 Test System w Performance Tested; Certificate no. 030202 Molecular Circuitry Detex System MC-18 for E. coli O157 including H7 w Performance Tested Method; Certificate no. 000301 Neogen Corporation ISO-Grid + SD39 Agar w AOAC Official Method Alert for E. coli O157 w AOAC Official Method 2000.13 Neogen Corp. REVEAL 8 for E. coli O157 w AOAC Official Method 2000.13 REVEAL for E. coli O157 w AOAC Official Method 2000.14-21 -
- 22 -
1 지식재산권 : 특허출원 4 건, 등록 1 건 목표초과달성함 : 특허출원 9 건, 등록 4 건 2 기술이전 2 건 목표달성함 : 기술이전 2 건 3 제품화 2 건목표달성함 : 제품화 2 건 ( 시제품 5 건 ) 4 학술성과 : 논문 10 편 (SCI 5 편, 비 SCI 5 편 ) 목표초과달성함 : 논문 14 편 (SCI 10 편, 비 SCI 4 편 ) 5 기타 ( 당초목표에없음 ) 인력양성 3 건, 학술발표 6 건, 홍보전시 1 건 - 23 -
제 2 장국내외기술개발현황 - 24 -
- 25 -
제조회사 BioControl System (Belleveus, WA) Neogen (Lansing, MI) BioMerieus (Marcyl, Etoile, France) Tecra (France Forest, NSW, Australia) Igen (Gaithersburg, MD) Molecular Circuitry Organon Teknika (Boxtel, Netherlands) GeneTrack (Hopkinton, MA) DuPont Qualicon (Wilmington, DE) Bio-Rad TaKaRa 적용기술 Lateral-flow, ELISA Lateral-flow Fluorescent immunoassay Dipstick, ELISA Electrochemiluminescent immunoassay Electroimmonoassay ELISA ELISA PCR PCR, PCR-Hybridization PCR - 26 -
그림 2.1 USDA 에서 O157:H7 의검출의사용되는크롬아가 (Rainbow agar) Target Product Method Company Escherichia coli GENE-TRAK Probe Neogen E. coli O157:H7 BAX PCR a Qualicon Probelia PCR BioControl a PCR, Polymerase Chain Reaction - 27 -
- 28 -
- 29 -
최근 PCR 을이용한병원성대장균의검출방법이식품공전에정식으로등재되었음 ( 표 2.3) 표 2.3 식품공전에등재된 VT toxin 검출 method - 30 -
- 31 -
제 3 장연구개발수행내용및결과 < 요약 > Ÿ 바실러스세레우스에서구토형및설사형독소유전자들, non-ribosomal peptide synthetase (NRPS/CER primers), cereulide (ces), haemolysin BL (hbldca), enterotoxin FM (entfm), non-haemolytic entrotoxin (nheabc), 및 cytotoxin K (cytk) 을목표대상으로하는제1 프라이머세트를개발함 ( 표 3.1). Ÿ 제1 프라이머세트의 multiplex PCR 조건을최적화함 : [95ºC 10min, (94ºC 1min, 54ºC 1min, 72ºC 1min) 35 cycles, 72ºC 5min] ( 표 3.3) Ÿ 제1 프라이머세트의민감도및특이도를구토및설사형표준균주들에서검증함. 비목표세균들에서 PCR 결과는음성으로나왔으므로이들프라이들의특이도는매우높은것으로증명됨. groel은모든바실러스세레우스균주들에서, CER(NRPS) 은구토형균주들에서만양성으로나타났으나, 설사형 / 장독소형유전자들은설사형및구토형균주들양쪽에혼재하였음. Ÿ 한국에서분리한야생형균주로서구토형 B. cereus 71균주와설사형 B. cereus 425균주등 496 균주들에대한 PCR 검출시험결과, B. cereus group 마커인 groel은모든균주들에서양성이였으며 (100%). 구토형독소관련유전자 (NRPS(CER) 및 ces) 는구토형균주들에서만발견되었으나, 설사형장독소유전자들인 hbld, nhea, entfm 및 cytk의검출율은각각 59.4%, 92.3%, 77.2% 및 47.5% 로써매우다양한유전자프로파일을나타냈음. Ÿ 바실러스세레우스순수배양액및인위접종한식품시료에서 multiplex PCR의검출한계를측정함. 순수배양액시료의 genomic DNA에대한 PCR 검출한계는 2 pg/reaction tube 이었으며, 인위접종한시료에서는약 10 3 cfu/g 시료이었음. Ÿ 농식품 ( 쌀과김밥 ) 및환경 ( 토양과소분변 ) 시료들 ( 각 36개총 144개 ) 에대한 PCR 기법의바실러스세레우스오염도검출율은전통적방법인배지배양법과비교하여유사하거나경우에따라약간낮은것으로나타남. 바실러스세레우스의검출빈도는쌀, 김밥, 토양및분변에서각각 63.8%, 38.9%, 84.6% 및 69.2% 였음. Ÿ 결론적으로제1 프라이머세트의동시검출 multiplex PCR은전통적배지배양법보다더나은검출율을보이지는않았으나, PCR 기법은신속성, 경제성, 효율성등많은장점을가지므로, 목표유전자및세균들에대한민감도및특이도등에서보다우수한 primer set의개발이필요함 ( 제2절의제2 및제3 프라이머세트개발 ). - 32 -
가. multiplex PCR primer 디자인 Target gene sequence Product length Design source AGCTATGATTCGTGAAGGT groel AAGTAATAACGCCGTCGT AGGCCCAGCTACATACAACG entfm CCACTGCAGTCAAAACCAGC CGCAACGACAAATCAATGAA hblc ATTGCTTCACGAGCTGCTTT GCGTACCAAATCACCCGTTC CER TGCAGGTGGCACACTTGTTA GGAGGGGCAAACAGAAGTGAA nhea CGAAGAGCTGCTTCTCTCGT TGCTAGTAGTGCTGTAACTC cytk CGTTGTTTCCAACCCAGT 236 AB077143 327 AY789084 421 AY786407 546 AY576054 750 DQ019312 881 DQ019311-33 -
ºC ºC ºC ºC ºC No. Pre-denaturation Thermal cycles Final extension 1 94ºC 2min (94ºC 40sec, 52ºC 40sec, 72ºC 1min) 35 72ºC 5min 2 94ºC 2min (94ºC 40sec, 52ºC 1min, 72ºC 1min) 35 72ºC 5min 3 94ºC 2min (94ºC 40sec, 54ºC 40sec, 72ºC 1min) 35 72ºC 5min 4 94ºC 2min (94ºC 40sec, 54ºC 1min, 72ºC 1min) 35 72ºC 5min 5 95ºC 5min (94ºC 1min, 56ºC 1min, 72ºC 1min) 35 72ºC 5min 6 95ºC 10min (94ºC 30sec, 54ºC 1min, 72ºC 1min) 35 72ºC 5min 7 95ºC 10min (94ºC 30sec, 54ºC 1min, 72ºC 1min) 35 72ºC 5min 8 95ºC 10min (94ºC 1min, 54ºC 1min, 72ºC 1min) 35 72ºC 5min - 34 -
Component Volume Tris-HCl MgCl 2 KCl 10 mm 1.5 mm 40 mm dntp mixture 250 µm Taq polymerase (Takara Taq TM, Otsu, Japan) cytk primers (forward/reverse) nhea primers (forward/reverse) CER primers (forward/reverse) hblc primers (forward/reverse) entfm primers (forward/reverse) groel primers (forward/reverse) DNA template 1 U 30 pm each 30 pm each 20 pm each 20 pm each 15 pm each 20 pm each 10-15 ng Total volume 25 µl - 35 -
Emetic reference strains Enterotoxic reference strains B. cereus group members Non-target bacteria B. cereus F4810/72 B. cereus ATCC13061 B. thuringiensis KCTC1508 Escherichia coli KCCM32396 B. cereus JNHE36 B. cereus ATCC12480 B. thuringiensis 824 B. cereus JNHE78 B. cereus KCTC1013 B. cereus KUGH164 B. cereus KCTC1014 B. cereus KNIHuls1 B. cereus KCTC1092 B. cereus KNIHuls3 B. cereus KCTC1094 B. cereus KNIHuls4 B. cereus KCTC1526 B. cereus KNIHuls5 B. mycoides KCTC 3453 B. weihenstephanensis KACC12001 B. pseudomycoides KACC12098 Escherichia coli O157:H7 ATCC 43895 Salmonella typhimurium ATCC14028 Listeria monocytogenes ATCC19119 Listeria monocytogenes ATCC19115 Staphylococcus aureus ATCC12500 Staphylococcus aureus ATCC27729 Clustridium perfringens KCTC5101 B. cereus KNIHuls7 B. subtilis KCCM11316 B. cereus KNIHuls8 B. subtilis KCTC3135 B. cereus KFDA250 Pseudomonas putida KCCM35479 Escherichia coli ATCC3565-36 -
- 37 -
Strain Type Multiplex PCR assay CER groel Cyt K entfm hblc nhea B. cereus ATCC13061 Enterotoxic - + - + - + B. cereus ATCC12480 Enterotoxic - + + + + + B. cereus KCTC1013 Enterotoxic - + + + + + B. cereus KCTC1014 Enterotoxic - + - + - + B. cereus KCTC1092 Enterotoxic - + + + + + B. cereus KCTC1094 Enterotoxic - + + + + + B. cereus KCTC1526 Enterotoxic - + + + + + B. cereus F4810/72 Emetic + + - + - + B. cereus JNHE36 Emetic + + + + + + B. cereus JNHE78 Emetic + + - - - + B. cereus KUGH164 Emetic + + - - - + B. cereus KNIHuls1 Emetic + + - + - + B. cereus KNIHuls3 Emetic + + - + - + B. cereus KNIHuls4 Emetic + + - + - + B. cereus KNIHuls5 Emetic + + - + - + B. cereus KNIH7uls7 Emetic + + - + - + B. cereus KNIHuls8 Emetic + + - + - + B. cereus KFDA250 Emetic + + - + - + - 38 -
그림 3.1 바실러스세레우스표준균주에서구토및설사관련유전자들에대한 PCR의전기영동결과 (Gel electrophoresis results of 4 B. cereus reference strains detection by multiplex PCR approach in artificially inoculated food (kimbab). M, 100-bp DNA size marker; Lane1, B. cereus ATCC 13061; Lane 2, B. cereus KCTC 1014; Lane 3, B. cereus ATCC 12480; Lane 4, B. cereus F4810/72. 그림 3.2 Gel electrophoresis of multiplex PCR assay products for two B. cereus group members). Lane 1, B. weinhenstephanensis KACC 12001; Lane 2, B. pseudomycoides KACC 12098; Lane 3, 100-bp ladder. - 39 -
그림 3.3 Gel electrophoresis of multiplex PCR assay products for non-target strains. Lane 1, E. coli O157:H7 ATCC 43895; Lane 2, B. subtilis KCCM 11316; Lane 3, L. monocytogenes ATCC 19119; Lane 4, S. typhimurium ATCC 14028; Lane 5, S. aureus ATC C27729; Lane 6, E. coli KCCM 32396; Lane 7, 100 bp ladder. (Non-target 세균들에서는 PCR이수행되지않으므로 primers의특이도가우수함을나타냄.) 그림 3.4 Gel electrophoresis of 6 enterotoxic reference strains and 1 non-target strain. M, 100-bp ladder; Lane 1, B. cereus KCTC 1013; Lane 2, B. cereus KCTC 1014; Lane 3, B. cereus KCTC 1092; Lane 4, B. cereus ATCC 12480; Lane 5, B. cereus KCTC 1526; Lane 6, B. cereus KCTC 1508; Lane 7, Pseudomonas putida KCCM 35479; Lane 8, no template control (NTC). ( 목표세균들인장독소생성균주들 (lane #1~#6) 에서 PCR 밴드가나타나므로 primers의특이도가우수함을보여줌 ) - 40 -
- 41 -
그림 3.5 Toxic gene patterns and their prevalence among 496 wild B. cereus strains. - 42 -
- 43 -
- 44 -
Strain Type Concentration of DNA in PCR reaction tube 2 ng 200 pg 20 pg 2 pg 200 fg B. cereus ATCC13061 Enterotoxic + + + - - B. cereus ATCC12480 Enterotoxic + + + + - B. cereus KCTC1013 Enterotoxic + + + - - B. cereus KCTC1094 Enterotoxic + + + - - B. cereus F4810/72 Emetic + + + + - +: presence of amplified product/ -: absence of amplified product. - 45 -
- 46 -
Inoculated bacterial strain Food F4810/72 ATCC12480 0.1 ml inoculum 1 ml inoculum 0.1 ml inoculum 1 ml inoculum Kimbab 1.8 10 4 1.8 10 4 2.1 10 4 2.1 10 3 Milk 1.8 10 3 1.8 10 3 2.1 10 4 2.1 10 3 Rice 1.8 10 3 1.8 10 3 2.1 10 4 2.1 10 3 Baby cereal 1.8 10 4 1.8 10 3 2.1 10 4 2.1 10 3 Sunflower oil 1.8 10 5 1.8 10 3 2.1 10 4 2.1 10 3 Tteok 1.8 10 4 1.8 10 3 2.1 10 4 2.1 10 3 Pasta 1.8 10 4 1.8 10 3 2.1 10 4 2.1 10 3-47 -
Toxin genes Kimbab Rice soil Feces (n = 12) (n = 23) (n = 11) (n = 9) cytk 4 (33.3%) 12 (52.2%) 6 (54.5%) 6 (66.7%) nhea 11 (91.7%) 20 (86.9%) 11 (100%) 8 (88.9%) hblc 7 (58.3%) 16 (69.6%) 7 (63.6%) 5 (55.6%) entfm 9 (75.0%) 18 (78.3%) 7 (63.6%) 5 (55.6%) CER ND 2 ( 8.7%) ND ND ND: not detected. - 48 -
- 49 -
제 2 절 B. cereus 구토 / 설사형동시검출 multiplex real-time PCR kit 개발 < 요약 > Ÿ Ÿ Ÿ 바실러스세레우스구토및설사형독소유전자동시검출용 multiplex conventional PCR kit 및 multiplex real-time PCR kit를개발하기위하여구토독소유전자 (ces) 및설사독소 / 장독소유전자들 (hbl, nhe, entfm, cytk) 을타깃으로하는제2 및제3 프라이머세트들을새로디자인하고, 각프라이머세트를사용하는 multiplex PCR 및 multiplex real-time PCR의반응조건및프라이머농도등을경험적으로최적화하였으며, 48개표준균주, 인위접종된시료, 식품및환경시료등에서 PCR kit의민감도, 특이도및검출한계를측정하였음. multiplex PCR 의 premix 는 AccuPower TM Multiplex PCR PreMix (SYBR Green), multiplex real-time PCR 의 premix 는 MeltDoctor TM HRM Master Mix (SYTO 9) 를주로사용하였음. Ÿ 제 2 프라이머세트의염기서열은표 3.14 에나열하였음. - entfm, nhea, hbld, cytk 및 ces 프라이머에대한 PCR 산물크기는각각 488, 376, 163, 106, 및 70 bp 이며, T m 값은각각 72.6, 75.5, 76.2, 77.9, 및 81.1 이고, 프라이머최적농도는각각 200, 200, 100, 200 및 100 nm 임. - multiplex PCR 의최적반응조건은 [95 C 10 분, (95 C 15 초, 56 C 30 초, 72 C 30 초 ) x 35 회반복, 72 C 3 분 ] 임. - PCR 검출한계는순수배양액의 DNA 시료에서약 2 pg/reaction tube 이였으며, 인위접종시료에서약 10 2 cfu/g 시료이었음. - 제 2 프라이머세트에대한 multiplex PCR 의 DNA 밴드및 singleplex real-time PCR 의분명한 melting peak 결과와달리, multiplex real-time PCR 의 melting peak 결과는서로명확하게구별되지않았음. Ÿ 제 3 프라이머세트의염기서열은표 3.22 에나열하였음. - entfm, nhea, hbld, cytk 및 ces 프라이머에대한 PCR 산물의크기는각각 255, 163, 127, 97 및 81 bp 이며, Tm 값은각각 78.4, 76.6, 81.9, 74.3 및 72.2 이고, 프라이머최적농도는각각 50, 100, 100, 150 및 50 nm 임. - PCR 의검출한계는순수배양액의 DNA 시료에서약 200 fg/tube 이었으며, 인위접종시료에서증균전약 10 2 cfu/g 이였으며, 7 시간증균후약 10 1 cfu/g 이였음. - real-time PCR 최적반응조건은 [95 C 10 분, (95 C 15 초, 58 C 1 분 ) x 35 회반복 ] 이며, melting curve 단계는 60 C 에서 95 C 까지매초마다 0.1 C 씩점진적증가반응임. - 제 3 프라이머세트에대한 multiplex PCR 의 DNA 밴드및 singleplex 및 multiplex real-time PCR 의 melting peak 결과는서로명확하게구별되었음 Ÿ 결론적으로, multiplex conventional PCR kit 의제작에는제 2 프라이머세트를, multiplex real-time PCR kit 의제작에는제 3 프라이머세트를사용하였음. - 50 -
- 51 -
Emetic reference strains Bacillus cereus F4810/72 Bacillus cereus JNHE 36 Bacillus cereus JNHE 80 Bacillus cereus KUGH27 Bacillus cereus JNHE 82 Bacillus cereus JNHE 88 Bacillus cereus KUGH 12 Bacillus cereus KNIH 20 Bacillus cereus JNHE 54 Bacillus cereus JNHE 13 Bacillus cereus JNHE 95 Bacillus cereus JNHE 23 Bacillus cereus JNHE 61 Bacillus cereus JNHE 60 Bacillus cereus JNHE 15 Bacillus cereus JNHE 7 Bacillus cereus KUGH 164 Enterotoxic reference strains Bacillus cereus ATCC 13061 Bacillus cereus ATCC 12480 Bacillus cereus KCTC 1013 Bacillus cereus KCTC 1014 Bacillus cereus KCTC 1092 Bacillus cereus KCTC 1094 Bacillus cereus KCTC 1526 Bacillus cereus ATCC 11778 Bacillus cereus ATCC 27348 B. cereus group Non-target strains Bacillus thuringiensis KCTC 1508 B. mycoides KCTC 3453 B. pseudomycoides KACC 12098 B. weihenstephanensis KACC 12001 Escherichia coli KCCM32396 Escherichia coli O157:H7 ATCC 43895 Salmonella enteritidis ATCC14028 Listeria monocytogenes ATCC 15313 Listeria monocytogenes ATCC19115 Streptococcus salivarius ATCC 19258 Staphylococcus aureus ATCC27729 Enterococcus faecalis ATCC 33186 B. subtilis KCCM3135 Escherichia coli B0499 Escherichia coli B0455 Pseudomonas putida KCCM35479 Escherichia coli ATCC3565 Micrococcus luteus KCCM11211 Streptococcus pyogenes KCCM 11819 Vibrio parahaemolyticus ATCC 17802 Campylobacter jejuni ATCC 33291 Yersinia enterocolitica ATCC 23715-52 -
- 53 -
Target gene entfm nhea hbld cytk ces Sequence F: 5 GGAACTGGATACGTAAGC 3 R: 5 TAGTGAATGAATCCACTGC 3 F: 5 TGAAATTGTAAATGCTGCAG 3 R: 5 ATGTACTTCAACGTTTGTAACG 3 F: 5 GCATGGTCAATTGGTGGT 3 R: 5 CACCAGCTGCTGTTCCTA 3 F: 5 AAATGTTTAGCATTATCCGC 3 R: 5 TTTGCCCGATATCTGTTACAAC 3 F: 5 ATGAATCAACGATTATGCG 3 R: 5 GTCGGATTCGATACAATTTC 3 Product length 488 bp 376 bp 163 bp 106 bp 70 bp Design source AY789084; AY897207; EF453661; EF453653; EF453659 Y19005; DQ019312; DQ885236; DQ153261; DQ153257 U63928; AJ007794; AY820178; AY820179; AY822582; AY822584 AJ277962; DQ019311; JN222929; JN222928; JN222924; CP000001; AJ318875; AJ318877; AJ318876 AY691650; DQ360825; DQ345790; JN222922; AY691650; DQ238109; DQ459072; JN112795; JN112796-54 -
Pre-denaturation Thermal cycles Final extension 95ºC 10min (95ºC 15sec, 48ºC 30sec, 72ºC 30sec) 35 72ºC 3min 95ºC 10min (95ºC 15sec, 50ºC 30sec, 72ºC 30sec) 35 72ºC 3min 95ºC 10min (95ºC 15sec, 52ºC 30sec, 72ºC 30sec) 35 72ºC 3min 95ºC 10min (95ºC 15sec, 54ºC 30sec, 72ºC 30sec) 35 72ºC 3min 95ºC 10min (95ºC 15sec, 56ºC 30sec, 72ºC 30sec) 35 72ºC 3min 95ºC 10min (95ºC 15sec, 58ºC 30sec, 72ºC 30sec) 35 72ºC 3min 95ºC 10min (95ºC 15sec, 60ºC 30sec, 72ºC 30sec) 35 72ºC 3min - 55 -
μ - 56 -
- 57 -
- 58 -
- 59 -
- 60 -
- 61 -
그림 3.6 구토및설사관련특정유전자 5 종류에대한 2nd set of primers 에대한 PCR 결과. Photograph of the specific products of the genes on agarose gel after electrophoresis (2nd set of primers). Lane1, cytk(106 bp); Lane 2, nhea (376 bp); Lane 3, hbld (163 bp); Lane 4, entfm (488 bp); Lane 5, 100-bp ladder, Lane 6, ces (70 bp). - 62 -
그림 3.7 Multiplex PCR results of 8 B. cereus reference strains. Lane1, 100-bp ladder; Lane 2, F4810/72; Lane 3, ATCC12480; Lane 4, ATCC13061; Lane 5, KCTC1013; Lane 6, ATCC27348; Lane 7, KCTC1092; Lane 8, KCTC1094; Lane 9, KCTC1014; Lane 10, 100-bp ladder. - 63 -
Strain Type Concentration of DNA in PCR reaction tube 2 ng 200 pg 20 pg 2 pg 200 fg B. cereus ATCC13061 Enterotoxic + + + + - B. cereus ATCC12480 Enterotoxic + + + + - B. cereus KCTC1013 Enterotoxic + + + + - B. cereus KCTC1094 Enterotoxic + + + + - B. cereus F4810/72 Emetic + + + + - - 64 -
그림 3.8 Gel electrophoresis results of multiplex PCR using 2nd set of primers in 10-fold serial dilutions of artificially B. cereus F4810/72 inoculated food (rice). Lane 1 & 11: size marker; Lane 2, 3.1 10 7 cfu/g; Lane 3, 3.1 10 6 cfu/g, Lane 4, 3.1 10 5 cfu/g; Lane 5, 3.1 10 4 cfu/g; Lane 6, 3.1 10 3 cfu/g; Lane 7, 3.1 10 2 cfu/g (LOD); Lane 8, 3.1 10 1 cfu/g; Lane 9, Non-target strain (B. subtilis KCCM3135); Lane 10, No template control (NTC). - 65 -
- 66 -
- 67 -
- 68 -
- 69 -
Genes Melting temperatures (Tm) of different reference strains Mean cytk 76.04 76.2 76.05 76.34 76.43 76.21 nhea 75.14 75.59 75.89 75.74 75 75.47 entfm 77.23 77.53 77.68 79.02 78.12 77.91 ces 72.61 72.45 72.6 72.75 72.47 72.57 hbld 81.4 80.67 80.97 80.95 81.26 81.05 Genes Melting temperatures (T m ) of different reference strains Mean cytk 76.91 76.09 76.23 76.26 76.08 76.31 nhea 75.65 75.77 75.43 75.39 75.55 75.55 entfm 77.61 77.29 77.41 77.77 77.48 77.51 ces 72.43 72.44 72.56 72.65 72.78 72.57 hbld 80.69 80.87 81.14 81.2 81.16 81.01-70 -
- 71 -
그림 3.9 Melting curves of different genes in singleplex real time PCR (2nd set of primers) using (A) StepOne PCR machine: cytk: Tm 76.21 C, nhea: Tm 75.47 C, entfm: Tm 77.91 C, ces: Tm 72.57, hbld: Tm 81.05 C; (B) Rotor Gene 6000 real time PCR machine: cytk: Tm 76.31 C, nhea: Tm 75.55 C, entfm: Tm 77.51 C, ces: Tm 72.57, hbld: Tm 81.01 C - 72 -
그림 3.10 Amplification plot for cytk gene. Reference strains show their amplification in PCR analysis and that there is no amplification for non-target strains (2nd set of primers). - 73 -
MgSO 4 μ Component Volume (μ Roche 2X master mix 12.5 ddh 2 O 3.5 Primer mix 1 (100 nm hbld/ces) 1 Primer mix 2 (200 nm nhea, cytk, entfm) 1 Q-solution (Qiagen) 2 MgSO 4 3 dntp 1 Template DNA 1 Total volume 25 μ - 74 -
그림 3.11 Melting curve analysis of multiplex PCR real time assay. This analysis was detected using Roche master mix with the addition of extra components (2nd set of primers). - 75 -
- 76 -
재디자인된 3rd set of primers-using multiplex real-time PCR 의최적화를위하여순수 배양액 (pure culture), 인위적오염식품 ( 아기시리얼, 김밥, 저온살균우유, 파스타, 쌀, 떡, 해바라기오일 ) 시료를통하여 3rd set of primers 의특이성및민감성을평가하였음. - 77 -
Target gene ces1 ces2 ces3 ces4 ces5 ces6 ces7 ces8 ces9 ces10 cytk1 cytk2 Sequence 5 AACATCACCACCAATGAGCA 3 5 AATCAATTGGCGGATCAAAA 3 5 TTGATTGGTGCACAATGGTC 3 5 TTGCTCATTGGTGGTGATGT 3 5 TGCACAATGGTCCATCACTT 3 5 TTGCTCATTGGTGGTGATGT 3 5 TGGAATGACCACCAAGTTCA 3 5 GGCTAAAATTTGGCGTGATG 3 5 CATTCTCACTCGGCAAACAC 3 5 TGAACTTGGTGGTCATTCCA 3 5 TCGCATTAATGGAATGACCA 3 5 TGGCTAAAATTTGGCGTGAT 3 5 ATCGCGGCTGATTTTATTTG 3 5 TTTCAAGAACCGCAATCAGA 3 5 ACAATCGCTTTTAGCCCAAG 3 5 ATTTTTGTCGGACTGGATGC 3 5 ATGCAACCATCAATGGCATA 3 5 TGACTTGGATCCACATCGAG 3 5 GGGAGCCAACAACAATGTCT 3 5 CATGCAAATGGTGTAACGATG 3 5 CGT TGT TTC CAA CCC AGT TT 3 5 TAT ACA AAA CAC GCC GAC GA 3 5 TTT CCA ACC CAG TTT GCA GT 3 5 TAT ACA AAA CAC GCC GAC GA 3 Product length Product Tm 69 bp 75.31 C 71 bp 73.20 2 C 63 bp 72.32 C 80 bp 73.52 C 73 bp 72.32 C 90 bp 73.96 C 84 bp 75.72 C 83 bp 74.11 C 86 bp 73.37 C 97 bp 72.32 C 76 bp 79.17 C 71 bp 79.02 C AY691650; DQ345790; AY691650; DQ459072; JN112796 AY691650; DQ345790; AY691650; DQ459072; JN112796 AY691650; DQ345790; AY691650; DQ459072; JN112796 AY691650; DQ345790; AY691650; DQ459072; JN112796 AY691650; DQ345790; AY691650; DQ459072; JN112796 AY691650; DQ345790; AY691650; DQ459072; JN112796 AY691650; DQ345790; AY691650; DQ459072; JN112796 AY691650; DQ345790; AY691650; DQ459072; JN112796 AY691650; DQ345790; AY691650; DQ459072; JN112796 AY691650; DQ345790; AY691650; DQ459072; JN112796 AJ277962; JN222929; JN222924; AJ318875; AJ318876 AJ277962; JN222929; JN222924; AJ318875; AJ318876 Design source DQ360825; JN222922; DQ238109; JN112795; DQ360825; JN222922; DQ238109; JN112795; DQ360825; JN222922; DQ238109; JN112795; DQ360825; JN222922; DQ238109; JN112795; DQ360825; JN222922; DQ238109; JN112795; DQ360825; JN222922; DQ238109; JN112795; DQ360825; JN222922; DQ238109; JN112795; DQ360825; JN222922; DQ238109; JN112795; DQ360825; JN222922; DQ238109; JN112795; DQ360825; JN222922; DQ238109; JN112795; DQ019311; JN222928; CP000001; AJ318877; DQ019311; JN222928; CP000001; AJ318877; - 78 -
Target gene cytk3 cytk4 cytk5 cytk6 cytk7 cytk8 cytk9 nhea1 nhea2 nhea3 entfm1 entfm2 entfm3 entfm4 entfm5 Sequence 5 TTG CAG TTC CGA ATG TGA AG 3 5 TAT ACA AAA CAC GCC GAC GA 3 5 CAA CAG CGA TCA TAC CAG GA 3 5 ACC GAT GGA TCA ACT TCC AG 3 5 TAA AGA AAC GGG CGC TGT TA 3 5 CTG GCG CTA GTG CAA CAT TA 3 5 GCT TTA ACA GAA CCG CCA AG 3 5 CGC CCG TTT CTT TAA CGT AG 3 5 AAG CCT GGA CGA AGT TGG TA 3 5 TCC TGG TAT GAT CGC TGT TG 3 5 CGC TCG GAT CAT CGA TAA AA 3 5 TTC AAC ACC TGC TGC TTA CG 3 5 TAA AGA AAC GRG CGC TGT TA 3 5 CTG GYG CTA GTG CAA CAT TA 3 5 TGAAATTGTAAATGCTGCA 3 5 GCCTCTGMTTCAGTTTGTGA 3 5 TGAAATTGTAAATGCTGCA 3 5 ATTTGWGTCGCCTCTGMTTC 3 5 TGAAATTGTAAATGCTGCA 3 5 TGTAATTTGWGTCGCCTCTG 3 5 GGAACTGGATACGTAAGC 3 5 GCTGGGCCTGTACGTACTTT 3 5 GGAACTGGATACGTAAGC 3 5 TTGTAGTTGGTTGTTGTGTTTSG 3 5 GGAACTGGATACGTAAGC 3 5 CCRTTTGTTACKCCACCGATT 3 5 GGAACTGGATACGTAAGC 3 5 CAACCATTTTCAGCRCCAGT 3 5 GGAACTGGATACGTAAGC 3 5 CGGCCGTTATGGTTAATTT 3 Product length Product Tm 58 bp 77.2 C 62 bp 72.9 C 81 bp 74.55 C 93 bp 75.74 C 105 bp 75.59 C 155 bp 75.14 C 81 bp 74.4 C 114 bp 75.67 C 123 bp 76.32 C 127 bp 76.57 C 158 bp 77.42 C 79 bp 74.97 C 194 bp 78.17 C 230 bp 78.27 C 255 bp 78.42 C Design source AJ277962; DQ019311; JN222929; JN222928; JN222924; CP000001; AJ318875; AJ318877; AJ318876 AJ277962; DQ019311; JN222929; JN222928; JN222924; CP000001; AJ318875; AJ318877; AJ318876 AJ277962; DQ019311; JN222929; JN222928; JN222924; CP000001; AJ318875; AJ318877; AJ318876 AJ277962; DQ019311; JN222929; JN222928; JN222924; CP000001; AJ318875; AJ318877; AJ318876 AJ277962; DQ019311; JN222929; JN222928; JN222924; CP000001; AJ318875; AJ318877; AJ318876 AJ277962; DQ019311; JN222929; JN222928; JN222924; CP000001; AJ318875; AJ318877; AJ318876 AJ277962; DQ019311; JN222929; JN222928; JN222924; CP000001; AJ318875; AJ318877; AJ318876 Y19005; DQ019312; DQ885236; DQ153261; DQ153257 Y19005; DQ019312; DQ885236; DQ153261; DQ153257 Y19005; DQ019312; DQ885236; DQ153261; DQ153257 AY789084; AY897207; EF453661; EF453653; EF453659 AY789084; AY897207; EF453661; EF453653; EF453659 AY789084; AY897207; EF453661; EF453653; EF453659 AY789084; AY897207; EF453661; EF453653; EF453659 AY789084; AY897207; EF453661; EF453653; EF453659-79 -
Target gene Sequence Product length Design sources: Genebank identification no. entfm5 5 GGA ACT GGA TAC GTA AGC 3 5 CGG CCG TTA TGG TTA ATT T 3 255 bp AY789084; AY897207; EF453661; EF453653; EF453659 hbld 5 GCA TGG TCA ATT GGT GGT 3 5 CAC CAG CTG CTG TTC CTA 3 163 bp U63928; AJ007794; AY820178; AY820179; AY822582; AY822584 nhea3 5 TGA AAT TGT AAA TGC TGC A 3 5 TGT AAT TTG WGT CGC CTC TG 3 127 bp Y19005; DQ019312; DQ885236; DQ153261; DQ153257 ces10 5 GGG AGC CAA CAA CAA TGT CT 3 5 CAT GCA AAT GGT GTA ACG ATG 3 97 bp AY691650; DQ360825; DQ345790; JN222922; AY691650; DQ238109; DQ459072; JN112795; JN112796 cytk9 5 TAA AGA AAC GRG CGC TGT TA 3 5 CTG GYG CTA GTG CAA CAT TA 3 81 bp AJ277962; DQ019311; JN222929; JN222928; JN222924; CP000001; AJ318875; AJ318877; AJ318876-80 -
반응온도반응시간 Cycle 수 95 C 10 min 1 cycle 95 C 15 sec 58 C 1 min 35 cycles Final step (melting curve step) from 60 C to 95 C, with gradual temperature increments of 0.1 C/s - - 81 -
그림 3.12 Singleplex melt curve of primers of 3rd set of primers. cytk: Tm 74.4 C, nhea: Tm 76.57 C, entfm: Tm 78.42 C, ces: Tm 72.37, hbld: Tm 81.81 C. - 82 -
Genes Melting temperatures (Tm) of different reference strains ( ) Mean T M ( ) ces10 72.37 71.96 72.14 72.31 72.21 72.20 cytk9 74.40 73.89 74.41 74.46 74.53 74.34 nhea3 76.57 76.39 76.48 76.71 76.62 76.55 entfm5 78.42 78.18 78.63 78.71 78.18 78.42 hbld 81.81 81.64 81.52 82.31 82.26 81.90-83 -
Primer name Optimum concentrations (nm) ces10 50 cytk9 150 nhea3 100 entfm5 50 hbld 100 그림 3.13 Optimization of primers concentrations in multiplex real-time PCR melt curve analysis (3rd set of primers). A: a sample of optimization process before finding the optimum primer mixture concentration in B. cereus ATCC 12480. B: final optimized primer concentrations in B. cereus ATCC 12480 enterotoxic reference strain. - 84 -
그림 3.14 Ability of all 5 primers to work in multiplex using equal amounts of B. cereus ATCC 12480 and F4810/72. - 85 -
그림 3.15 Final evaluation of the multiplex real-time PCR High Resolution Melting Curve Analysis on two reference strains. - 86 -
개발된 3rd set of primers-using multiplex real-time PCR 의효율검증을위하여순수배 양액에서의검출한계분석과실제식품및환경시료에서의오염도분석을수행하여 PCR kit 의우수함을검증하였음 Strain B. cereus ATCC13061 B. cereus ATCC12480 B. cereus KCTC1013 B. cereus KCTC1094 B. cereus F4810/72 Type Concentration of DNA in PCR reaction tube 2 ng 200 pg 20 pg 2 pg 200 fg 20 fg Enterotoxic + + + + + - Enterotoxic + + + + + - Enterotoxic + + + + + - Enterotoxic + + + + + - Emetic + + + + + - - 87 -
그림 3.16 Limit of detection in artificially inoculated milk (A) and rice (B). The figure shows amplification plot of the HRM multiplex real-time PCR approach (3rd set of primers) for B. cereus F4810/72 from 1.8 10 7 to 1.8 10 2 cfu/ml in milk and 2.3 10 7 to 2.3 10 2 cfu/g of B. cereus ATCC 12480 in rice. - 88 -
- 89 -
w w w - 90 -
요약 1. 구토및설사형바실러스세레우스멀티플렉스피씨알동시검출키트들 (Emetic & Enterotoxic Bacillus cereus multiplex detection kit 및 multiplex real-time PCR detection kit) 의시제품을개발하였음. w 각 PCR 키트구성성분들의농도및용량을대량생산을위하여계산하고오차율을고려한값을결정하고사용자편의를고려한동결건조형키트를제작하였음. w multiplex PCR kit는다음의 3가지구성요소로이루어졌음 : (1) 0.2 ml 8-stripe PCR tubes ( 동결건조된 PCR master mix가들어있음 ), (2) primer mix tube ('P' 로표시함, 제 2 프라이머세트혼합액 ), (3) positive control tube ('C' 로표시함, B. cereus ATCC 12480( 설사형 ) 와 F4810/72( 구토형 ) 유전체혼합액 ). w multiplex real-time PCR kit는다음의 3가지구성요소로이루어졌음 : (1) real-time PCR premix tube ('2XM' 으로표시함, MeltDoctor TM HRM master mix), (2) primer mix tube ('P' 로표시함, 제3 프라이머세트혼합액 ), (3) positive control tube ('C' 로표시함, B. cereus ATCC 12480( 설사형 ) 와 F4810/72( 구토형 ) 유전체혼합액 ). 2. 개발된 PCR kit의성능을 AOAC protocol 에따라검증하고평가함 w PCR kits의실험법및 AOAC 검증을위한사용자편의프로토콜 을개발함 w AOAC 검증방법으로인위접종시료, 그리고실제식품및환경시료등을대상으로두 PCR kits와표준배지배양법을비교시험한검출결과는세가지방법중 multiplex real-time PCR kit가가장우수함을나타냄. w AOAC 검증방법에따라 3개의독립된실험실에서각각두 PCR kits의검증을수행하여개발된 PCR kits의우수한성능을검증하였음. 3. 개발된 PCR kits는다음과같은장점이있음 : (1) 신속함 : 시험소요시간이짧음 (1~3 시간 ( 증균전 ) 또는 1일이내 ( 증균후 ), (2) 높은민감도 : 식품그램당약 10 3 CFU/g ( 증균전 ), 10 1 CFU/g ( 증균후 ), (3) 높은특이도 : 전통적배지법과비교하여위양성및위음성을최소화할수있음, (4) 명확성 : 균동정을위한추가확인시험이필요없음, (5) 경제성 : 추가시험이불필요하고, 할일이적으므로더경제적임, (6) 독성유전자프로파일작성 : B. cereus 검출뿐만아니라독성유전자프로파일을작성하여의학적, 전염병학적, 및환경적연구에적용가능, (7) 기록과문서화용이함 : 전통적배지방법보다 PCR 방법에서얻어진결과들은더쉽게문서화할수있고향후분석을위하여장기간보관할수있음. - 91 -
- 92 -
- 93 -
그림 3.17 개발된각 PCR kits 시제품의외형 (Outer view of multiplex PCR and multiplex real-time PCR kits produced by Kogenebiotech.) - 94 -
w w w 그림 3.18 개발된 multiplex PCR detection kit 시제품키트의모든내용물 (All components of the multiplex PCR detection kit produced by Kogenebiotech.) - 95 -
w w w 그림 3.19 개발된 multiplex real-time PCR detection kit 시제품키트의내용물 (All components of the multiplex real-time PCR detection kit) - 96 -
- 97 -
그림 3.21 multiplex PCR detection kit 에대한사용자편의차트식실험법 (User friendly Protocol for the multiplex PCR detection kit using an easy to understand flowchart.) - 98 -
그림 3.22 multiplex real-time PCR detection kit 에대한사용자편의차트식실험법 (User friendly Protocol for multiplex real-time PCR detection kit using an easy to understand flowchart.) - 99 -
그림 3.23 키트검증을위해사용한 3 종류의식품시료들사진. (The 3 food types used in the study for the AOAC validation of the multiplex PCR and multiplex real-time PCR detection kits.) - 100 -
- 101 -
그림 3.24 개발된키트들에대한 AOAC 에기초한검증을위한사용자편의프로토콜의요약 (Brief, user friendly protocol for the AOAC based validation of multiplex PCR and multiplex real-time PCR kits.) - 102 -
AOAC 검증을위한 사용자편의프로토콜 1. 먼저, 각식품품목 ( 예, 밥, 우유또는파스타 ) 당 24 개시료 (lots) 를준비한다. 2. 각식품시료 24 개중각두개씩음성및양성대조군으로준비한다. 음성대조군은세 균을접종하지않은것이며, 양성대조군은세균의순수배양액을직접사용한다. 3. 24 개시료들중 10 개씩두가지레벨로해당세균에의해인위접종한다. 두가지세 트의접종균수표시는다음과같다 : high level inoculum 및 low level inoculum. 4. 각세트의시료는각세균을무작위로접종한후, 접종한세균과음식물을잘섞어준 다. 5. 멸균 stomacher bags 에시료밥또는파스타 400 그램또는우유 400 밀리리터를 25 g 또는 25 ml 씩각각나눈후, 균질화하기위하여 stomacher 에서 2 분간혼합한다. 6. 그후, 이들시료를 DNA 추출또는 MYP 선택배지배양법등의실험에사용한다. 7. 각키트의프로토콜에따라 multiplex PCR kit, multiplex real-time PCR kit 를통해얻 은결과들그리고 conventional culture method 로부터얻은결과들을 AOAC formulas 에따라분석을수행하여서로의결과를비교분석한다. - 103 -
- 104 -
그림 3.25 식품시료에서 DNA 추출법을위한사용자편의프로토콜의요약 (Brief, user friendly protocol for the DNA extraction from food samples using Mo Bio Powerfood Microbial DNA Isolation Kit.) - 105 -
- 106 -
- 107 -
w w w 실험재료및방법에서설명한 AOAC protocol에따라본연구에서개발된 multiplex conventional PCR kit 및 multiplex real-time PCR kit의검증시험을수행하였음. 3개의독립된실험실들에서독립적으로검증시험을수행한결과, 개발된 multiplex real-time PCR 키트의성능이제일우수한것을검증됨. 두 PCR kits에서얻은결과를 conventional culture method에서얻은결과와비교분석하여새로개발된 PCR 방법들의상업적스케일의제품키트들의효율을검증하였음. - 108 -
- 109 -
- 110 -
Sample Inoculated samples (1~10) Negative control 1 2 3 4 5 6 7 8 9 10 1 2 Positive control Rice Low Rice High MYP + + + + PCR + + + + + + + + + rtpcr + + + + + + + + MYP + + + + + + + + + + + + + PCR + + + + + + + + + + + + + rtpcr + + + + + + + + + + + + + Pasta Low Pasta High MYP + + + + + + + PCR + + + + + rtpcr + + + + + + + + MYP + + + + + + + + + + PCR + + + + + + + + + rtpcr + + + + + + + + + Milk Low Milk High MYP + + + PCR + + + + + + rtpcr + + + + + + MYP + + + + + + + + + + + PCR + + + + + + + + + + + rtpcr + + + + + + + + + + + - 111 -
그림 3.26 B. cereus F4810/72에대한식품시료 ( 밥 ) 에서의 AOAC 검증결과. AOAC validation results for rice inoculated with B. cereus F4810/72. A) amplification plot for positive control, negative controls and inoculated samples (high inoculum, F4810/72 reference strain) using the multiplex real-time PCR HRM detection kit; B) MYP agar results for low level inoculum (3 positives); C) multiplex PCR detection kit results: Lane 1: ladder, Lane 2-11: high level inoculated samples, Lane 12: positive control, Lane 13: negative control, Lane A-J low level inoculated samples in laboratory number 1 (Kangwon National University). - 112 -
그림 3.27 B. cereus ATCC 12480에대한식품시료 ( 파스타 ) 에서의 AOAC 검증결과. AOAC validation results for pasta inoculated with B. cereus ATCC 12480 12480 in laboratory number 1 (Kangwon National University). A) results of MYP agar conventional method in high (9 positives) and low (6 positives) level inoculum; B) multiplex PCR detection kit results: Lane 1-10: inoculated samples; Lane 11: positive control; Lane 12: ladder; C) multiplex real-time PCR detection kit results in StepOneTM machine. - 113 -
Food sample Pasta (ATCC 12480) Rice (F4810/72) Milk (KCTC 1013) positives negatives positives negatives positives negatives MYP 6 b 4 3 a 7 2 a 8 Low inoculum PCR 4 a 6 8 b 2 5 b 5 rtpcr 7 b 3 7 b 3 5 b 5 MYP 9 a 1 10 a 0 10 a 0 High inoculum PCR 8 a 2 10 a 0 10 a 0 rtpcr 8 a 2 10 a 0 10 a 0 *Numbers labeled with different letters for each inoculation level of every individual food represent a significant difference. - 114 -
- 115 -
Food sample Pasta (ATCC 12480) Rice (F4810/72) Milk (KCTC 1013) positives negatives positives negatives positives negatives MYP 8 a 2 10 b 0 10 a 0 Low inoculum PCR 10 b 0 6 a 4 10 a 0 rtpcr 9 ab 1 10 b 0 10 a 0 MYP 10 a 0 10 a 0 10 a 0 High inoculum PCR 10 a 0 10 a 0 10 a 0 rtpcr 10 a 0 10 a 0 10 a 0 * 모든식품의각접종레벨에서세가지검출방법에대한수치들에다른알파벳으로표시되면이수치는 서로통계적으로유효한차이를나타냄. (Numbers labeled with different letters for each inoculation level of every individual food represent a significant difference.) - 116 -
그림 3.28 제2실험실에서수행된 multiplex PCR detection kit에대한 AOAC 검증실험결과들. multiplex PCR detection kit AOAC validation results for pasta inoculated with B. cereus ATCC 12480 in low and high inoculum levels in laboratory number 2 (Agricultural Research Center). - 117 -
그림 3.29 제 2 실험실에수행된 AOAC 검증실험결과들. (AOAC validation results for pasta inoculated with B. cereus ATCC 12480 in low inoculum level using multiplex real-time PCR kit in laboratory number 2.) - 118 -
- 119 -
Food sample Pasta (ATCC 12480) Rice (F4810/72) Milk (KCTC 1013) positives negatives positives negatives positives negatives MYP 10 a 0 10 a 0 10 a 0 Low inoculum PCR 10 a 0 10 a 0 10 a 0 rtpcr 10 a 0 10 a 0 10 a 0 MYP 10 a 0 10 a 0 10 a 0 High inoculum PCR 10 a 0 10 a 0 10 a 0 rtpcr 10 a 0 10 a 0 10 a 0 * 모든식품의각접종레벨에서세가지검출방법에대한수치들에다른알파벳으로표시되면이수치는 서로통계적으로유효한차이를나타냄. (Numbers labeled with different letters for each inoculation level of every individual food represent a significant difference.) - 120 -
그림 3.30 제 3 실험실에서수행된 multiplex PCR detection kit 에대한 AOAC 검증실험결 과들. AOAC validation results for pasta inoculated with B. cereus ATCC 12480 in laboratory number 3 at high and low level inoculum (Konkuk University). - 121 -
그림 3.31 제 3 실험실에수행된 AOAC 검증실험결과들. AOAC validation results for pasta inoculated with B. cereus ATCC 12480 in low inoculum level using multiplex real-time PCR kit in laboratory number 3 (Konkuk University). - 122 -
- 123 -
- 124 -
- 125 -
Kimbab Without enrichment 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Total MYP - - - - - - - - - + - - - + - 2/15 PCR + + + - - - - - - - - + - - - 4/15 real-time PCR - - - + + - - - - - + + + - - 5/15 With enrichment 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Total MYP + + + - + - + + + - - - + - + 9/15 PCR + + + + + + + + + + - + + + + 14/15 real-time PCR + + + + + + + - + + - + + + - 12/15 pork Meat Without enrichment 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Total MYP - - - - - - - + + + - - - - - 3/15 PCR + - - - - - - - - - - + - - - 2/15 real-time PCR + - - - + - - - - - - - + - - 3/15 With enrichment 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Total MYP + + + + + + + + + + + - + + - 13/15 PCR - + - + - + - - - - - + + + - 6/15 real-time PCR - + + + + + + + - - + + + + + 12/15 Tofu Without enrichment 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Total MYP - - - - - - - - - + - - - - - 1/15 PCR - - - + + + - - - - - - - + - 4/15 real-time PCR + + - - - + - - - - - + + - - 5/15 With enrichment 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Total MYP + + - + - + + + + + + + + + + 13/15 PCR + + + + + + + - + + + + - + - 12/15 real-time PCR + + + + + + + + + + - + - + + 13/15 Spinach Without enrichment 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Total MYP - - + - + - - + + - + - + + + 8/15 PCR + - + + - + - - + + + + - + - 9/15 real-time PCR + - + + + + - + + - - + - + - 9/15-126 -
With enrichment 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Total MYP + + + + - + + + + + + + + + + 14/15 PCR + + + + + + + + + + + + + + + 15/15 real-time PCR + + + + + + + + + + + + + + + 15/15 Lettuce Without enrichment 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Total MYP - - + - + + + + - - + - - + - 7/15 PCR - - + + + - + - - - - - - + - 5/15 real-time PCR + + + + + + + - + - + + + + + 13/15 With enrichment 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Total MYP - + + - + - - - - - + + - + - 6/15 PCR + + + + + + + - - - + + + + + 12/15 real-time PCR + - + + + + + - + + + + + + + 13/15 Rice Without enrichment 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Total MYP - - + - - - - - - - - - - - + 2/15 PCR - - - - - + - - - + - - + - - 3/15 real-time PCR - - + + + + + + + + - + - - - 9/15 With enrichment 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Total MYP + - + + + + + + + + - + + + + 13/15 PCR + + + + + + + + + + - - - - - 10/15 real-time PCR + + + + + + + + + + - - - - + 11/15 Tomato Without enrichment 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Total MYP - - - - + - - - - - - - - + - 2/15 PCR - - - - - - - - - - - - - - - 0/15 real-time PCR - + - - + + - - - + + + + + - 8/15 With enrichment 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Total MYP + - - - - - - - + + - - - + - 4/15 PCR - - - - + - - + - - - - - - - 2/15 real-time PCR + - + + - + + - + + - - - + - 8/15-127 -
그림 3.32 상추에서전통적배지법, multiplex PCR kit 및 multiplex real-time PCR kit 에의 한결과들 (Results of real-time PCR kit, mpcr kit and conventional MYP agar method on lettuce.) - 128 -
그림 3.33 7가지식품시료에서자연적오염도에대한증균전및증균후세가지다른검출방법의시험결과들. Detection rates in naturally contaminated foods for all food samples using the three different methods, with and without enrichment. ( 증균전및증균후 real-time PCR 결과들 ( 흑색 ) 이전통배지배양법 ( 녹색 ) 이나 multiplex PCR법 ( 적색 ) 보다가장민감한것으로나타남에주목하라.) - 129 -
- 130 -
< 요약 > 5종병원성대장균검출을위한 PCR system의제작을위하여다양한병원성대장균특이유전자마커및 Primer set을 Database 화하여각각의성능을평가하였음 Primer 후보군중병원성대장균의검출의성능을평가하기위하여 BLAST 및 in silico PCR amplification 을통하여일부를 Rule-Out 하였고, 본실험실에서보유하고있는병원성대장균균주를대상으로 Primer 의성능을평가하기위하여민감도및특이도를검증하였음. - 131 -
4.1-132 -
Web of science Pubmed - 133 -
- 134 -
4.3. Primer-blast primer 4.4 Schematic diagram for Conventional PCR primer screening - 135 -
4.5 Schematic diagram for Real-time PCR primer screening - 136 -
그림 4.6 in silico Simulation 홈페이지 - 137 -
그림 4.7 정부기관으로의각병원성대장균균주분양신청 ( 질병관리본부 ) 표 4.2 병원성대장균보유현황 질병관리본부 서울시보건환경연구원 합계 EPEC 12 3 15 EHEC 8 3 11 EAEC 11 3 14 EIEC 5 3 8 ETEC 12 3 15 Total 48 15 63-138 -
- 139 -
그림 4.8 Enterobacteriaceae 의 DNA 및 rrna 상동성 (Spence et al., 1994) - 140 -
- 141 -
- 142 -
EAEC EIEC EPEC ETEC 그림 4.9 기보유한병원성대장균들의각 target gene 에대한 Conventional PCR 검증 ( 일부 ) - 143 -
- 144 -
- 145 -
- 146 -
- 147 -
- 148 -
- 149 -
- 150 -
- 151 -
- 152 -
- 153 -
- 154 -
- 155 -
< 요약 > 1. 대장균검출을위한 Primer 디자인 기존 E. coli species 의검출에사용되는유전자는 uid A, 16s rrna 가사용되었으나한계점이존재하였음. 따라서대장균 species 검출을위한새로운 Primer의개발이필요함. Lactose permease 를코딩하는 Lac Y gene을대상으로 Primer 를개발하였으며개발된 Primer 는병원성대장균및기타식중독균을대상으로민감도및특이도를평가하였음. 총 63개의대장균에서양성, 50개의기타식중독균을대상으로음성결과를나타내었으며따라서대장균 species 검출을위한 lac Y primer 개발이완료되었음. 2. 5 종병원성검출을위한 Conventional PCR 개발 Primer 후보군의각유형별병원성대장균및비병원성대장균, 대장균이외의식중독균에대한민감도및특이도평가를실시하였음. PCR을이용한병원성대장균의용이한검출방법을위하여 Flowchart 를제작하였고이를통해대장균의병원성유무를쉽게판정할수있음. 또한개발된 PCR Primer 후보군의각유형별병원성대장균및비병원성대장균, 대장균이외의식중독균에대한민감도및특이도평가를실시하였음. 최종적으로선정된 Conventional PCR 세트의검출한계를평가함. 순수배양액에서검출한계는 4log cfu/ml 이며식품의인위접종후 24시간배양후에는검출한계가 1log cfu/g(ml) 이다. 이는대장균의특성상외부균의영향을적게받고빠르게증균하기때문인것으로보임. 결론적으로개발된 Conventional PCR 세트는시료에서병원성대장균을검출하기에유용한것으로평가됨 - 156 -
- 157 -
β - 158 -
- 159 -
- 160 -
- 161 -
- 162 -
- 163 -
- 164 -
- 165 -
- 166 -
- 167 -
그림 5.4 Multiplex Conventional PCR 을이용한병원성대장균검출모식도 - 168 -
- 169 -
- 170 -
- 171 -
그림 5.6 5 종병원성대장균검출을위한 Multiplex Conventional PCR 결과 Lane M : 100 bp DNA ladder, 1 : EAEC, 2 : EIEC, 3 : EPEC or EHEC, 4 : EPEC+EAEC+EIEC, 5 : ETEC(LT), 6 : ETEC(STh, STp), 7 : ETEC(LT, STh, STp) 8 : EHEC(stx1), 9 : EHEC(stx2), 10 : EHEC(stx1, stx2), 11: EPEC(bfp), 12 : EHEC + EPEC, 13 : Escherichia coli ATCC 25922, 14 : Shigella flexneri ATCC 12026 Pre-denaturation step X 35 Denaturation Annealing Extension Final extension 95 /5min 95 /30s 60 /30s 72 /1min 72 /5min - 172 -
- 173 -
- 174 -
- 175 -
- 176 -
- 177 -
- 178 -
- 179 -
- 180 -
< 요약 > 1. Internal Amplification Control(IAC) 개발 식품, 임상및환경시료에서 DNA를추출후 PCR을실시하였을시시료내존재하는 PCR inhibitor 로위음성결과를나타낼수있음. IAC는 PCR의위음성결과를배제하여정확한결과를얻을수있게함. 본연구팀은 Viral hemorrhagic septicemia virus(vhsv) 의 DNA sequence 를이용하였으며 VHSV는사람및식품시료에서검출된적이없어적합함. IAC는 10 4 copies/ul 의 Template 농도, 75nM Primer 농도및 250nM Probe 농도가최종적으로결정됨. 개발된 IAC의 Sequence는 Cloning을통하여 IAC 생산및활용이용이하도록하였음. 2. 5 종병원성검출을위한 Real-time PCR 개발 Primer 및 Probe 후보군의각유형별병원성대장균및비병원성대장균, 대장균이외의식중독균에대한민감도및특이도평가를실시하였음. 최종적으로선정된 Real-time PCR 검출을위한 Primer/probe 는 IAC와동시에사용되면서검출한계를평가함. 순수배양액에서검출한계는 4log cfu/ml 이며식품의인위접종후 24시간배양후에는검출한계가 1log cfu/g(ml) 이다. 이는대장균의특성상외부균의영향을적게받고빠르게증균하기때문인것으로보임. 결론적으로개발된 IAC와 Real-time PCR 세트는시료에서병원성대장균을검출하기에유용한것으로평가됨 - 181 -
PCR inhibitor Bile salts complex polysaccharides collagen heme Humic acid Melanin and eumelanin myoglobin polysaccharides proteinases calcium ions urea Hemoglobin, lactoferrin immunoglobin G indigo dye Source of inhibitor feces feces, plant material tissues blood soil, plant material hair, skin muscle tissue plants milk milk, bone urine blood blood denim - 182 -
- 183 -
- 184 -
그림 6.1 pcr-topo vector 의구조 그림 6.2 IAC 의 cloning 과정 - 185 -
μ μ - 186 -
- 187 -
- 188 -
그림 6.3 X-gal 을도포한 LB agar. Sequence 의 Vector 삽입유무확인 *Blue colony : Vector 내로 Sequence 정상적으로삽입안됨 *White colony : Vector 내로 Sequence 정상적으로삽입 - 189 -
그림 6.4 M13 Primer 를이용한 Vector 의 PCR 반응 그림 6.5 Bioedit 을이용하여 Target Sequence 의 Vector 내정상적인삽입확인 - 190 -
그림 6.6 Standard curve of internal amplification control - 191 -
- 192 -
- 193 -
- 194 -
- 195 -
- 196 -
- 197 -
Pathotyp e Target gene Primer & probe Sequence(5-3 ) Conc (pmole) Reference EPEC eaea Forward CAT TGA TCA GGA TTT TTC TGG TG ATA 0.075 Reverse CTC ATG CGG AAA TAG CCG TTA 0.075 probe FAM-ATA GTC TCG CCA GTA TTC GCC ACC AAT ACC-TAMRA 0.25 Nielsen et al., 2003 Forward CCT TTT CCG CGT TCC TTG 0.075 EIEC ipah Reverse CGG AAT CCG GAG GTA TTG C 0.075 probe FAM-CGC CTT TCC GAT ACC GTC TCT GCA-TAMRA 0.25 Thiem et al., 2004 Forward GCC TAA AGG ATG CCC TGA TG 0.5 EAEC aggr Reverse GAC CAA TTC GGA CAA CTG CAA 0.5 probe FAM-CAT CTA CTT TTG ATA TTC CGT AT-TAMRA 0.25 Delannoy et al 2012 Forward GTG GCA TTA ATA CTG AAT TGT CAT CA 0.075 stx1 Reverse GCG TAA TCC CAC GGA CTC TTC 0.075 EHEC probe FAM-TGA TGA GTT TCC TTC TAT GTG TCC GGC AGA T-TAMRA 0.25 Forward GAT GTT TAT GGC GGT TTT ATT TGC 0.075 Jinneman et al.,2012 stx2 Reverse TGG AAA ACT CAA TTT TAC CTT TAG CA 0.075 probe FAM-TCT GTT AAT GCA ATG GCG GCG GAT T-TAMRA 0.25-198 -
Pathotype Target gene Primer & probe Sequence(5-3 ) Conc (p/mole) Reference Forward TTC CCA CCG GAT CAC CAA 0.075 LT Reverse CAA CCT TGT GGT GCA TGA TGA 0.075 Hidaka et al.,2009 probe FAM-CTT GGA GAG AAG AAC CCT-TAMRA 0.25 Forward GAA CAA CAC ATT TTA CTG CTG TGA ACT 0.075 ETEC STp Reverse GCA CCA ATA CAT ATA ATA TAG AGG GAA TCA 0.075 lijima al 2007 et probe FAM-TGT TGT AAT CCT GCC TGT GCT CCA TGT TAT T-TAMRA 0.25 STh Forward Reverse probe CTG GTT TTG ATT CAA ATG TTC GTG TCC TGA GGG AAA GGT GAA AAA GAC FAM-TTG ATT TCT TCA TAT TAC CTC CGG ACA TGG CA-TAMRA 0.075 0.075 0.25 Hardegen et al., 2010 Forward ACC AGA CCC AGC ACC AGA TAA G 0.075 lac Y Reverse CTG CTT CTT TAA GCA ACT GGC GA 0.075 P a v l o v i c et al 2011 probe CY5-CAT ACA TAT TGC CCG CCA GTA CAG AC-BHQ2 0.25 E. coli Forward CAT GCC GCG TGT ATG AAG AA 0.075 16s rrna Reverse CGG GTA ACG TCA ATG AGC AAA 0.075 Huijsdens et al., probe FAM-TAT TAA CTT TAC TCC CTT CCT CCC CGC TGA A-TAMRA 0.25 2002-199 -
- 200 -
- 201 -
- 202 -
- 203 -
- 204 -
- 205 -
- 206 -
- 207 -
- 208 -
- 209 -
< 요약 > 개발된키트의장기보관을위해서는동결건조가실시되어야함. 키트는 20 의냉동고에서 4시간예비동결후 70 Ultra-Low freezers에서 8시간동결시켰으며동결된시약을동결건조기에서영하 56 C 온도와 5 mtorr 압력조건하에 3 시간동결건조하였음. 동결건조는시에는다양한동결건조보호제가사용되므로이들에대하여 D.W 만사용한대조군과평가를실시하였으며최종적으로 5% Trehalose 가동결건조전후 PCR 키트에서영향을가장적게미치는것으로나타나최종적으로 5% Trehalose 가첨가되어동결건조를실시함 - 210 -
- 211 -
그림 7.1 동결건조 PCR kit 의제작과정 (a), PCR kit 의준비및 label; (b), -20 에서 4 시간,-70 에서 8 시간예비동결 ; (c), 동결건조 ; (d), 동결건조된 PCR kit - 212 -
- 213 -
- 214 -
< 요약 > 개발된키트성능의검증을위하여동일한조건하에평가및검증을실시하여야함. PCR 키트의실험법및검증을위한사용자편의프로토콜을개발하였으며검증방법으로인위접종시료및접종균을준비하고 PCR kit와배지배양법을비교, 시험하였음. 독립된 2개의실험실에서각각개발된 PCR 키트의검증을수행하여개발된 PCR 키트의우수한성능을검증하였음. - 215 -
- 216 -
- 217 -
- 218 -
- 219 -
그림 8.3 개발된키트들의 AOAC 에기초한검증을위한사용자편의프로토콜의요약 - 220 -
< 사용자편의프로토콜 > - 실험실에서는각시료 ( 예, 우유및다진쇠고기 ) 당 12개의샘플이준비된다. - 각시료의두개는음성대조군과양성대조군에사용될시료이다. - 나머지시료 10 개는인위접종을수행한다. - 2 세트의접종이수행된다 : high level inoculum (10-20 cfu/10g) 그리고 low level inoculum (1-2 cfu/10g) (Hidaka et al., 2009 ; Toshima et al., 2004) - 50g(ml) 시료는무작위로선택되어접종후균과음식물을잘섞이게흔들어준다. - 50g(ml) 의시료를 10 g(ml) 로필터백에각각나눈다. - 시료가들어있는필터백에 90ml의 Brain Heart Infusion broth를첨가하고이들시료를균질화하기위하여멸균 stomacher bags에서 1분간 homogenization 한다. - 3시간동안 37 에서배양후이들시료에 90ml의 Double Strength Tryptone Phosphate broth를첨가하고잘흔들어준뒤 20시간동안 42 에서증균배양한다. - 배양한시료중일부는멸균 loop를이용하여 EMB 배지에 streaking 하고일부는 Intron 사의 G-spin Genomic DNA Extraction Kit (for Bacteria) 를사용하여 DNA 를 추출한다. - EMB agar 배지는 B. cereus를위한 standard selective medium이다 - 추출된 DNA는 PCR 및 real-time PCR 실험에사용하고 EMB 배지에서얻어지는대장균의심집락은 Colony 를증균배양후 DNA를추출하여 PCR로확정한다. - Culture method 및 PCR/ Real-time PCR 서로의결과를비교분석한다. - 접종및비접종음식시료에서의 DNA 추출은 G-Spin Genomic DNA extraction Kit [For Bacteria] (Intron Bio) 를사용하여준비한다. - 그림 8.4는 G-spin Genomic DNA Extraction Kit의추출프로토콜을요약하여보여준다. - 이프로토콜은실험수행자들의이해를돕고 DNA 추출과정을동일하게하기위하여준비되었다. - 221 -
그림 8.4 음식시료에서 DNA 추출을위한사용자편의프로토콜의요약. - 222 -
- 223 -
- 224 -
- 225 -
- 226 -
- 227 -
- 228 -
- 229 -
- 230 -
- 231 -
제 4 장목표달성도및관련분야에의기여도 - 232 -
- 233 -
제 5 장연구개발성과및성과활용계획 가. 연구개발결과의성과및활용목표대비실적 (1) 연구성과목표 ( 단위 : 건수 ) 구분 출원 특허 등록 품종명칭등록 신품종 품종생산수입판매신고 품종보호 출원 등록 ( 예시 ) 유전자원등록 SCI 논문 비 SCI 기타 ( 학회발표 ) 1차년도 2차년도 3차년도 4차년도 5차년도 목표 1 1 1 달성 6 2 2 목표 1 2 2 달성 0 4 3 0 목표 2 1 2 2 달성 3 1 5 2 목표 달성 (2) 목표 달성 목표 4 1 5 5 계달성 9 5 10 4 6 * 연차별연구성과목표는향후연차평가등의정량적평가지표로활용됨 ** 연구성과는연구계획에따라도출된것으로예시와같이작성 (2) 연구성과활용목표 구분기술실시 ( 이전 ) 상품화정책자료교육지도언론홍보 ( 단위 : 건수 ) 기타 ( 홍보전시 ) 활용건수 목표 2 2 달성 3 2 1 * * 행사명칭 : 2013 제 11 회인터비즈바이오파트너링 & 투자포럼, 행사장소 : 제주도휘닉스아일 랜드, 행사일 : 2013.07.03-05, 행사유형 : 제품설명회, 참여품목 : 구토, 설사독소생성바실러스세 레우스동시신속검출용멀티플랙스중합효소연쇄반응프라이머세트 - 234 -
나. 논문게재성과 게재 연도 2013 2013 2013 2013 2014 2014 2014 2015 2015 논문명 Improvement of modified charcoal-cefoperazone-deoxycholat e agar by addition of potassium clavulanate for detecting Camylobacter spp. in chicken carcass rinse Prevalence, characterization, and antimicrobial susceptibility of Salmonella Gallinarum isolated from eggs produced in Conventional or organic farms in South Korea 생리활성 펩타이드를함유하는치 즈유청단백질가수분해물로부터기 능성건강음료개발에관한연구 : 총설 발효낙농유제품인 Kefir 다양한기 능및특성 : 총설 Comparison of 3 Selective Media for Enumeration of Bacillus cereus in Several Food Matrixes Improved multiplex PCR detection of Bacillus cereus group and its toxic strains in food and environmental samples Enterotoxigenic profiling of emetic toxin- and enterotoxin-producing Bacillus cereus, Isolated from food, environmental, and clinical samples by multiplex PCR 비살균원유로만든다양한치즈의 안전성에관한연구 : 총설 Sodium Chloride 가치즈의품질에 미치는영향과저염치즈개발기술 : 총설 저자 주저자교신저자공동저자 Jung-whan Chon Soo-kyung Lee 유성호 천정환 Jung-whan Chon Fereidoun Forghani Fereidoun Forghani 김홍석 천정환 Kun-Ho Seo Kun-Ho Seo 송광영 송광영 Kun-Ho Seo Deog-H wan Oh Deog-H wan Oh 송광영 송광영 Growth Inhibition of Cronobacter Dong-Hyeo Kun-Ho 2015 sakazakii in Experimentally n Kim Seo Hyunsook Kim Hong-Seok Kim Jung-Whan Chon, Kwang-Young Song, Ji-Yeon Hyeon,Jin-San Moon 서건호천정환 김현숙임종수 윤성식백현동 윤여창 김현숙김동현 김홍석정동관 김수기서건호 Kwang-Young Song Kun-Ho Seo 학술지명 International journal of food microbiology Poultry Science Journal of Korean Dairy Technology and Science Association Journal of Korean Dairy Technology and Science Association Journal of Food Science African Journal of Microbiology Research Jung-Beom Kim Journal of Food Science 천정환임종수 김현숙김동영 김수기서건호 김현숙김동현김홍석정동관김수기서건호 Jung-Wjan Chon Il-Byeong Kamg Journal of Korean Dairy Technology and Science Association Journal of Korean Dairy Technology and Science Association Journal of Food Vol. (No. ) 국내외구분 SCI 구분 165 국외 SCI 92 국외 SCI 31 (2) 31 (2) 79 (12) 8 (47) 79 (11) 국내비 SCI 국내비 SCI 국외 국외 국외 SCI SCI SCI 33 국내비 SCI 33 국내비 SCI 78 (9) 국외 SCI - 235 -
Hyunsook Kim 2015 2015 2015 2015 Contaminated Powdered Infant Formula by Kefir Supernatant Characterization of Escherichia coli Producing Extended-Spectrum b-lactamase (ESBL) Isolated from Chicken Slaughterhouses in South Korea Incidence, Antimicrobial Resistance, and Molecular Characteristics of Nontyphoidal Salmonella Including Extended-Spectrum b-lactamase Producers in Retail Chicken Meat Rapid detection of viable Bacillus cereus emetic and enterotoxic strains in food by coupling propidium monoazide and multiplex PCR (PMA-mPCR) A novel pentaplex real time (RT)- PCR high resolution melt curve assay for simultaneous detection of emetic and enterotoxin producing Bacillus cereus in food Jong-Soo Lim Dasom Choi Fereidoun Forghani Fereidoun Forghani Kun-Ho Seo Kun-Ho Seo Deog-H wan Oh Deog-H wan Oh Hong-Seok Kim Kwamg-Young Song Da-Som Choi Young-Jo Kim Jung-Whan Chon Hong-Seok Kim Hyun-Jung Park Jin-San Moon Sung-Hwan Wee Jung-Whan Chon Hong-Seok Kim Dong-Hyeon Kim Jong-Soo Lim Jin-Hyeok Yim Taimour Langaee, Mohammad Eskandari, Kun-Ho Seo, Mi-Ja Chung Singh, P. Kun-Ho Seo, Protection FOODBORNE PATHOGENS 12 국외 SCI AND DISEASE Journal of Food Protection 78 국외 SCI Food control 55 국외 SCI Food control 60 국외 SCI 2015 * (Sub mit) Pathogenic Eschericia coli isolated from slaughter house environment 임진혁서건호천정환, 김동현 International journal of food microbiology - 국외 SCI 2015 * (Sub mit) Multiplex PCR method with internal amplification control distinguish Shigella spp and enteroinvasive escherichia coli in ready to eat vegetables 임진혁서건호천정환, 김홍석 International journal of food microbiology - 국외 SCI - 236 -
다. 특허성과 출원된특허의경우 등록된특허의경우 등록연도 특허명등록인등록국등록 번호 등록연도 특허명등록인등록국 등록번호 - 237 -
라. 기술료징수현황 기징수액 당해년도징수액 향후징수액 합계 - 3,000,000 매출정율사용료 ( 매출액의3%) 3,000,000+α - - 매출정율사용료 ( 매출액의3%) ( 향후매출액의3%) 20,000,000 20,000,000-20,000,000 마. 사업화현황 사업화명 사업화내용 사업화업체개요 업체명대표자종업원수사업화형태 기매출액 당해년도 매출액 매출액 합계 바. 인력활용 / 양성성과 (1) 인력지원성과 지원총인원 지원대상 ( 학위별, 취득자 ) 성별지역별 박사석사학사기타남여수도권대전기타지역 3 2 1 3 1 2 (2) 장 단기연수지원성과 장기 (2 월이상 ) 단기 (2 월미만 ) 국내국외국내국외 (3) 산업기술인력양성성과 프로그램명프로그램내용교육기관교육개최회수총교육시간총교육인원 사. 경제사회파급효과 산업지원성과 ( 단위 : 2건 ) 고용창출성과 ( 단위 : 명 ) 기술지도 기술이전 기술평가 합계 창업 사업체확장 합계 3 3-238 -
그림 5.1 구토및설사형바실러스세레우스세균을동시에검출할수있는 Multiplex PCR detection kit 시제품 ( 왼쪽 ) 및사용설명서예시. - 239 -
그림 5.2 구토및설사형바실러스세레우스세균을동시에검출할수있는 Multiplex Real-time PCR kit 시제품 ( 왼쪽 ) 및사용설명서예시. - 240 -
- 241 -
그림 5.3 5 종병원성대장균을동시에검출할수있는 PCR 및 Real-time PCR kit, Real-time PCR 에적용할수있는 Internal amplification control kit 의시제품들. - 242 -
제 6 장연구개발과정에서수집한해외과학기술정보 - 243 -
표 2. NCBI 의 PubMed 에서 Bacillus cereus" and "Multiplex PCR" 를검색어로 [all fields] 에 서검색한결과중에서관련성이높은논문들의목록예 (selected papers) 번호 논문제목 저널명및년도 분석 ( 장단점요약 ) 1 Detection of viable enterotoxin-producing Bacillus cereus and analysis of toxigenicity from ready-to-eat foods and infant formula milk powder by multiplex PCR. J Dairy Sci. 2016 설사독소들을타겟으로한 PCR 법으로신선채소류와유아용우유에적용함. 구토독소생성세균은검출못함 2 A novel multiplex PCR discriminates Bacillus anthracis and its genetically related strains from other Bacillus cereus group species. PLoS One. 2015 탄저균검출을위한 PCR 기법으로본과제와는간접적으로연관됨 3 Rapid detection of viable Bacillus cereus emetic and enterotoxic strains in food by coupling propidium monoazide and multiplex PCR (PMA-mPCR) Food Control 2015 본연구팀의결과임. 구토및설사독소생성바실러스를동시에검출함. 특히생균만을특이적으로검출가능함 4 Enterotoxigenic profiling of emetic toxin- and enterotoxin-producing Bacillus cereus, Isolated from food, environmental, and clinical samples by multiplex PCR. J Food Sci. 2014 본연구팀의결과임. 구토및설사독소생성바실러스를동시에검출함 Multiplex PCR assay for the detection of enterotoxic Indian J 설사독소들을타겟으로한 PCR 5 Bacillus cereus group strains and its application in food Microbiol. 법으로여러식품에적용함. 구 matrices. 2010 토독소생성세균은검출못함 Comparison of multiplex PCR, enzyme immunoassay and J Microbiol 설사독소들을타겟으로한 PCR 6 cell culture methods for the detection of Methods. 법과면역법및세포배양법을 enterotoxinogenic Bacillus cereus. 2009 비교함 7 Prevalence and toxigenic profiles of Bacillus cereus isolated from dried red peppers, rice, and Sunsik in Korea. J Food Prot. 2009 한국의여러시료에서분리한바실러스에서독소유전자들의존재양상을분석함 Broad distribution of enterotoxin genes (hblcda, nheabc, Int J Food 설사독소들을타겟으로한 PCR 8 cytk, and entfm) among Bacillus thuringiensis and Bacillus Microbiol. 법으로여러식품에적용함. 구 cereus as shown by novel primers. 2008 토독소생성세균은검출못함 9 Simultaneous detection and identification of Bacillus cereus group bacteria using multiplex PCR. J Microbiol Biotechnol. 2007 바실러스세레우스그룹을동시에검출할수있는방법. 독소생성에집중하지않음 바실러스세레우스의독소생성 10 Establishment of a novel multiplex PCR assay and detection of toxigenic strains of the species in the Bacillus cereus group. J Food Prot. 2005 균주들에 multiplex PCR을적용한선구적연구임. 그러나구토및설서형독소생성세균을동 시검출못함 - 244 -
제 7 장연구시설 장비현황 * 도입 개발한연구시설 장비현황및국가과학기술종합정보시스템장비등록번호를기술 - 245 -
제 8 장연구실안전관리이행실적 - 246 -
<1 협동 > 위험등급점검주기분류기준 A 등급 분기 1 회 가연성가스, 인화성시약, 유해화학물질, 다량의폐액배출, 독극물, 생물및동물의취급, 방사성동위원소, 위험성이높은기계장비가 설치된실험실 B 등급반기 1 회일반시약, 소규모인화성시약, 불연성가스, 소량의폐수발생실험실 C 등급연 1 회이화학실험을수행하지않는전기, 설계, 컴퓨터관련실험실 - 247 -
- 248 -