Tissue Engineering and Regenerative Medicine, Vol. 7, No. 5, pp 575-582 (2010) Original Article 유치의치수와치주인대에서분리한줄기세포의특성 송제선 1 김승혜 1 김성오 1 최병재 1 김정희 2 곽성욱 3 정한성 3 * 1 연세대학교치과대학소아치과학교실및구강과학연구소 2 경희대학교치과대학구강생화학교실및구강생물연구소 3 연세대학교치과대학구강생물학교실내해부발생학연구실및구강악안면경조직재생연구소 Characterization of Stem Cells Obtained from the Dental Pulp and Periodontal Ligament of Deciduous Teeth Je Seon Song 1, Seung-hye Kim 1, Seong-Oh Kim 1, Byung-Jai Choi 1, Jeong-Hee Kim 2, Sungwook Kwak 3, and Han-Sung Jung 3 * 1 Department of Pediatric Dentistry, Oral Science Research Center, College of Dentistry, Yonsei University, Seoul, 120-752 Korea 2 Department of Oral Biochemistry, Institute of Oral Biology, College of Dentistry, Kyung Hee University, Seoul, 130-701 Korea 3 Division in Anatomy & Developmental Biology, Department of Oral Biology, Research Center for Orofacial Hard Tissue Regeneration, College of Dentistry, Yonsei University, Seoul, 120-752 Korea (Received: September 30 th, 2010; Accepted: October 25 th, 2010) Abstracts : Many studies have found adult stem cells in human teeth or correlated tissues. However, most of these stem cells were found in the permanent teeth or pulp from exfoliated deciduous teeth. The aim of the present study was to characterize stem cells isolated from the functional dental pulp and periodontal ligament of deciduous teeth. Dental pulp tissue was obtained from deciduous teeth by extirpation during treatment for dental caries, and periodontal tissue was obtained from deciduous teeth that were extracted for orthodontic reasons or space management. We observed cell outgrowth from these tissues in explants culture, and named these cells as deciduous dental pulp stem cells (DDPSCs) and deciduous periodontal ligament stem cells (DPDLSCs), respectively. These stem cells presented embryonic stem cell markers (Oct-4 and Nanog), an ectomesenchymal stem cell marker (Nestin), and mesenchymal stem cell markers (Stro-1 and CD146). In differentiation media, DDPSCs and DPDLSCs were able to change into cells that produce lipid vacuoles or cells that induce extracellular mineral aggregation, expressing genes correlated with adipogenesis (PPARγ2 and LPL) or osteogenesis (ALP and BSP), respectively. This is the first report of the presence of multipotent stem cells in the functional dental pulp and periodontal ligament tissue of deciduous teeth, which can be isolated using an explants culture method. These tissues can be obtained easily during routine dental procedures, and could therefore represent a good source of adult stem cells for use in regenerative medicine. Key words: deciduous teeth, dental pulp, periodontal ligament, stem cells, explants culture 1. 서론 최근다분화가능성체줄기세포의추출및재생의학에의응용에대한많은연구가이루어지고있는데치아및주변간엽조직에서도다분화가능줄기세포들이존재한다는것이보고되었다. 1,2 법랑질을제외한치아및그주 These authors equally contributed to this work *Tel: +82-2-2228-3064; Fax: +82-2-312-8012 e-mail: hsjung@yuhs.ac (Han-Sung Jung) 변조직들은발생학적으로외배엽성중간엽 (ectomesenchyme) 조직에서유래한세포들로부터발생되기때문에 3 여기에서나온성체줄기세포는골조직 4,5, 연골조직 6,7, 상아질조직 8,9, 백악질조직 10,11, 근육조직 12, 혈관조직 13, 지방조직 5,6 과같은중배엽성조직으로분화가가능한동시에신경조직 14 과같이외배엽성조직으로의다양한분화가가능한것으로보고되고있다. 치아및그주변조직에서얻을수있는성체줄기세포는치수조직 15 내에존재하는세포 (dental pulp stem cells, 575
송제선 김승혜 김성오 최병재 김정희 곽성욱 정한성 DDPSC), 미성숙영구치치근단부위 16,17 에서얻을수있는세포 (stem cells from apical pulp, SCAP), 맹출중인치낭 18 에서얻을수있는세포 (dental follicular precursor cells, DFPC), 그리고치주인대 10 세포 (periodontal ligament stem cells, PDLSC) 등이알려져왔다. 유치의경우에는흡수탈락되고있는유치의치수 19,20 혹은발치된선천치치수 21 에서얻을수있는세포 (stem cells from human exfoliated deciduous teeth, SHED) 가보고되었다. 특히자연적으로탈락하는유치의경우골수나지방조직과는달리비침습적인방법으로얻을수있다는장점뿐만아니라세포증식율이높기때문에줄기세포의원천으로서주목을받고있다. 19,22-24 탈락유치줄기세포 (SHED) 는유전자발현양상이나증식및분화양상에서영구치치수줄기세포와다른점이보고되고있는데 22 탈락유치치수줄기세포는영구치치수줄기세포와달리상아질 -치수복합체를잘형성하지못하며골형성을유도하는역할을할수있는것으로보고되었다. 1,19 한편현재까지유치의치주인대에서성체줄기세포치주인대에서의다분화가능줄기세포는보고된바가없었다. 하지만영구치의치주인대에서줄기세포 (PDLSC) 가보고되었기때문에유치의치주인대에서도유사하지만약간은다른특성을가진줄기세포가존재할것이라고추정할수있을것으로보인다. 이러한유치의치주인대조직은탈락유치에서는쉽게얻을수는없지만치과진료과정중공간관리및교정적목적으로발거된유치로부터쉽게얻을수있다. 한편영구치의치수에서줄기세포를얻는경우는주로발거된제3대구치 25 나혹은외상에의해노출된치수 7 에서얻었다. 유치치수의경우에는발거된유치에서얻었다. 19,20 그러나아직까지정상적으로기능하고있는유치의치수에서얻을수있는지는연구된바가없었다. 유치의경우치아우식증치료과정중기계적치수노출이있는경우에치수를제거하게되는데이때에도탈락유치의치수에서얻을수있는줄기세포와유사한세포를얻을수있을것으로추정된다. 소아연령에서얻은세포는특히세포활성도가높으며특히소아치과진료과정중자연스럽게얻을수있는유치의치수와치주인대조직으로부터줄기세포를얻어보관및사용할수있다면재생의학적관점에서보다유리하다고할수있을것으로보인다. 따라서본연구는유치의치료과정중얻을수있는치수및치주인대에서다분화가능성체줄기세포를분리하고그특성을분석해보고자한다. 2. 방법 2.1 유치로부터일차배양 (Primary Culture from Deciduous Teeth) 유치로부터줄기세포의일차배양은연세대학교치과대학기관윤리위원회로부터승인 (2-2010-0019) 과환아및보호자의동의를받고서이루어졌으며만 2-14세의건강한남녀 8명 ( 남자4 명, 여자 4명 ) 으로부터조직을얻었다. 유치치주인대조직은영구치이소맹출로인한교정적목적으로발거된유전치에서얻었으며 (n=4) 치수조직은충치치료중기계적노출에의해치수치료를진행해야하는유견치와제1유구치에서얻었다 (n=4). 조직으로부터의일차배양은 explants culture법을이용하였다. 치주인대조직의경우치은접합부위 (gingival attachment) 와치근단에서최소 2mm 떨어진부위에서 #15 blade를이용하여조직을조심스럽게분리하였으며치수조직은 barbed broach로치수조직전체를분리하였다. 얻어진조직은 1mm 3 의크기로잘게자른후 60 mm culture dishes (BD Falcon, Lincoln Park, NJ, USA) 위에올려놓고 counting chamber cover glass (Superior, Germany) 를덮어세포가자라나오도록하였다. 배양에사용된배지는 α-minimum essential medium (α-mem; Gibco BRL, Grand Island, NY, USA) 배지에 10% fetal bovine serum (FBS; Gibco BRL), 100 U/ml of penicillin and 100 µg/ml of streptomycin (Gibco BRL), 2 mm L-glutamine (Gibco BRL), 10 mm L-ascorbic acid (Sigma, St. Louis, MO, USA) 를첨가하여사용하였으며 37 o C, 5% CO 2 의습윤환경에서배양하였다. 유치의치수및치주조직으로부터자라나온세포는각각 deciduous dental pulp stem cells (DDPSCs), deciduous periodontal ligament stem cells (DPDLSCs) 로명명하고 10일후계대배양하였으며각각 4개의세포주를 2계대에서동일한수로섞어서실험을진행하였다. 각실험은최소 2번반복하여결과의유의성을확인하였다. 2.2 역전사중합효소연쇄반응 (Reverse Transcription Polymerase Chain Reaction, RT-PCR) 을통한줄기세포관련유전자발현확인배양된줄기세포에서배아줄기세포 (embryonic stem cells, ES cells) 의표지자인 Oct-4 및 Nanog 및외배엽성간엽줄기세포 (ectomesenchymal stem cells, EMSCs) 의표지자인 Nestin의 mrna의발현을 RT-PCR 을통해확인하였다. 세번계대배양한세포로부터 total RNA를추출하였는데, 세포로부터 total RNA의분리는 RNeasy mini kit (Qiagen, Valencia, CA, USA) 을사용하였다. 이후 Nanodrop ND-1000 (Thermo Scientific, Waltham, MA, USA) 분광광도계를사용하여 280 nm 및 260 nm에서의흡광도를측정한후정량하였다. 각각의 total RNA 1 µg을 oligo (dt) 15 primer를함유한 Maxime RT premix kit (Intron biotechnology, Seoul, Korea) 에넣고멸균된증류수를섞어총 20 µl가되도록한후 45 o C에서 1시간, 576
유치의줄기세포 (Stem Cells from Deciduous Teeth) 95 o C 에서 5 분간반응시켜 cdna 를합성하였다. 중합효소연쇄반응 (polymerase chain reaction, PCR) 은 Maxime PCR PreMix Kit (i-startaq) (Intron biotechnology) 를사용하여시행하였다. 합성된 cdna 1 µl, 10 pmol/ µl 의 forward 및 reverse primer 를각각 1µl 를넣고최종부피가 20 µl 이되도록멸균된증류수로희석하였다. 초기 denaturation 으로서 95 o C 에서 2 분간시행한다음 denaturation 을 94 o C 에서 20 초, annealing 은 60 o C 에서 10 초, extension 은 72 o C 에서 20 초간적절한 cycle 로진행하고 final extension 은 72 o C 에서 5 분간시행하였다 (Swift MaxPro Thermal Cyclers; ESCO, Singapore). 실험에사용된 primer 의종류와반응조건은 Table 1 에표기하였다. Housekeeping 유전자인 human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) 를 PCR 양성반응의확인을위하여같이시행하였다. PCR 반응완료후, 반응생성물들은 6 LoadingStar (DyneBio, Sungnam, Korea) 와섞어 2% agarose gel 에전기영동하였으며 UV light 하에 ChemiDoc XRS (BIO-RAD Lab, Richmond, CA, USA) 로영상을촬영하였다. 2.3 유세포분석 (Flow Cytometry Analysis) 을통한간엽성줄기세포표지자확인유치줄기세포에서간엽성줄기세포 (mesenchymal stem cells, MSCs) 관련표지자인 Stro-1 과 CD146 의발현양상을유세포분석법을이용하여확인하였다. 세번계대배양된세포들을인산염완충식염수 (phosphate buffered saline, PBS, ph=7.2) 로두차례세척한후 trypsin 이들어있지않은 cell dissociation buffer (Invitrogen, Carlsbad, CA, USA) 로세포를떼어내었다. 500 g 의원심력으로 5 분동안세포를침전시킨후다시 1 10 6 cells/ml 의농도로 flow cytometry staining buffer (ebioscence, San Diego, CA, USA) 에부유시켰다. 1 차항체로서 monoclonal anti-human Stro-1 (IgM; R&D system, Minneapolis, MN, USA) 를 5µg/10 6 cells 농도로넣었으며 4 o C 에서 1 시간동안반응시켰다. flow cytometry staining buffer 로두번세척후 2 차항체로서 R-phycoerythrin (R-PE) 이결합된 goat anti-mouse IgM (SouthernBiotech, Birmingham, AL, USA) 를 0.1 µg/1 10 6 cells 농도로 4 o C 에서 30 분동안반응시켰다. CD146 의경우에는 fluorescein isothiocyanate-(fitc) 가미리결합된 anti-human CD146 (ebioscence) 를 20 µl/10 6 cells 농도로넣고 4 o C 에서 1 시간동안반응시켰다. 대조군은 1 차항체를생략하고진행하였다. 염색된세포들은 FACSCalibur Flow Cytometer (BD Biosciences) 로형광량을측정하였으며 FCSExpress V3 software (De Novo Software, Thornhill, ON, Canada) 로발현양상을분석하였다. 2.4 면역조직염색 (Immunohistochemistry) 을통한조직내간엽성줄기세포확인 Stro-1 의조직내발현양상을면역조직염색을통해확인하였다. 교정적목적으로발거된유견치를 24 시간동안 10% natural-buffered formalin (Sigma) 에담가고정한후 2 주간 10% EDTA (ph=7.4) 로탈회시켰다. 이후파라핀에매몰하여 5µm 두께로자른후슬라이드를제작하였다. 항원성부 Table 1. RT-PCR and quantitative RT-PCR primers used in this study Genes Primer sequence (5'-3') Size (bp) Cycles Reference Oct-4 Nanog Nestin GAPDH PPAR γ2 LPL ALP BSP GAPDH * quantitative RT-PCR F: CGACCATCTGCCGCTTTGAG R: CCCCCTGTCCCCCATTCCTA F: TGCAAATGTCTTCTGCTGAGAT R: GTTCAGGATGTTGGAGAGTTC F: GCCCTGACCACTCCAGTTTA R: GGAGTCCTGGATTTCCTTCC F: AGGTGAAGGTCGGAGTCAACG R: GCTCCTGGAAGATGGTGATGG F: ACAGCAAACCCCTATTCCATGCTGT R: TCCCAAAGTTGGTGGGCCAGAA F: TGGACTGGCTGTCACGGGCT R: GCCAGCAGCATGGGCTCCAA F: GGACCATTCCCACGTCTTCAC R: CCTTGTAGCCAGGCCCATTG F: CTGGCACAGGGTATACAGGGTTAG R: ACTGGTGCCGTTTATGCCTTG F: TCCTGCACCACCAACTGCTT R: TGGCAGTGATGGCATGGAC 573 29 39 287 29 39 200 31 40 231 25 41 159 45 * This study 167 45 * This study 137 45 * 39 182 45 * 42 100 45 * 42 577
송제선 김승혜 김성오 최병재 김정희 곽성욱 정한성 활을 위해 sodium citrate buffer (10 mm, ph6.0)하에 10분 간 열처리한 후 내인성 peroxidase 활성을 억제하기 위해 상 온에서 3% H2O2를 10분간 처리하였다. 비특이적인 반응을 억제하기 위하여 5% bovine serum albumin (Sigma)을 30분 동안 처리한 후 1차 항체로서 anti-human Stro-1를 1:400으로 희석하여 실온에서 1시간 및 4oC에서 밤샘 처리하였다. 2차 항체로서 biotin이 표지 된 goat anti-mouse IgM (Vector laboratories, Burlingame, CA, USA)을 1:100으로 희석하여 30분간 실온에서 처리하였다. 이후 발색은 LSAB + Kits (Dako Co., Carpenteria, CA, USA)을 사용하였다. Streptoavidin-HRP을 10분간 실온에서 처리한 후 DAB (Diaminobenzidine)을 1분간 처리하여 발색시켰다. 대조염색 으로서 Gill s hematoxylin (Sigma)을 1분간 처리한 후 탈수 및 봉입과정을 거쳐 광학현미경으로 관찰하였다. 대조군의 경 우 1차 항체를 생략하고 진행하였다. 2.6 분화와 관련된 유전자의 정량적 역전사 중합효소 연 쇄반응(Quantitative Reverse Transcription Polymerase Chain Reaction, qrt-pcr) 지방세포로의 분화와 관련된 유전자인 peroxisome proliferator-activated receptor γ2 (PPARγ2)와 lipoprotein lipase (LPL) 및 경조직 형성 세포로의 분화와 관련된 유전 자인 alkaline phosphatase (ALP)와 bone sialoprotein (BSP) 의 mrna 발현양상을 정량적 역전사 중합효소 연쇄반응으로 분석하였다. Total RNA추출 및 cdna제조는 상기에 기술된 RT-PCR방법과 동일하게 진행하였다. 반응액은 멸균 증류수 7 µl, forward 및 reverse primer (10 pmol/µl) 각각 1 µl, 합성 된 cdna 1 µl 및 2x SYBR Premix Ex Taq (Takara Bio, Otsu, Japan) 10 µl를 넣어 총 20 µl를 만들었으며 Thermal Cycler Dice real time system (Takara Bio)으로 증폭 및 형광을 검출하였다. 증폭과정은 초기 denaturation으 로서 95oC에서 10초간 시행한 다음 denaturation을 94oC에서 5초, annealing은 60oC에서 15초, extension은 72oC에서 10초 간 45회 진행하고 이후 60oC에서 95oC까지 dissociation 과정 을 시행하였다. 사용한 primer의 조건은 Table 1와 같다. 최 종 PCR 산물은 전기영동을 시행하여 다른 특이한 band가 나 타나지 않는 것을 확인하였고 dissociation curve상에 특이한 peak가 없음을 확인하였다. 분화 전후의 각 mrna의 상대적 발현양의 비교는 GAPDH를 기준으로 하여 2- CT법26을 이용 하였다. 결과는 평균값과 표준편차로 나타내었으며 분화 전 후의 상대적인 발현량의 차이를 SPSS (version 17.0; Chicago, IL, USA) 프로그램을 이용하여 Wilcoxon signed rank test (p<0.05)로 통계 분석하였다. 2. 5 지방세포 및 경조직 형성 세포로의 분화유도 (Adipogenic and Osteogenic Differentiation) 유치로부터 얻은 줄기 세포의 지방세포로의 분화 능력 과 경조직 생성 세포로의 분화능력을 확인하기 위하여 36계대의 세포를 12 well 배양용기에 1 104 cells/cm2 농도 로 분양한 다음 세포가 거의 차게 될 때 분화 배지로 교 환하였다. 대조군은 일반 배양 배지를 같은 일정으로 처 리하였으며 3일에 한 번씩 배지를 교환하였다. 지방세포로의 분화는 분화 유도 배지[α-MEM 배지에 10% FBS, 1% antibiotics, 1 µm dexamethasone (Sigma), 10 µg/ ml human insulin (Sigma), 100 µm indomethacin (Sigma), 500 µm 3-isobutyl-l-methylxanthine (IBMX; Sigma)를 첨가] 를 10일 간 처리한 후 분화 유지 배지(α-MEM 배지에 10% FBS 및 1% antibiotics, 10 µg/ml human insulin을 첨가) 를 10일간 추가로 처리하였다. 분화를 확인하는 방법으로 서 Oil Red O 염색을 시행하였다. Oil Red O 염색은 세 포를 10% natural-buffered formalin 에 4oC에서 30분간 고정한 후 0.2% Oil Red O (Sigma) 용액을 상온에서 10 분간 적용시킨 다음 증류수로 세척한 후에 광학현미경으 로 관찰하였다. 경조직 형성 세포로의 분화는 분화 배지 [α-mem 배지 에 10% FBS 및 1% antibiotics, 0.1 µm dexamethasone, 2 mm β-glycerolphosphate (Sigma) 및 50 µm ascorbic acid 2-phosphate (Sigma)를 첨가]를 5주간 처리하였다. 분 화를 확인하는 방법으로서 석회화 결정을 Alizarin Red S 염색을 통해 확인하였다. Alizarin Red S 염색은 세포를 10% natural-buffered formalin로 고정한 후 2% Alizarin Red S (ph=4.2; Sigma) 용액을 5분간 적용시킨 다음 광 학현미경으로 관찰하였다. 3. 결 과 3.1 유치로부터 일차배양(Primary Culture from Deciduous Teeth) 배양 접시에 고정된 유치의 치수와 치주인대 조직에서 부터 3-4일이 지나면 세포가 자라나오기 시작하였으며, 자 Figure 1. Morphology of stem cells obtained from deciduous teeth: (A) deciduous dental pulp stem cells (DDPSCs) and (B) deciduous periodontal ligament stem cells (DPDLSCs). Original magnification: 40. 578
유치의 줄기세포(Stem Cells from Deciduous Teeth) Figure 3. Flow cytometry analysis of mesenchymal stem cell markers (Stro-1 and CD146) in DDPSCs and DPDLSCs. 3.2 RT-PCR 분리 배양된 유치 줄기세포에서 발현되고 있는 mrna 를 RT-PCR로 분석한 결과 ES cell 표지자인 Oct-4 및 Nanog가 모두 발현되었으며 또한 EMSCs 표지자인 Nestin 이 두 세포군에서 모두 발현되었다(Fig 2). 3.3 유세포 분석(Flow Cytometry Analysis) 유치 줄기세포에서 Stro-1과 CD146의 발현양상을 유세 포 분석법을 이용하여 확인하였다. 두 세포군에서 Stro-1 과 CD146 모두 발현이 되고 있었으며 Stro-1 보다는 CD146의 발현양이 더 많았다. 두 세포군 간에 전반적인 발현 형태는 비교적 유사하게 나타났다(Fig 3). Figure 2. Expression of genes associated with embryonic stem cells (Oct-4 and Nanog) and ectomesenchymal stem cells (Nestin) in DDPSCs and DPDLSCs. (A) RT-PCR gels (B) Relative expression. 3.4 면역조직염색(Immunohistochemistry) Stro-1의 조직 내 발현양상을 면역조직염색을 통해 확인 하였다. Stro-1 표지자는 백악모세포(cementoblast)층이나 상 아모세포(odontoblast)층과는 떨어져서 존재하였으며 혈관 주 위에서 관찰되거나 세포밀집대(cell-rich zone)에서 관찰되 라나온 세포는 광학현미경 상에서 방추형이거나 혹은 섬 유모세포와 유사한 형태를 보였는데(Fig 1), 치주인대에서 유래한 세포가 좀 더 방향성을 가지고 증식하는 양상이 관 찰되었다. Figure 4. Immunohistochemical staining of Stro-1 marker (arrows) in the deciduous teeth. (A) Negative control; (B) dental pulp; (C) periodontal ligament (scale bars: 100 um). D, dentin; C, cementum. 579
송제선 김승혜 김성오 최병재 김정희 곽성욱 정한성 Figure 5. Adipogenic differentiation of DDPSCs and DPDLSCs. (A) Oil red O staining after 20 days of culture in adipogenic differentiation medium (b,c,e, and f) or control medium (a and d). Original magnifications: a and d, 100; b and e, 50; c and f: 200. (B) Changes in the expressions of peroxisome proliferatoractivated receptor γ2 (PPARγ2) and lipoprotein lipase (LPL) after adipogenic differentiation. * p < 0.05, Wilcoxon signed rank test. Figure 6. Osteogenic differentiation of DDPSCs and DPDLSCs. (A) Alizarin red S staining after 5 weeks of culture in osteogenic differentiation medium (b and d) or control medium (a and c). Original magnification: 100. (B) Changes in the expressions of alkaline phosphatase (ALP) and bone sialoprotein (BSP) during osteogenic differentiation. * p < 0.05, Wilcoxon signed rank test. 었다(Fig 4). 3. 5 지방세포 및 경조직 형성 세포로의 분화유도 (Adipogenic and Osteogenic Differentiation) 유치 줄기세포의 지방세포 및 경조직 형성 세포로의 분 화를 세포화학적 염색법과 정량적 RT-PCR로 확인하였다. Oil red O 염색 결과 지방세포로의 분화가 관찰되었으나 그 수는 비교적 적었다. 정량적 RT-PCR 분석 결과 분화를 시 키지 않은 군에 비하여 분화를 시킨 군에서 PPARγ2와 LPL 의 발현이 증가한 것이 관찰되었다(Fig 5). 경조직 생성 세포로의 분화는 Alizarin red S 염색을 통 해 볼 때 지방세포로의 분화보다 더 잘 일어나는 것이 관 찰되었다. 정량적 RT-PCR 분석 상 분화를 시키지 않은 군 에 비하여 분화를 시킨 군에서 ALP 및 BSP의 발현이 점 차 증가하는 것이 관찰되었다(Fig 6). 4. 고 고 있다. 유치는 영구치와는 비슷하지만 조금은 다른 형 태학적 조직학적 특징을 가지고 있으며 여기에서 유래한 줄기세포 또한 세포성장률의 차이나 유전자의 발현의 차 이를 보이는 것이 밝혀졌다.19,22 유치와 영구치에서 얻은 줄기세포 간에 어떠한 차이점이 더 존재하는지는 더 많은 연구가 필요할 것으로 사료되나 무엇보다 유치에서 얻은 줄기세포는 세포증식률이 높고 비침습적으로 얻을 수 있 다는 점에서 향후 줄기세포의 채취 및 보관에 있어 줄기 세포의 주요한 공급원이 될 가능성이 높아 보인다. 본 연구에서 유치의 치수와 치주인대에 유래한 세포들 은 배아줄기세포의 표지자인 Oct-4와 Nanog의 발현뿐만 아 니라 외배엽성 중간엽 줄기세포 표지자인 Nestin의 발현도 관찰되었다. 또한 골수조직이나 지방조직 등 간엽조직 내 에서 혈관주위(perivascular niche)나 혹은 신경다발주위 세 찰 사람의 치아는 유치와 영구치라는 두 가지 종류를 가지 580
유치의줄기세포 (Stem Cells from Deciduous Teeth) 포에서주로발견되는초기간엽성줄기세포표지자로알려진 Stro-1 27,28 과역시주로혈관주위에분포하는세포에서관찰되며간엽성줄기세포표지자로알려진 CD146 27-29 의존재도확인되었다. 이는유치도영구치와같이치수와치주인대조직이외배엽성중간엽 (ectomesenchyme) 에서유래한세포들로부터발생되기때문에그특성을가지고있는것으로여겨진다. 3 본연구에서는유세포분석상유치의치수줄기세포 (DDPSCs) 와치주인대줄기세포 (DPDLSCs) 간에 Stro-1의발현에있어서약간의차이 (51.7% vs. 80.4%) 를관찰할수있었는데치주인대줄기세포 (DPDLSCs) 에서보다더관찰되었다. 이는영구치치주인대줄기세포 (PDLSC) 가치수기원줄기세포 (DPSC) 보다세포증식률이높고 30,31 간엽성줄기세포능의측정인자중하나로알려져있으며 Stro-1 및 CD146을발현하는세포에서증가 29 한다고알려진 colony forming unit (CFU) 이더많으며 31 골성분화시관련유전자 (Osteocalcin, Runx2 32 및 ALP 33 ) 의발현이보다높다는보고 31,33 와맥을같이하는것으로보인다. 그러나두세포군간에 Stro-1의발현에큰차이가없으며 32,33 CD146 은오히려 DPSC에서더많이나타난다는보고 33 도있었다. 따라서치수와치주인대유래줄기세포간에표지자의발현양상이나줄기세포능에있어서어떤차이가있는지유치의경우에는어떠한지좀더확인해볼필요가있을것으로보인다. 한편 Stro-1의발현되는세포의비율이다른치아관련줄기세포에서나타나는비율 (SHED: 9.6%, DPSC: 5-10%, SCAP: >18%, PDLSC: 3-27%) 1,19,34,35 보다비교적높게발현이되었다. 이는원래정상유치조직에서나온줄기세포에서높은발현을보인다고생각할수도있으나실험조건의다양성이나 explants culture법을사용한것에의한영향일수도있어좀더연구가필요할것으로여겨진다. 유치의치수줄기세포 (DDPSCs) 와치주인대줄기세포 (DPDLSCs) 는비록적은수이기는하지만지방세포로분화될수있었으며경조직을생성하는세포로의분화도일어났다. 지방세포로의분화가경조직을생성하는세포로의분화보다잘일어나지않게보이는것은그유래가원래상아질이나백악질혹은골과같은경조직을생성하는세포이기때문인것으로추정할수있을것이며본연구의면역조직화학검사결과 Stro-1을발현하는세포가분화된상아모세포나백악모세포로부터떨어져서분포하며필요시치아조직이나골조직을생성하는세포로분화될수있는세포라는점에서도유추해볼수있을것이다. 3 조직으로부터세포를일차배양하는방법에는효소처리법 (enzymic disaggregation), 물리적분쇄 (mechanical disaggregation), 그리고 explants culture법등이있는데 36 본연구에서는 explants culture법을사용하였다. explants culture 법은조직을잘게자른다음배양접시에고정시킨후세포가자라나오도록하는방법이다. 이방법의경우에는비록시간은많이걸리지만보다균일한세포군을얻을수있고조직이적은경우에유리하며비용을줄일수있는점이장점이될수있다. 특히치근이흡수되고있는유치의치주인대조직의경우그양이적을수밖에없기때문에이방법에의한줄기세포의분리가보다유리할것으로여겨진다. 대부분치아관련조직에서효소처리법에의해줄기세포를얻어왔으나 1,23,34,37 최근 explants culture 법으로분리한치수줄기세포가증식률이높고근육세포로의분화에보다유리하다는보고가있어 38 세포분리방법에따른줄기세포의특성이어떻게다른지에대해좀더많은연구가필요할것으로사료된다. 결론적으로본연구는정상유치의치수와치주인대로부터성체줄기세포를 explants 방법으로분리배양하여줄기세포관련표지자 (Oct-4, Nanog, Nestin, Stro-1, CD146) 의발현및지방조직과경조직으로의분화가능성을확인하였다. 또한치아줄기세포를보관하고응용하는데있어서유치의치료과정중자연스럽게얻을수있는유치조직을활용가능하다는점과특히유치의치주인대에서최초로분화가능한줄기세포를얻었다는점이의의라고할수있을것이다. 향후유치에서얻은줄기세포의조직공학에서의응용가능성및영구치유래줄기세포와의차이등에관한좀더많은연구가이루어져야할것으로사료된다. 감사의글 : 본연구는연세대학교치과대학 2009 년도교수연구비에의하여이루어졌음 (6-2009-0038). 참고문헌 1. GT Huang, S Gronthos, S Shi, Mesenchymal stem cells derived from dental tissues vs. those from other sources: their biology and role in regenerative medicine, J Dent Res, 88, 792 (2009). 2. C Morsczeck, G Schmalz, TE Reichert, et al., Somatic stem cells for regenerative dentistry, Clin Oral Investig, 12, 113 (2008). 3. A Nanci, AROh Ten Cate, Ten Cate's oral histology : development, structure, and function, 7th ed. / Antonio Nanci. ed, St. Louis, Mo. ; [London]: Mosby, (2008). 4. D Ma, Z Ma, X Zhang, et al., Effect of age and extrinsic microenvironment on the proliferation and osteogenic differentiation of rat dental pulp stem cells in vitro, J Endod, 35, 1546 (2009). 5. W Sonoyama, Y Liu, T Yamaza, et al., Characterization of the apical papilla and its residing stem cells from human immature permanent teeth: a pilot study, J Endod, 34, 166 (2008). 6. SH Lee, YS Sohn, YW Choi, et al., Culture of Mesenchymal Stromal Cells from Dental Pulp: Culture Medium Study for Effective Expansion and Characterization, Tissue Eng Regen 581
송제선 김승혜 김성오 최병재 김정희 곽성욱 정한성 Med, 7, 248 (2010). 7. AH Huang, YK Chen, AW Chan, et al., Isolation and characterization of human dental pulp stem/stromal cells from nonextracted crown-fractured teeth requiring root canal therapy, J Endod, 35, 673 (2009). 8. ML Couble, JC Farges, F Bleicher, et al., Odontoblast differentiation of human dental pulp cells in explant cultures, Calcif Tissue Int, 66, 129 (2000). 9. K Iohara, L Zheng, M Ito, et al., Side population cells isolated from porcine dental pulp tissue with self-renewal and multipotency for dentinogenesis, chondrogenesis, adipogenesis, and neurogenesis, Stem Cells, 24, 2493 (2006). 10. BM Seo, M Miura, S Gronthos, et al., Investigation of multipotent postnatal stem cells from human periodontal ligament, Lancet, 364, 149 (2004). 11. BM Seo, M Miura, W Sonoyama, et al., Recovery of stem cells from cryopreserved periodontal ligament, J Dent Res, 84, 907 (2005). 12. I Kerkis, CE Ambrosio, A Kerkis, et al., Early transplantation of human immature dental pulp stem cells from baby teeth to golden retriever muscular dystrophy (GRMD) dogs: Local or systemic?, J Transl Med, 6, 35 (2008). 13. K Iohara, L Zheng, H Wake, et al., A novel stem cell source for vasculogenesis in ischemia: subfraction of side population cells from dental pulp, Stem Cells, 26, 2408 (2008). 14. C Morsczeck, F Vollner, M Saugspier, et al., Comparison of human dental follicle cells (DFCs) and stem cells from human exfoliated deciduous teeth (SHED) after neural differentiation in vitro, Clin Oral Investig, (2009). 15. S Gronthos, M Mankani, J Brahim, et al., Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo, Proc Natl Acad Sci U S A, 97, 13625 (2000). 16. I Kerkis, A Kerkis, D Dozortsev, et al., Isolation and characterization of a population of immature dental pulp stem cells expressing OCT-4 and other embryonic stem cell markers, Cells Tissues Organs, 184, 105 (2006). 17. S Abe, S Yamaguchi, A Watanabe, et al., Hard tissue regeneration capacity of apical pulp derived cells (APDCs) from human tooth with immature apex, Biochem Biophys Res Commun, 371, 90 (2008). 18. S Yao, F Pan, V Prpic, et al., Differentiation of stem cells in the dental follicle, J Dent Res, 87, 767 (2008). 19. M Miura, S Gronthos, M Zhao, et al., SHED: stem cells from human exfoliated deciduous teeth, Proc Natl Acad Sci U S A, 100, 5807 (2003). 20. AH Huang, YK Chen, LM Lin, et al., Isolation and characterization of dental pulp stem cells from a supernumerary tooth, J Oral Pathol Med, 37, 571 (2008). 21. E Karaoz, BN Dogan, A Aksoy, et al., Isolation and in vitro characterisation of dental pulp stem cells from natal teeth, Histochem Cell Biol, (2009). 22. S Nakamura, Y Yamada, W Katagiri, et al., Stem cell proliferation pathways comparison between human exfoliated deciduous teeth and dental pulp stem cells by gene expression profile from promising dental pulp, J Endod, 35, 1536 (2009). 23. V Arora, P Arora, AK Munshi, Banking stem cells from human exfoliated deciduous teeth (SHED): saving for the future, J Clin Pediatr Dent, 33, 289 (2009). 24. N Koyama, Y Okubo, K Nakao, et al., Evaluation of pluripotency in human dental pulp cells, J Oral Maxillofac Surg, 67, 501 (2009). 25. S Shi, PG Robey, S Gronthos, Comparison of human dental pulp and bone marrow stromal stem cells by cdna microarray analysis, Bone, 29, 532 (2001). 26. KJ Livak, TD Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method, Methods, 25, 402 (2001). 27. S Shi, S Gronthos, Perivascular niche of postnatal mesenchymal stem cells in human bone marrow and dental pulp, J Bone Miner Res, 18, 696 (2003). 28. NH Lin, D Menicanin, K Mrozik, et al., Putative stem cells in regenerating human periodontium, J Periodontal Res, 43, 514 (2008). 29. AC Zannettino, S Paton, A Arthur, et al., Multipotential human adipose-derived stromal stem cells exhibit a perivascular phenotype in vitro and in vivo, J Cell Physiol, 214, 413 (2008). 30. SH Chen, T Inoue, M Shimono, An experimental study of osteogenesis in explants of rat dental pulp, periodontal ligament, bone marrow and muscle cells in vitro, Bull Tokyo Dent Coll, 30, 155 (1989). 31. YY Jo, HJ Lee, SY Kook, et al., Isolation and characterization of postnatal stem cells from human dental tissues, Tissue Eng, 13, 767 (2007). 32. B Lindroos, K Maenpaa, T Ylikomi, et al., Characterisation of human dental stem cells and buccal mucosa fibroblasts, Biochem Biophys Res Commun, 368, 329 (2008). 33. LP Wu, X Wei, JQ Ling, et al., The surface antigen expression of periodontal ligament cells and dental pulp cells in vitro, Hua Xi Kou Qiang Yi Xue Za Zhi, 27, 20 (2009). 34. IC Gay, S Chen, M MacDougall, Isolation and characterization of multipotent human periodontal ligament stem cells, Orthod Craniofac Res, 10, 149 (2007). 35. J Xu, W Wang, Y Kapila, et al., Multiple differentiation capacity of STRO-1+/CD146+ PDL mesenchymal progenitor cells, Stem Cells Dev, 18, 487 (2009). 36. RI Freshney, Culture of animal cells : a manual of basic technique, 5th ed. ed, Hoboken, N.J.: Wiley-Liss, Chichester : John Wiley [distributor], (2005). 37. CYC Huang, D Pelaez, JD Bendala, et al., Plasticity of stem cells derived from adult periodontal ligament, Regenerative Medicine, 4, 809 (2009). 38. L Spath, V Rotilio, M Alessandrini, et al., Explant-derived human dental pulp stem cells enhance differentiation and proliferation potentials, J Cell Mol Med, 14, 1635 (2010). 39. A Tomokiyo, H Maeda, S Fujii, et al., Development of a multipotent clonal human periodontal ligament cell line, Differentiation, 76, 337 (2008). 40. MJ Honda, F Nakashima, K Satomura, et al., Side population cells expressing ABCG2 in human adult dental pulp tissue, Int Endod J, 40, 949 (2007). 41. NM Lapsys, AD Kriketos, M Lim-Fraser, et al., Expression of genes involved in lipid metabolism correlate with peroxisome proliferator-activated receptor gamma expression in human skeletal muscle, J Clin Endocrinol Metab, 85, 4293 (2000). 42. S Fujii, H Maeda, N Wada, et al., Investigating a clonal human periodontal ligament progenitor/stem cell line in vitro and in vivo, J Cell Physiol, 215, 743 (2008). 582