J Koren Soc ood Sci Nutr 한국식품영양과학회지 43(5), 749~755(2014) http://dx.doi.org/10.3746/jkfn.2014.43.5.749 장류유래 Exopolyscchride 생성유산균의잠재적 Probiotic 특성 안유진 최혜선 농촌진흥청국립농업과학원농식품자원부 Potentil Probiotic Properties of Exopolyscchride Producing Lctic Acid Bcteri Isolted from ermented Soyben Product YuJin Ahn nd HyeSun Choi Dept. of Agrofood esources, NAAS, DA, Gyeonggi 441853, Kore ABSTACT Exopolyscchrides (EPSs) hve been widely used in the food industry s viscofying, stbilizing, nd emulsifying gents s well s in the phrmceuticl industry for their immunomodultory, ntitumor, nd ntiinflmmtory effects. A totl of 458 lctic cid bcteri (LAB) strins isolted from severl kinds of soyben pstes were screened for the production of homoeps (HoPS). LAB isoltes were primrily screened using thin lyer chromtogrphy (TLC) nd further screened polymerse chin rection (PC) trgeting genes involved in HoPS production. Six LAB isoltes producing high mounts of HoPS were identified by TLC. Among these isoltes, glucnsucrse gene ws mplified in two strins (, ), wheres the fructnsucrse gene ws detected in three strins (,, ). After isolting the strins, their morphologicl chrcteristics nd 16S rdna sequences were determined. Six species were identified s L. limentrius, L. plntrum, L. pentosus, L. brevis, L. limentrius, nd L. prbrevis. To evlute the potentil probiotic properties of these LAB, their survivl rtes ginst simulted intestinl environment were determined. After 2 hr of incubtion in rtificil gstric juice, survivl rtes of, JSB90,, nd were ll greter thn 50%. After 2 hr of incubtion in bile juice, vible cell count of ws similr with initil vil cell counts. Growth of the six LAB ws screened in rbinooligoscchride (AOS)contining MS broth. esults showed tht growth of the isoltes selectively incresed fter culture in AOScontining medi. Strin (6 hr), (6 hr), (20 hr), nd (29 hr) showed mximum growth rte. Especilly, showed the highest growth rte. These results suggest tht EPSproducing LAB isolted from Deonjng could be pplied s synbiotics. Key words: lctic cid bcteri, exopolyscchride, probiotics, prebiotics, synbiotics 서 Probiotics는 GAS(generlly recognized s sfe) 로안전한미생물이고내산성및내담즙성을가짐으로써위장관에서정착하여숙주에게건강적효능을주는것으로보고되고있으며, 유산균이대표적이다 (1). 유산균은자연계에널리분포하고탄수화물을혐기적으로이용하여젖산을생성하는미생물로서유제품, 육류, 채소등다양한발효식품가공에종균으로사용하고있으며, 식품의보존성향상뿐만아니라관능적특성및영양적가치향상에기여하고있다. 또한일부유산균속은다당류를생합성하여제품의조직과점성향상에도기여하고있다 (2). Exopolyscchrides (EPS) 는미생물세포벽의일부로서세포벽주위에협막을형성하거나세포벽외부에점질형태로서발효중에축적되 론 eceived 31 Mrch 2014; Accepted 25 April 2014 Corresponding uthor. Emil: choihs9587@kore.kr, Phone: 82312990572 는미생물다당류로 1차또는 2차대사산물이다 (3). 최근에 EPS가물성증진효과와함께항암 (4), cholesterol 저하, 항궤양 (5) 등면역학적효과가있다고보고되면서생리기능성소재로주목받고있다. 또한 EPS가 prebiotics로서의기능을갖고있다고보고되고있다 (6). Prebiotics는장내유해균총의증식을억제하고유용미생물의증식을촉진시켜장내환경을개선시키는데장관내미생물들의탄소원으로사용되는복합당류로서 oligoscchrides, lctulose, lctosucrose, pltinose, rffinose, stchyose 및 inulin 등이있다 (7). 식품원료로사용가능한 prebiotics는그종류가다양하지못한실정이며, 최근 rbinooligoscchride (AOS) 에대한연구가진행된바있다 (8). 최근 probiotics 와 prebiotics의합성어로 synbiotics가많이알려져있으며, 지금까지이들에대한연구는발효유제품및육제품, 사람의분변에서분리된장내유산균들을대상으로한것들이대부분이고 (9) 식물성유산균대한연구는미진한실정이다. 식물성유산균은채소, 과일, 곡물이나식물발효식품등식
750 안유진 최혜선 물소재에서유래된유산균을말하며, 곡물이나채식을주식으로하는동양인의위장에동물성유산균보다더적합한것으로보고되어있다 (10). 전통장류는예로부터전승된우리나라의대표적인대두발효식품으로곡류단백질에서부족하기쉬운필수아미노산, 지방산, 유기산, 미네랄및비타민류등의영양소를보충해줌으로써영양학적으로중요한기능을가진다 (11). 발효과정중미생물이생산하는 2차대사산물의혈전용해능, 항산화능, 항암활성, 면역증강, 혈압강하및항균효과등다양한생리활성이보고됨에따라기능성식품으로서전통장류에대한관심이증가하고있는추세이다 (12). 이와같이전통장류에서분리된유산균의활용에대한인식이재평가되고있다. 본연구에서는전통장류에서분리한식물성유산균중 EPS 생산유산균을선발하여항균활성, 인공위액및인공담즙저항성시험을통하여선발유산균의 probiotics로써특성분석과 synbiotics 관점의 prebiotics로써 rbinooligoscchrides(aos) 의이용가능성을제시하고자하였다. 재료및방법시료및사용균주본실험에서사용한장류는전국각지에서 12종을수집하였다. 균주 Listeri monocytogenes LMG 13305, Stphylococcus ureus DSM 346, Bcillus cereus ATCC 27348, Escherichi coli DSM 30083, Slmonell enteric IO 3313을사용하였다. 분석에사용한시약은 Sigm Aldrich Co.(St. Louis, MO, USA) 에서구입하여사용하였다. 균주배양및선발수집한장류시료 20 g을 80 ml의 0.85%(w/v) 멸균생리식염수에현탁한후, 영양배지로 MS gr(difco, Sprks, MD, USA), BL gr(difco), 저영양배지로 20% MS gr, 20% BL gr 배지에도말하여 37 C에서정치배양하였다. 영양배지는 48시간, 저영양배지는 96시간동안배양한후유산균성상을나타내는콜로니를 picking 하였다. 선택된콜로니는동일한배지에순수분리하여 3대계대배양한후단일콜로니를취하여 MS 액체배지에배양하여 75% glycerol 용액에현탁하고 80 C에보관하여실험에사용하였다. HomoEPS(homoexopolyscchride) TLC 스크리닝장류유래유산균주의세포외다당및올리고당생산을스크리닝하기위하여균주배양액을 thin lyer chromtogrphy(tlc) 분석으로확인하였다. HomoEPS 생성확인을위하여 MS 배지를 5 kd cutoff ultrfiltrtion(pll, Port Wshington, NY, USA) 하여배지내단백다당을제거한후, 2% sucrose와 mltose를첨가하였다. 분리균주는 37 C에서 24시간, 30 C에서 7시간배양후, 8,000 rpm에서 10분동안원심분리 (6200, Kubot, Tokyo, Jpn) 하여상등액을 TLC 스크리닝시료로사용하였다. 배양액 1 μl 4회점적하고전개용매 (ACN : wter=85:15) 로 4회전개하였으며, 발색용매 (0.5% nphtl, 5% H 2SO 4 in ethnol) 로발색시킨후, 105 C 오븐에 3분굽고 spot을확인하였다. 다당생성농도를정량적스크리닝하기위해배양액의 spot 농도는 multi guge(uji film, Tokyo, Jpn) 를이용하여측정하였다. 균을배양하지않은배지 spot(control) 의농도와균배양액의 spot의농도를비교하여 180% 이상차이를보인균주를 EPS 우수생성균주로선발하였다 (ig. 1). EPS 생합성유전자 PC 스크리닝선발균주의 EPS 생성관련유전자확인을위해 polymerse chin rection(pc) 을수행하였다. 전배양된균체를원심분리 (8,000 rpm, 10분 ) 한후, 멸균증류수로잔여배지성분을씻어내었다. Totl genomic DNA는 QIAmp ig. 1. Thin lyer chromtogrm of homopolyscchrides formtion in culture with LAB, sucrose nd mltose. Lne std1 nd std2 (stndrds), glucose, mltose, nystose, strch, fructose, sucrose, 1kestose, Dpnose (0.5%); Lne C, control; Lne 1~13, S20, HSA03, 19, 24, 25, 32, MSB03, 04, 07, 13, 16, 20, S24. The crbohydrte of compositions of the rection products were nlyzed by TLC, TLC silic gel 60 254 (Merck, Drmstdt, Germny) with two scents of 85:15 (v/v/v) cetonitrile/wter. The crbohydrte were visulized by dipping the pltes into 5% H 2SO 4 in ethnol contining 0.5% nphthl, followed by drying nd heting for 3 min t 105 C.
장류유래유산균의 Probiotic 특성 751 DNA mini kit(qigen, Hilden, Germny) 권장매뉴얼에따라추출하였다. 추출된 genomic DNA, EPS 생합성관련유전자 primer 및 Amfieco PC premix(gendepot, Brker, Houston, TX, USA) 로 Biod C0 therml cycler(biod, Hercules, CA, USA) 를이용하여 Tble 1의조건으로분석하였다. PC 산물을 1.5% grose gel 로전기영동하여유전자발현여부를확인하였다. EPS 생산균주의동정선발균주는 16S rdna 서열분석을통하여동정하였다. DNA 유전자염기서열분석은 ( 주 ) 제노텍 (Dejeon, Kore) 에의뢰하여분석하였으며, 사용된 primer는 518(5' CCAGCAGCCGCGGTAATACG3') 와 800(5'TACC AGGGTATCTAATCC3 ) 을사용하였다. 16S rdna 유전자의염기서열분석후, NCBI의 dtbse를통하여유사균주들과비교하였다. 또한염기서열을 Clustl X progrm을이용하여정렬한후, neighborjoining method(13) 에의거하여분리균주의계통분류학적위치를조사하였다. 항균활성분리균주의항균활성은 grwell diffusion ssy를사용하여분석하였다 (14). 대상세균으로는식중독감염의원인균으로보고된그람양성세균인 Listeri monocytogenes LMG 13305, Stphylococcus ureus DSM 346, Bcillus cereus ATCC 27348, 그람음성세균인 Escherichi coli DSM 30083, Slmonell enteric IO 3313을사용하였다. 유해균주배양액을 opticl density(660 nm) 를 0.5가되도록일정농도의균수로조절하여 0.7% NA soft gr(difco) 에 0.3% 의농도로접종하여혼합한뒤 NA 평판배지에 5 ml 분주하여굳힌후, 1 mm의구멍을내고전배양된분리균주를 5 μl씩접종하여배양하여저해환 (cler zone) 을확인하였다. 인공위액저항성분리균주의체내소화관조건과유사한환경에서측정하기위하여인공위액내성실험을실시하여확인하였다. 인공위액내성실험은 Kobyshi의방법 (15) 을변형하여 1 N HCl로 ph 2.5로조정한 MS 액체배지 (Difco) 에 0.22 μm membrne filtrtion(merck Millipore, Drmstdt, Germny) 한 1% pepsin(sigmaldrich Co.) 을첨가하여인공위액을제조하였다. MS 액체배지에균을접종하여 37 C 에서 24시간동안 200 rpm의조건에서배양 (VS8480S, Vision, Bucheon, Kore) 한후, 배양액 1 ml를 50 ml의인공위액을가하여배양 (37 C, 2 hr, 200 rpm) 하고생균수를계수하여생존율 (%) [( 실험구의 Log 지수값 / 대조구의 Log 지수값 ) ] 로나타내었다. 대조구는 pepsin을첨가하지않고 ph 조절하지않은 MS 액체배지를사용하였다. 인공담즙액저항성인공담즙에대한저항성은 Pik의방법 (16) 을변형하여멸균된 10% oxgll을 1% 첨가하여인공담즙을제조하였다. MS 액체배지에균을접종하여 37 C에서 24시간배양한후배양액을인공위액에넣고, 진탕배양 (37 C, 2 hr) 후생균수를측정하여생존율 (%) 로나타내었다. 대조군은 10% oxgll을첨가하지않은 MS 액체배지를사용하였다. Tble 1. Primer pirs used to screen for homopolyscchrides (HoPS) genes Primer Direction 1) Sequence 2) (5 3 ) Dsr1 Gtf T2 Lev GAY GCN GTN GAC YAA YGT NA YG TAH AWT TG TCN GGN ACM MA TC GAY AAY WSI AAY CCI YI GTI C AD TCI CC TA TAI AVI YKI G GAY TY TGG GAY WSN TGG C GCW GAN CCN GAC CAT TST TG GAY GTI TGG GAY WSI TGG C TCI TYY TC TCI SWI MC AT Trget gene Glucnsucrse Dextrnsucrse ructnsucrse Levnsucrse rgment size (bp) 1580 660 220 800 PC conditions 35 cycles of 94 C (30 sec), 55 C (45 sec), 72 C (80 sec) 35 cycles of 95 C (30 sec), 42 C (45 sec), 72 C (1 min) 30 cycles of 94 C (45 sec), 55 C (30 sec), 72 C (30 sec) 30 cycles of 94 C (45 sec), 50 C (30 sec), 72 C (30 sec) Positive control strin 3) Leu. mesenteroides KCTC 3719 Leu.mesenteroides subsp. dextrnicum LMG 7939 Leu. mesenteroides KCTC 3719 Lb. Snfrnciscensis 30 1) : forwrd, : reverse. 2) Y=C or T; =A or G; W=A or T; K=G or T; S=C or G; M=A or C; V=A, C or G; N=A, C, G or T; I=inosine. 3) The presence nd sequence nlysis of the corresponding genes were confirmed by DNA sequencing. eference This study 12 13 14
752 안유진 최혜선 AOS의 synbiotics 효과분리균주의 synbiotics 능력평가를위한 prebiotics로 rbinooligoscchride(aos) 이용평가를실시하였다. Glucose 무첨가 MS에 3% AOS를첨가한배지를제조하여균주배양액을접종한후배양 (37 C, 48 hr) 중일정시간간격으로흡광도 (Abs. t 660 nm) 를측정하였다. 또한 TLC 분석을통해배양액의 AOS 소비패턴을확인하였다. 통계처리모든실험은 3회수행하였으며, SPSS 12.0(Sttisticl Pckge for the Socil Science, IBM, Armonk, NY, USA) 을이용하여일원배치분산분석 (ANOVA) 을실시하였으며, 사후검정은 Duncn's multiple rnge test에의하여실행하였다. 통계적유의성은 P<0.05를기준으로하였다. 결과및고찰 HoPS 생성하는분리균주선발유산균이생성하는 EPS는 homopolyscchrides 와 heteropolyscchrides로구분된다. 그중 homopolyscchrides(hops) 는 glucose 또는 fructose 등의단당류로구성되어있으며, glucns type으로 dextrn(α(13) glucn), reutern(α(14)glucn) 이있으며, fructns type의 levn(β(21)fructn) 과 inulin(β(26)fructn) 이있다 (2). 장류로부터유산균성상을보이는 458개의균주중, TLC 분석으로 HoPS를생성하는 6개의분리균주의다당생성유전자 (Dsr1, Gtf, T2, Lev) 를확인한결과는 Tble 2와같다. 과 에서 Dsr1과 T2 유전자가존재하는것을확인하였다. 생성된다당은세포외로분비되거나세포벽 (cell wll) 에부착된상태로 host 장내상피세포의 dhesion 및 invsion에관여하는중요한역할을할것으로판단된다. Tble 3. Identifiction of exopolyscchride (EPS) producing isoltes in fermented soyben pste nd its ingredients by prtil 16S rna sequencing Strin Accession No. 1) Identifiction Identity (%) AB919110 AB919111 AB919112 AB919113 AB919114 AB919115 Lctobcillus limentrius Lctobcillus plntrum Lctobcillus pentosus Lctobcillus brevis Lctobcillus limentrius Lctobcillus prbrevis 98 99 99 1) Isoltes ssigned ccession number by DNA Dt Bnk of Jpn. plntrum, Lb. pentosus, Lb. brevis, Lb. limentrius, Lb. Prbrevis와 98~% 의상동성을보였다 (Tble 3). 16S rdna 유전자의구조에근거하여기존젖산균과의분자계통학적유연관계를파악하기위하여 phylogenetic tree 를작성한결과, 각분리균주들은위에서언급한유산균을포함하는계통학적그룹에포함됨을알수있었다 (ig. 2). 항균활성분리균주의항균활성을측정하기위하여분변오염의지표가되는 E. coli, 식중독원인균인 Listeri, Stphylococcus, Slmonell, B. cereus에서항균활성을측정한결과, 가 4개의병원성균에대해가장우수한항균력을나타내었고, 가 3개의병원성균에대한항균력을나타내었다. 그리고, 과 은각각 1개의병원성균에대한항균력을나타내었다 (Tble 4). 유산균은 lctic cid를생성하여산도를낮춤으로써병원성세균의생육을억제하는것으로알려져있으며, bcteriocin 등의항균성펩티드를생성하여항균작용을나타낸다 (17). 따라서항균활성이우수한분리균주 와 는장에머물면서유해균주증식을억제하여장내균총을개선시키는효과를기대할수있을것으로판단된다. EPS 생산균주의동정 TLC와 PC 분석을통해선발된 HoPS 생산 6균주의 16S rdna 염기서열을분석한결과,,,,,, 는 Lb. limentrius, Lb. Tble 2. Screening of genes involved in HoPS (Dsr1, Gtf, T2, Lev) production 1) Strin Dsr1 Gtf T2 Lev 1), presence of the corresponding gene;, no detection of the corresponding gene. In vitro 내산성및내담즙산성식품과함께섭취된유산균이효과를나타내기위해서는소화액수준의산성환경에서생존할수있는내산성이요구되며, 장내담즙농도 (0.3%) 보다고농도의 oxgll이함유된배지에서생육할수있어야한다 (16). HoPS를생성하는분리균주의인공위액과인공담즙에대한내성을조사한결과,, 와 은 70% 이상의높은인공위액에대한내성을나타내었고, 는 63.31%, 과 JSB 89는각각 36.49%, 44.26% 의인공위액내성을나타내었다 (ig. 3). 이러한균주는주재료인콩과함께채소류를부재료로하여발효시킨별미장에서유래하였으며, 채소발효에의해김치와유사한젖산발효가일어난 ph가낮은조건에서생육하였기때문에내산성을가지는것으로사료된다. 답즙산에대한내성또한 probitocis 균주선발에있어중요한
장류유래유산균의 Probiotic 특성 753 ig. 2. Neighbour joining phylogenetic tree of the composition of the LAB from fermented soyben pste. The scle br indictes 1 nucleotide substitution per nucleotides. Numbers in prentheses indicte ccession numbers of 16S rna genes from type strins. Bootstrp vlues over 50% (bsed on 1,000 replictions) re shown t the noodes. Tble 4. Antibcteril ctivity of exopolyscchride (EPS) producing isoltes in fermented soyben pste Inhibition 1) Strin Listeri monocytogenes LMG 13305 Escherichi coli DSM 30083 Stphylococcus ureus DSM 346 Slmonell enteric IO 3313 1), presence of n inhibition zone surrounding the Lctobcillus colony;, no inhibition. Bcillus cereus ATCC 27348 특성이다. (66.36%) 를제외한분리균주모두 80% 이상의높은내담즙성을가지고있었다. Probiotics로알려져있는 Lctobcillus rhmnosus GG(LGG) 와비교했을 Survivl rte (%). 120 80 60 40 20 0 b LGG Strins ig. 3. Survivl of the LAB tested fter incubtion in simulted gstric ( ) nd bile juices ( ). Error brs represent stndrd devitions (n=3). Mens with different letters (,b) bove the sme br re significntly different (P<0.05). b b 때인공위액과담즙액에서내성이떨어지지않는것을관찰하였다. 한편산양유로부터분리된 Streptococcus slivrius와 Lctobcillus lctis는 ph 3.0에서대부분사멸하였으며 0.3% bile에서 22~29% 의담즙내성을나타내었다고보고된바있고 (18), 동치미에서분리된 Lctobcillus sp. 3은인공위액에서내성이높은반면담즙에서생존율은 6% 로나타났다 (19). 또한 Kim 등의연구에서위액과담즙에서의높은저항성은분리균주의 EPS 생성으로인한균체보호막작용에의한결과라고보고하였다 (20). 따라서 EPS를생성하는분리균주들을우수한위액내성과담즙내성을나타내어장내환경에서도생존가능한 probiotics로활용될수있을것으로판단된다. AOS 이용 synbiotic 효과 Prebiotics는장내유익한박테리아의생장을돕는성분으로 probiotics의영양원이되어장내환경을개선하는데도움을주며, 올리고당과같은난소화성탄수화물로이루어
754 안유진 최혜선 Abs. t 660 nm. 1.0 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0.0 0 10 20 30 40 50 Time (hr) ig. 4. The growth curve of LAB in MS contining 3% prebiotics (AOS) s shown by the opticl density (turbidity) mesured t 660 nm. 져있는경우가많고대부분이식이섬유의형태로존재한다. 현재식물의세포벽및식물세포벽다당류분해효소로부터다당류에대한기술의진보는새로운 prebiotics의개발에영향을미쳤으며, 식품원료로사용가능한 prebiotics 종류가매우제한적 (isomltooligoscchride 및 fructooligoscchride 등 ) 이고다양한종류가필요한실정이다. 최근새로운 prebiotics로써 sugr beet rnibn에효소적기법을이용하여제조된 rbinooligoscchride(aos) 에대한연구가진행되고있다 (8). Probiotic 특성을지닌분리균주의 prebiotics로써 AOS 를이용한시간에따른성장율을관찰한결과, AOS를탄소원으로균체증식에소모되는것과균주별소비패턴이다르다는것을확인하였다. 특히 가 AOS를이용한성장율이가장우수하였으며, 와 도높은성장율을보였다 (ig. 4). 6균주모두 AOS를첨가하지않은 MS 액체배지에서보다 AOS를첨가한 MS 액체배지에서선택적으로높은성장율을나타내었다 (dt not shown). 따라서 probiotic 특성을나타내는분리균주가 prebiotics로써 AOS를선택적으로이용함으로써 AOS의새로운 prebiotics로써의가능성을확인하였다. 요 전통장류에서유산균성상을보이는균주를분리하여, TLC 와 PC을통하여 HoPS를우수하게생성하는균주,,,, 및 를선발하였다. 선발된 6균주의 16S rdna 의염기서열을분석한결과 는 L. limentrius, 는 L. plntrum, 은 L. pentosus, 는 L. brevis, 는 L. limentrius, 는 L. prbrevis로동정되었다. 항균활성은 6균주중에서 가 4개의병원성균에대한항균을나타내어항균활성이가장우수하게나타났고, 인공위액저항성은, 와 균주가 70% 이상의높은인공위액저항성으로가장우수했으며, 인공담즙저항성은 를제외한 5균주에서 80% 이상의생존율을나타내며담즙 약 액저항성이우수하게나타났다. 또한 probiotic 특성을지닌분리균주의 prebiotics로써 AOS를이용한성장율을관찰한결과, 모든분리균주가 AOS를선택적으로이용하며성장하는것을관찰하였고특히 가 AOS 이용성장율이가장우수한것으로확인되었다. 본연구를통해장류유래 probiotics를선발하였고 AOS의새로운 prebiotics로활용을검토한바, synbiotics로이용할수있는가치가있다고판단되었다. 감사의글 본연구는농촌진흥청연구개발사업 (PJ008626 및 PJ907 153) 지원을받아수행되었으며, 이에감사드립니다. EEENCES 1. Otero MC, Ocñ VS, Elen NderMcís M. 2004. Bcteril surfce chrcteristics pplied to selection of probiotic micrognisms. Methods Mol Biol 268: 435440. 2. usmdiedo P, Hugenholts J, Zoon P. 2002. An overview of the functionlity of exopolyscchrides produced by lctic cid bcteri. Int Diry J 12: 163171. 3. Kim DJ, Lee SY. 2001. Isoltion of the exopolyscchride producing Enterobcter sp. nd physicochemicl properties of the polyscchride produced by this strin. Koren J Biotechnol Bioeng 16: 370375. 4. Kimmel SA, oberts, Ziegler G. 1998. Optimiztion of exopolyscchride production by Lctobcillus delbrueckii subsp. bulgricus grown in semidefined medium. Appl Environ Microbiol 64: 659664. 5. Cerning J, Bouilnne C, Desmzeud MJ, Lndon M. 1998. Exocellulr polyscchride production by Streptococcus thermophilus. Biotechnol Lett 10: 255260. 6. Welmn AD, Mddox IS. 2003. Exopolyscchrides from lctic cid bcteri: perspectives nd chllenges. Trends Biotechnol 21: 269274. 7. Modler H, Mckellr, Yguchi M. 1990. Bifidobcteri nd bifidogenic fctors. Cn Inst ood Sci Tech J 23: 2941. 8. Westphl Y, Kühnel S, de Wrd P, Hinz SW, Schols HA, Vorgen AG, Gruppen H. 2010. Brnched rbinooligoscchrides isolted from sugr beet rbinn. Crbohydr es 345: 11801189. 9. Srel M, Mogensen G, onden, Mtto J, Mttil Sndholm T. 2000. Probiotic bcteri: sfety, functionl nd technologicl properties. J Biotechnol 84: 197251. 10. Cho YH, Prk SN, Jeong SW. 2009. A study on the physiologicl ctivity nd industril prospects of plntorigin lctic cid bcteri. Koren J Diry Sci Technol 27: 5357. 11. Gibbs B, Zougmn A, Msse, Mullign C. 2004. Production nd chrcteriztion of bioctive peptides from soy hydrolyste nd soyfermented food. ood es Int 37: 123 131. 12. Ahn YS, Kim YS, Shin DH. 2006. Isoltion, identifiction nd fermenttion chrcteristics of Bcillus sp. with high protese ctivity from trditionl Cheonggukjng. Koren J ood Sci Technol 38: 8287. 13. Sitou N, Nei M. 1987. The neighborjoining methods: new method for reconstructing phylogenetic trees. Mol Biol Evol 4: 406425.
장류유래유산균의 Probiotic 특성 755 14. Hechrd Y, Dherbomez M, Centiempo Y, Lettllier. 1990. Antgonism of lctic cid bcteri from gots' milk ginst pthogenic strins ssessed by the sndwich method. Lett Appl Microbiol 11: 185188. 15. Kobyshi Y, Tohym K, Tershim T. 1974. Biologicl chrcteristics of Lctobcillus. II. Tolernce of multiple ntibiotic resistnt strin, Lctobcillus csei PS 3002, to rtificil digestive fluids. Nihon Sikingku Zsshi 29: 691697. 16. Pik HD, Jung MY, Jung HY, Kim WS, Kim KT. 2002. Chrcteriztion of Bcillus polyfermenticus SCD for orl bcteriotherpy of gstrointestinl disorders. Koren J ood Sci Technol 34: 7378. 17. Messens W, De VL. 2002. Inhibitory substnces produced by Lctobcilli isolted from sourdoughs review. Int J ood Microbiol 72: 3143. 18. Lim YS, Kim SY, Lee SK. 2008. Chrcteristics of lctic cid bcteri isolted from kefir mde of got milk. Koren J ood Sci Ani esour 28: 8290. 19. Chung WB, Seo WS, Ch JY, Cho YS. 2003. Isoltion nd chrcteriztion of Lctobcillus sp. 3 for probiotics production from Koren dongchimi. Koren J ood Preserv 10: 406410. 20. Kim HJ, Chng HC. 2006. Isoltion nd chrcteriztion of exopolyscchride producing lctic cid bcteri from Kimchi. Kor J Microbiol Biotechnol 34: 196203.