전남의대학술지제 44 권제 호 Chonnam Medical Journal Vol. 44, No., pp. 23 30 한국인에서 hmlh 유전자의다형성과급성골수성백혈병발병위험의상관성 전남대학교의과대학 병리학교실, 2 내과학교실, 3 조혈계질환유전체센터, 화순전남대학교병원 박성철,3 ㆍ김설매,3 ㆍ김형준 2,3 ㆍ정상우 ㆍ최찬,3 * Association Study of hmlh Polymorphisms with Risk of Acute Myeloid Leukemia in Korean Cheng Zhe Piao,3, Jin Xue Mei,3, Hyeoung-Joon Kim 2,3, Sang Woo Juhng and Chan Choi,3 * Departments of Pathology, 2 Internal Medicine, Chonnam National University Medical School, 3 Genome Research Center for Hematopoietic Diseases, Chonnam National University Hwasun Hospital, Hwasun, Korea Acute myelogenous leukemia (AML) is caused by dysregulation of oncogenes, tumor suppressor genes, and DNA mismatch repair genes. Accumulating evidence has shown that genetic differences in mismatch repair capacity resulting from genetic polymorphism influence the risk of environmental carcinogenesis. In AML and lymphoma, the promoter of hmlh is frequently hypermethylated. The purpose of this study is to investigate the association of hmlh gene polymorphisms with the susceptability to AML in Korean people. Allelic frequency of rs9349, rs800734, rs3774343, rs464725, rs377434, rs3774335, rs748766, D376D, V384D SNPs of hmlh was determined in 32 normal subjects by sequencing analysis. Haplotype frequency and linkage disequilibrium coefficiency of nine SNPs were estimated. The author selected and genotyped six SNPS for full-scale association study, they include one tagging SNP from neighboring six SNPs and five SNPs including two novel SNPs. One hundred and sixty eight AML cases and 255 unrelated healthy controls were used for the study. V384D was associated with increased risk of AML both in genotypes (OR=2.335; 95% CI:.056 5.65, p=0.032) and in allele frequency (OR=2.47; 95% CI:.8 5.228, p=0.02). Other SNPs except V384D were not associated with AML. The allele frequency of the SNPs between Asians, European descendants, and Africans was very significantly different (p<0.0), respectively. Among Asians, that of Koreans and Japanese was similar (p>0.05), while that between Korean and Chinese, and that between Japanese and Chinese were significantly different (p< 0.05). The data suggests that V384D polymorphism of hmlh might be associated with AML. Keywords: Polymorphisms Genetic; SNP protein; Leukemias 게재결정 : 2008 년 3 월 9 일 * 교신저자 : 최찬, 59-809, 화순전남대학교병원병리과, Phone: 06-379- 707, FAX: 06-379- 7099, E-mail: cchoi@chonnam.ac.kr 23
24 전남의대학술지제 44 권제 호 2008 서론 200년에인간유전체전체염기서열이밝혀졌고그중에 99% 이상이동일하다는것이확인되었다. 인간유전체염기서열에서관찰되는 % 미만의유전자의변이를단일염기다형성 (Single Nucleotide Polymorphism, SNP) 이라고부른다. 2 2005년 0 월 4일까지사람에서발견되어보고된 SNP의수는 0,430,753개 (http://www.ncbi.nlm.nih.gov/ projects/snp/snp_summary.cgi) 이며, 이수는시간이지남에따라기하급수적으로늘어날것이다. 이와같이인류집단에서 % 미만의차이에의해개인간에모습이나, 행동, 그리고질환감수성에차이가생긴다. 3 5 급성골수성백혈병 (Acute Myelogenous Leukemia, AML) 은염색체전좌가빈번하게나타나는악성혈액종양이다. 6 급성골수성백혈병의발병원인은아직확실하게알려지지는않았으나여러종류의암유전자, 종양억제유전자, 그리고과오수정 (DNA mismatch repair) 유전자등다양한유전자와관련되어있다. 생명체의유전체는외부환경에의노출을통하여끊임없이 DNA손상을받게되며생체내 DNA 복제과정중에서도오류가발생할수있다. 7,8 이러한상해나오류로유도된 DNA상의이상구조는 DNA 회복기전에의해정상적인 DNA 구조로되돌려질수있다. 7,9 DNA 회복은다양한요인의노출, 특히발암원과같은물질의노출에서오는손상으로부터세포의유전적고유성을유지하는중요한역할을한다. 0 정상적으로 DNA polymerase가새로합성되는 DNA 에잘못된염기를삽입할때일어나는 nucleotide의 mismatch는과오수정유전자효소에의해수정된다. 과오수정은세포증식시세포가유전체를정확하게복제하기위해필요한데이러한체계에결함이있으면정상세포보다돌연변이확률이 00배정도높다. 2 따라서 DNA 과오수정유전자의소실은유전자의불안정성을초래하며특히 microsatellite sequence에서돌연변이가쉽게일어나게되고암발생을유발하게된다. 3 사람에게서현재까지알려진과오수정유전자는 hmsh2, hmsh3, hmsh6와 hmlh, hmlh3, hpms, hpms2이다. 이중 hmlh 유전자는 3p2에위치하고 2개의 exon을가지고있다. 또한 hmlh 유전자는비용종증대장암 (Hereditary Non-Polyposis Colorectal Cancer). 4 크론병과궤양성대장염, 5,6 림프종, 급성골수성백혈병 7,8 등다양한질환과관련이있다. 그리고 hmlh의 V384D SNP과대장암의발생에관하여는관련 이있다 9 2 와없다 22,23 는상반된주장이있다. 급성골수성백혈병의일부는 hmlh 유전자프로모터의메틸화 (methylation) 에관련되어있으나, 7,8 급성골수성백혈병과 hmlh 유전자의 SNP의연관성연구는보고된바없다. 본연구의목적은과오수정유전자인 hmlh 유전자의 SNP 과급성골수성백혈병간의상관관계를구명하는데있다. Table. Characteristics of the study population Variables AML Number Sex Age Range Male Female 4 30 3 45 46 60 >60 Type (FAB) 0 2 3 4 5 6 7 Others 재료및방법. DNA 를얻기위한혈액채취및 genomic DNA 추출 7세에서 82세사이의병리학적인증상이없는건강한한국인 32명과화순전남대학교병원에내원하여급성골수성백혈병 (AML) 으로진단받은 4세부터 84세사이의환자 29명을대상으로매개인의서면동의를거친후말초혈액을채취하였다. 건강한한국인의평균연령은 50.6세였고급성골수성백혈병환자의평균연령은 50.0세였다 (Table ). 전혈 0 ml에서 genomic DNA을추출하는데 QIAamp TM DNA blood Maxi Kit (Qiagen, Valencia, CA) 를이용하였다. 50 ml centrifuge tube에 500μl Qiagen protease를 29 53 (52.6%) 38 (47.4%) 50.0±7.6 4.0±84.0 58 (9.9%) 66 (22.7%) 80 (27.5%) 87 (29.9%) 7 20 9 46 43 25 7 2 2 Normal controls 32 59 (49.5%) 62 (50.5%) 50.6±7.4 7.0±82.4 59 (8.4%) 70 (2.8%) 9 (28.0%) 02 (3.8%) p-value 0.45 0.93 FAB classification: M0 (undifferntiated AML), M (myeloblastic, without maturation), M2 (myeloblastic, with maturation), M3 (promyelocytic), M4 (myelomonocytic), M5 (monoblastic leukemia or monocytic leukemia), M6 (erythrocytic), M7 (megakaryoblastic). Others: 2nd leukemia (0), biphenotype etc (2).
박성철외 4 인 : hmlh 유전자의다형성과급성골수성백혈병발병위험의상관성 25 넣고 0 ml 전혈을넣어서섞는다. AL buffer를 2 ml 넣어섞고, 70 o C에서 0분간 incubation시킨후, 00% ethanol을 0 ml 넣고 0분동안섞는다. 이혼합물의절반을새로운 50 ml centrifuge tube에끼워넣은 QIAamp Maxi column에넣고뚜껑을덮은뒤 3,000 rpm에서 3분간원심분리시킨다. 침전된것을버린뒤남은혼합물질을다시 QIAamp Maxi column에넣고 3,000 rpm에서 3분간다시원심분리시키고침전액을버린다. QIAamp Maxi column에 AW buffer를 5 ml 넣고 5,000 rpm에서 분간원심분리시킨다. AW2 buffer 5 ml을 QIAamp Maxi column에넣고 5,000 rpm에서 5분간원심분리시킨다. QIAamp Maxi column을새로운 50 ml centrifuge tube 로옮겨서 AE buffer ml을떨어뜨리고실온에서 5분간두었다가 5,000 rpm에서 2분간원심분리한뒤분광광도계를이용하여정량하였다. 2. PCR을위한 primer 제작 dbsnp (http://www.ncbi.nlm.nih.gov/snp) 의 detabase 에기초하여 Pyrosequencing Primer는 Pyrosequencing Assay Design Software (ADSW; Pyrosequencing AB, Uppsala, Sweden) 를사용하여 reverse 쪽에 biotin을부착시켜 Primer를 design하였고 ABI Prism R 300 Genetic Analyzer (PE Biosystems, Foster City, CA) 에사용하는 Primer는 SNPs site가 PCR 산물의중심부분에위치하도록 Primer 3 program (http://www.justbio.com/primer/ index.php) 을이용하여 primer를설계하였다 (Table 2). 3. hmlh 유전자의 PCR 증폭및유전형분석 ) PCR 증폭 PCR은 PTC-000 TM programmable thermal controller-pelter effect cycling (MJ Research, Waltham, MA) 을사용하였다. Genomic DNA μl (20 ng/μl), sense pimer와 antisense primer 각각 0.5μM, 2 PCR buffer [50 mm Tris-HCl (PH 9.0), 30 mm (NH4) 2 SO4, 5 mm MgCl 2, 2μg BSA], 2 mm dntp μl, F-Taq DNA polymerase (SolGent, Deajeon, Korea) 0.5 unit 을더하고최종반응액은 20μl 으로하였다. PCR 증폭조건은 95 o C에서 2분간변성을한뒤, 95 o C에서 20초, 54 62 o C에서 40초, 72 o C에서 2분을 주기로 45주기로실행하였다. 증폭된 PCR 생성물 3μl 를 % agarose gel에서 50 V 로 30분간전기영동한후전개된산물은 UV transilluminator로확인하였다. 2) Pyrosequencing SNP rs800734는 Pyrosequencing으로 genotyping 분석을진행하였다. Pyrosequencing 기술은 Klenow DNA polymerase, ATP sulfurylase, Luciferase, Apyrase 등 4가지효소의촉매작용을이용하여 template에따라 DNA 중합반응이일어나는과정에서각유전형에따라새로이어떤염기가이용되는가하는것을검출해내는방법이다. Biotin 이부착된 PCR산물 25μl 에 3차멸균증류수 5μl 넣은다음 beads (Amersham Biosciences AB, Uppsala City, Sweden) 3μl 와 binding buffer 37μl 넣어준다음 5 분동안 shaking 시킨다. probe를위의혼합물과 70% ethly alcohol, 0.2N NaOH, PSQ washing buffer에차례로 5초씩담궜다가 5초씩들어서잘건조시킨다. 마지막으로 0 pmole/μl sequencing primer.6μl 와 annealing buffer 38.4μl 이들어있는 Pyrosequencing reaction plates에놓고잘흔들어주면서 beads를 released 시킨다음 95 o C에서 분동안 primer를 annealing 시키고실온에서식힌다음 PSQ 96MA system (Biotage AB, Uppsala City, Sweden) 을이용하여 SNP genotyping 을진행하였다. Table 2. Primers of hmlh and PCR conditions used in this study SNP ID rs800734 rs377434 rs4986984 Primer sequences (5 3 ) F, ggctggatggcgtaagctac R, ctagatgctcaacggaagtgc S, gatggcgtaagctaca F, ctcctgacctcaggtgatcc R, catgaccatttttccccttt F, gggatttttaatagtttgctggtg R, ttgattacgtgaaataagaactcca F, tcgggcagaattgcttctat R, tctgtcttatcctctgtgacaatg S, gactttgctaccaggacttgc Annealing temp. ( o C) Cycle number Product size (bp) D376D/ V384D/ CNUH- GRCHD03-209 F indicates the forward primer and R indicates the reverse primer. S indicates the sequencing primer. rs800734 was genotyped by pyrosequencing, and other SNPs were genotyped by ABI 300 genetic analyzer. 59 54 62 54 45 45 45 45 89 353 365 38
26 전남의대학술지제 44 권제 호 2008 3) DNA 염기서열분석 PCR 산물은 DNA purification Kit (SolGent, Daejun, Korea) 를이용해서정제하였다. PCR 산물 20μl 에 00μl 의 PB buffer를잘섞은뒤 filter column에넣고, 분간원심분리시킨다. Column에 80% ethly alcohol을 750μl 을넣고다시 분간원심분리시키고, 침전액을버린뒤다시 2 분간원심분리시킨다. Filter column을새로운.5 ml tube 로옮긴뒤, 30μl 의 EP buffer를 filter 중앙에떨어뜨리고 3분간실온에방치해두었다가 2분간원심분리한다. Filter 는버리고.5 ml tube에정제된 PCR 산물을 % agarose gel에서 TAE buffer 상태에서 50 V로 30분간전기영동한후 UV transilluminator로관찰하였다. 전기영동으로확인한정제한 PCR 산물 μl, sequence primer μl (.6 pmol/μl), BigDye TM v3. ready mix (Applied Biosystem, Foster City, CA) μl, BigDye TM Terminator v., v3. 5 sequecing buffer (Applied Biosystem, Foster City, CA) 3.5μl, 3차멸균증류수 3.5μl 을더해서최종반응액을 0μl 로하였다. PCR은 96 o C에서 분변성시킨뒤, 96 o C에서 0초, 50 o C에서 5초, 60 o C에서 6분을 주기로 25주기를실행하고, 4 o C에서끝냈다. BigDye PCR 생성물을정제하기위해 BigDye PCR 생성물 0μl, 3 M sodium acetate (ph 4.6) 2μl, 95% ethyl alcohol 50μl 을잘섞은뒤실온에서 30분간방치하고나서, 3,000 rpm, 22 o C에서 5분간원심분리한후상층액을버린다. 70% ethyl alcohol 350μl 을넣든뒤두세번가볍게섞은다음 3,000 rpm, 22 o C에서 5분간원심분리한후상층액을버렸다. 50 o C에서 5분간건조시킨후 Hi-Di formamide (Applied Biosystem, Foster City, CA) 20μl 을넣고잘섞고실온에서 20분동안방치하였다. 95 o C에서 5 분간변성시키고 4 o C에 0분동안둔후 ABI 300 Genetic Analyzer (Applied Biosystem, Foster City, CA) 를이용하여염기서열을분석하였다. 4. hmlh 유전자의후보 SNP 선정 International hapmap projects database (http://hapmap. org/ index.html.en) 와 JSNP (http://snp.ims.u-tokyo.ac.jp/ index.html) database 및 SNPbrowser TM software version 3.0 (Applied Biosystems, USA) 를사용하여동경거주일본인과북경거주중국인에서 minor allele frequency가 0. 이상이고 SNPs 사이의거리가일정한 hmlh gene의 rs800734, rs377434, rs4986984와 V384D SNP을선택하였다. 5. 통계분석환자군과대조군은로지스틱회귀분석 (http://ihg.gsf.de/ cgi-bin/hw/hwa2.pl) 을통해비차비와 95% 신뢰구간을추정하였다. Hardy-Weinberg 평형을검사하는데는 χ 2 검사를이용하였다. 두군의평균을비교하는데는 t-test를하였다. 분석하는데이용한프로그램은 SPSS Ver2.0이다. 결과. 정상한국인과급성골수성백혈병환자에서의 6개 SNPs의유전형분포및대립형질빈도의차이 32명의정상한국인과 29명의급성골수성백혈병환자에서 rs800734, rs377434, rs4986984, D376D, V384D, CNUH-GRCHD03-209 등 6개의 SNPs의유전형분포와대립형질의빈도를관찰하였으며모든 loci에대한유전자형의분포는 Hardy-Weinberg 평형이었다 (p>0.05). rs800734는정상한국인에서 G/G 유전형이 50명, G/A 유전형이 3명, A/A 유전형이 74명으로각각 9.6%, 5.4%, 29.0% 로다양한분포를나타내었고대립형질의빈도는 G 는 0.453, A는 0.547이었다. 급성골수성백혈병환자에서도 G/G 유전형이 38명, G/A 유전형이 85명, A/A 유전형이 45명으로각각 22.6%, 50.6%, 26.8% 로분포되었고대립형질의빈도는각각 G는 0.479, A는 0.52이었다. rs377434은정상한국인에서 A/A 유전형이 205명, A/C 유전형이 47명, C/C 유전형이 3명으로각각 80.4%, 8.4%,.2% 의분포를나타내었고대립형질의빈도는 A 는 0.896, C는 0.04였다. 급성골수성백혈병환자에서는 A/A 유전형이 39명, A/C 유전형이 26명, C/C 유전형이 3명으로각각 82.7%, 5.5%,.8% 의분포를나타내었고대립형질의빈도는각각 A는 0.905, C는 0.095였다. rs4968984는정상한국인에서 C/C 유전형이 252명, C/T 유전형이 3명, T/T 유전형은나타나지않아각각 98.8%,.2%, 0% 의분포를나타내었고대립형질의빈도는각각 C는 0.994, T는 0.006였다. 급성골수성백혈병환자에서는 C/C 유전형이 65명, C/T 유전형이 3명, T/T 유전형은나타나지않아각각 98.2%,.8%, 0% 의분포를나타내었고대립형질의빈도는각각 C는 0.99, T는 0.009였다.
박성철외 4 인 : hmlh 유전자의다형성과급성골수성백혈병발병위험의상관성 27 D376D는정상한국인에서 T/T 유전형이 254명, T/C 유전형이 명, C/C 유전형은나타나지않아각각 99.6%, 0.4%, 0% 의분포를나타내었고대립형질의빈도는 T는 0.998, C는 0.002였다. 급성골수성백혈병환자에서는 T/T 유전형이 68명, T/C 유전형과 C/C 유전형은모두나타나지않아각각 00%, 0%, 0% 의분포를나타내었고대립형질의빈도는각각 T는.0, C는 0이었다. V384D는정상한국인에서 T/T 유전형이 307명, T/A 유전형이 4명, A/A 유전형은나타나지않아각각 95.7%, 4.3%, 0% 의분포를나타내었고대립형질의빈도는 T는 0.978, A는 0.022였다. 급성골수성백혈병환자에서는 T/T 유전형이 272명, T/A 유전형이 8명, A/A 유전형이 명으로각각 93.5%, 6.2%, 0.3% 의분포를나타내었고대립형질의빈도는각각 T는 0.966, A는 0.034였다. CNUH-GRCHD03-209는정상한국인에서 A/A 유전형이 253명, A/G 유전형이 2명, G/G 유전형은나타나지않아각각 99.2%, 0.8%, 0% 의분포를나타내었고대립형질의빈도는 A는 0.996, G는 0.004었으며급성골수성백혈병환자에서는 A/A 유전형이 68명, A/G 유전형과 G/G 유전형은모두나타나지않아각각 00%, 0%, 0% 의분포를나 타내었고대립형질의빈도는각각 A는.0, G는 0이었다 (Table 3). 6개의 SNP 모두에서정상한국인과급성골수성백혈병환자에서대립형질빈도의차이가없었다. 2. 한국인에서발견한 hmlh 유전자의새로운단일염기다형성 Coding region에서 2개의새로운단일염기다형성을발견하였는데이들은각각 (+8524C T, +3278A G) 였다 (Fig. ). 이 2개의새로운단일염기다형성은아미노산이바뀌는돌연변이 (coding non-synonymous SNP) 로서 rs4986984 (+8524C T) 는 exon 0번에서 arginine[r] 이 cysteine[c] 으로바뀌었고정상한국인에서작은대립유전자의빈도 (minor allele frequency) 는가 0.006였고 NCBI s SNP database (http://www.ncbi.nlm.nih.gov/snp) 에 rs4986984 로등록되었다. CNUH-GRCHD03-209 (+3278A G) SNP은 exon 4번에서 aspartic acid[d] 가 glycine[g] 로바뀌였고정상한국인에서작은대립유전자의빈도가 0.004 였다. 그러나이 2개의새로운 SNPs은정상한국인과급성골수성백혈병환자에서유전형분포및대립형질의빈도가의의있는차이를보이지않았다 (Table 3). Table 3. SNPs of hmlh genotype distributions of controls and AML cases, with Ors and 95% CIs SNP a Region Amino acid b Genotype AML Number Normal OR (95%CI) -93 A>G (rs800734) +095 A>C (rs377434) +8524 C>T (rs4986984) +3279 T>C (D376D) +32202 T>A (V384D) +3278 A>G (CNUH-GRCHD03-209) 5 UTR Intron5 Exon 0 Exon 4 Exon 4 Exon 4 NA c NA [R]/[C] [D]/[D] [V]/[D] [D]/[G] G/G G/A A/A A/A A/C C/C C/C C/T T/T T/T T/C C/C T/T T/A A/A A/A A/G G/G 38 (22.6%) 85 (50.6%) 45 (26.8%) 39 (82.7%) 26 (5.5%) 3 (.8%) 65 (98.2%) 3 (.8%) 68 (00%) 275 (92.9%) 20 (6.8%) (0.3%) 68 (00%) 50 (9.6%) 3 (5.4%) 74 (29.0%) 205 (80.4%) 47 (8.4%) 3 (.2%) 252 (98.8%) 3 (.2%) 254 (99.6%) (0.4%) 307 (95.6%) 4 (4.4%) 253 (99.2%) 2 (0.8%) 0.85 (0.52.4) 0.80 (0.46.40) 0.82 (0.48.38).48 (0.29 7.4).53 (0.3 7.66).53 (0.03 77.27) 0.50 (0.02 2.43).5 (0.03 76.49).60 (0.80 3.22) 3.35 (0.4 82.54) 0.30 (0.0 6.3).50 (0.03 76.9) Numbers in the n column indicate the number of individuals. In the genotypes frequency column, number of individuals with a given genotype and parentheses show percentages. p-value was calculated by Hardy-Weinberg equilibrium. Odds ratios are given with 95% confidence intervals (95% CI). Normal, healthy korean normal population; AML, Acute myelogenous leukemia patients. a Calculated from the translation start site. b Amino acid: Amino acids change; c NA: not applicable.
28 전남의대학술지제 44 권제 호 2008 Fig.. (A) Partial sequence of the hmlh exon0 around rs4986984. Genomic DNA from normal individual was sequenced. The arrow indicates the C/T heterozygosity of rs4986984 at position +8524 from the start of the translation site. (B) Partial sequence of the hmlh exon4 around CNUH-GRCHD03-209. Genomic DNA from normal individual was sequenced. The arrow indicates the A/G heterozygosity of CNUH-GRCHD03-209 at position +3278 from the start of the translation site. Table 4. Comparison allele frequency of the SNPs in the hmlh gene in different population SNP ID Allele KOR (n) JPT (n) CHB (n) CEU (n) YRI (n) ED* rs800734 rs377434 V384D G:A A:C T:A 0.45:0.55 (50) 0.90:0.0 (50) 0.98:0.02 (50) 0.48:0.52 (86) 0.82:0.8 (74) 0.98:0.03 (60) 0.49:0.5 (88) 0.94:0.06 (88) 0.8:0.9 (4) 0.5:0.49 (98) 0.53:0.47 (20) 0.35 (p<0.0) 0.39 (p<0.0) 0.03 (p>0.05) Parentheses show the number of chromosomes. Different population data were obtained from the International Hapmap projects (http:// hapmap.org/index.html.en). Population descriptors: KOR: Korean normal population; JPT: Japanese in Tokyo, Japan; CHB: Han Chinese in Beijing, China; CEU: CEPH (Utah residents with ancestry from northern and western Europe); YRI: Yoruba in Ibadan, Nigeria. *ED (Ethnic difference) in allele frequency was calculated by subtracting the korean allele frequency from the highest allele frequency of minor allele among ethnic groups at each SNP site. Frequency data from Wang Y et al.23 3. SNP 대립형질빈도의인종간차이 International hapmap projects (http://hapmap.org/index. html.en) 의 database를참고하여인종간 SNP 변이빈도를알수있는 rs800734, rs377434, 그리고 V384D에서동경거주일본인, 북경거주중국인, 북유럽과서유럽혈통의유타거주인, 아프리카계혈통 ( 나이제리아의요루바인 ) 등인종과한국인을비교하였는데 rs800734에서동아시아인과북유럽과서유럽혈통의유타거주인간에통계적으로유의한차이를보였고 (p<0.0), rs377434에서동아시아인과북유럽과서유럽혈통의유타거주인및아프리카계혈통간에통계적으로유의한차이 (p<0.0) 를보였을뿐만아니라동아시아인중에서도한국인과일본인은차이가없었으나, 한국인과중국인 (p=0.03), 그리고일본인과중국인은 (p=0.02) 통계적으로유의한차이를보였다. V384D는한국인과일본 인에서통계적으로유의한차이를보이지않았다 (Table 4). 고찰저자들은급성골수성백혈병환자와정상대조군의 hmlh 유전자에서 5' flanking region에위치한 rs800734, intron 에위치한 rs377434, 그리고 exon에위치한 rs4986984, CNUHD-GRCHD03-209, D376D, V384D 등 6개 SNPs 의빈도를측정하여분석한결과이들 SNP은백혈병의발병과관련이없음을발견하였다. V384D SNP은보고자에따라대장암환자의발암과관련이있다 9 2 와없다 22,23 로알려져왔다. 과오수정유전자의이상이발암의중요한원인으로알려져있지만 hmlh 유전자의 SNP은급성골수성백혈병의감수성과는상관이없는것으로생각된다. 현재까
박성철외 4 인 : hmlh 유전자의다형성과급성골수성백혈병발병위험의상관성 29 지 hmlh 유전자는과오수정기능에중요한영향을미치는 NH2 말단과 COOH 말단등두곳의중요부위를가지고있다. 24 NH2 말단에는 ATPase 활성을가지는 HATPase domain이있고 25 COOH 말단에는 DNA 과오수정단백질, C-말단 domain 26 을가지고있다. V384D SNP은 384번째아미노산을결정하는데 hmlh 유전자의 NH2 말단에위치한 HATPase domain이거나 COOH 말단에위치한 DNA 과오수정단백질, C-말단 domain에는포함되지않았지만 valine이 aspartic acid로바뀌는 (GTT GAT) non-synonymous SNP이다. 저자들은한국인에서 2개의새로운 SNP rs4986984과 CNUH-GRCHD03-209를발견하였으며모두 non-synonymous SNP 이었다. 급성골수성백혈병환자군과대조군에서이 2개 SNPs의유전형과대립형질의빈도는유의한통계학적차이를보이지않았다. 그러나이러한정보는앞으로한국인에서다양한질환의분자역학적연구에유용하게사용될것으로사료된다. 공개된 SNP database는특정민족의 SNP 대립형질의빈도의존재를검사하는데매우유용한정보이다. 그러나지금까지의 SNP databas는대부분서양인, 아프리카인, 일본인과중국인등특정인종에만국한되어있다. 한국인은서양인과많은 SNP의빈도에서다르므로한국인시료를사용하여 SNP을발굴하고한국인 SNP database를구축하는것이반드시필요하다. 저자들은 3개의 SNP에서한국인과다른인종간의대립형질의빈도를비교하였는데 (Table 4) 한국인과북유럽과서유럽혈통의유타거주인및아프리카계혈통 ( 나이제리아의요루바인 ) 간에통계적으로유의한차이를보였지만동아시아인특히일본인과는현저한차이를보이지않은것을볼수있었다. 이것은한국인과일본인이동일한혈통에서기원하였을거라는 Okuda 27, Lee 등 28 의연구결과와도부합된다. 알림본연구는보건복지부보건의료기술진흥사업 (0-PJ0- PG6-0GN6-0005) 과전남대학교의생명인력사업단 ( 전남의대 BK사업단 ) 의지원에의하여이루어진것임. References. Bond GL, Hu W, Levine A. A single nucleotide polymorphism in the MDM2 gene: from a molecular and cellular explanation to clinical effect. Cancer Res 2005;65:548-4. 2. Kim KH, Yeom KS, Choi C. Search for the csnp frequencies of N-acetyltransferase 2 and NAD(P)H dehydrogenase, quinone in DNA pool of Korean people. Chonnam Med J 2002;38:202-9. 3. Gu Z, Hillier L, Kwok PY. Single nucleotide polymorphism hunting in cyberspace. Hum Mutat 998;2:22-5. 4. Shastry BS. SNP alleles in human disease and evolution. J Hum Genet 2002;47:56-6. 5. Stephens JC. Single-nucleotide polymorphisms, haplotypes, and their relevance to pharmacogenetics. Mol Diagn 999;4:309-7. 6. Gilliland DG. Molecular genetics of human leukemia. Leukemia 998; 2(Suppl ):S7-2. 7. Ronen A, Glickman BW. Human DNA repair genes. Environ Mol Mutagen 200;37:24-83. 8. Rotman G, Shiloh Y. ATM: from gene to function. Hum Mol Genet 998;7:555-63. 9. Yu Z, Chen J, Ford BN, Brackley ME, Glickman BW. Human DNA repair systems: an overview. Environ Mol Mutagenesis 999;33:3-20. 0. Ma X, Jin Q, Försti A, Hemminki K, Kumar R. Single nucleotide polymorphism analyses of the human proliferating cell nuclear antigen (pcna) and flap endonuclease (FEN) genes. Int J Cancer 2000;88: 938-42.. Fink D, Aebi S, Howell SB. The role of DNA mismatch repair in drug resistance. Clin Cancer Res 998;4:-6. 2. Thomas DC, Umar A, Kunkel TA. Microsatellite instability and mismatch repair defects in cancer. Mutat Res 996;350:20-5. 3. Thibodeau SN, Bren G, Schaid D. Microsatellite instability in cancer of the proximal colon. Science 993;260:86-9. 4. Bronner CE, Baker SM, Morrison PT, Warren G, Smith LG, Lescoe MK, et al. Mutation in the DNA mismatch repair gene homologue hmlh is associated with hereditary non-polyposis colon cancer. Nature 994;368:258-6. 5. Annese V, Piepoli A, Andriulli A, Latiano A, Napolitano G, Li HH, et al. Association of Crohn's disease and ulcerative colitis with haplotypes of the MLH gene in Italian inflammatory bowel disease patients. J Med Genet 2002;39:332-4. 6. Pokorny RM, Hofmeister A, Galandiuk S, Dietz AB, Cohen ND, Neibergs HL. Crohn's disease and ulcerative colitis are associated with the DNA repair gene MLH. Ann Surg 997;225:78-23; discussion 723-5. 7. Lenz G, Hutter G, Hiddemann W, Dreyling M. Promoter methylation and expression of DNA repair genes hmlh and MGMT in acute myeloid leukemia. Ann Hematol 2004;83:628-33. 8. Seedhouse CH, Das-Gupta EP, Russell NH. Methylation of the hmlh promoter and its association with microsatellite instability in acute myeloid leukemia. Leukemia 2003;7:83-8.
30 전남의대학술지제 44 권제 호 2008 9. Wang Y, Friedl W, Propping P, Li J, Li Z, Wang J. Val384Asp in hmlh gene in Chinese, Japanese and German and its etiological role in colorectal cancer. Zhonghua yi xue yi chuan xue za zhi 998;5: 263-6. 20. Wang Y, Zhou J, Li Z, Wang J, Li J, Gao C, et al. One of the etiological factors of digestive tract cancers in Chinese: the missense mutation Val384Asp in the hmlh gene. Zhonghua yi xue yi chuan xue za zhi 2000;7:82-6. 2. Zhang XM, Li JT, Zhu M, Wu XL, Gao P, Zhou P, et al. Study on the relationship between genetic polymorphism Val384Asp in hmlh gene and the risk of four different carcinomas. Zhonghua liu xing bing xue za zhi 2004;25:978-8. 22. Kim JC, Roh SA, Koo KH, Ka IH, Kim HC, Yu CS, et al. Genotyping possible polymorphic variants of human mismatch repair genes in healthy Korean individuals and sporadic colorectal cancer patients. Fam Cancer 2004;3:29-37. 23. Wang Y, Friedl W, Lamberti C, Nothen MM, Kruse R, Propping P. A novel missense mutation in the DNA mismatch repair gene hmlh present among East Asians but not among Europeans. Hum Hered 998;48:87-9. 24. Kondo E, Suzuki H, Horii A, Fukushige S. A yeast two-hybrid assay provides a simple way to evaluate the vast majority of hmlh germ-line mutations. Cancer Res 2003;63:3302-8. 25. Trojan J, Zeuzem S, Randolph A, Hemmerle C, Brieger A, Raedle J, et al. Functional analysis of hmlh variants and HNPCC-related mutations using a human expression system. Gastroenterology 2002; 22:2-9. 26. Modrich P. DNA mismatch correction. Ann Rev Biochem 987;56: 435-66. 27. Okuda T, Fujioka Y, Kamide K, Kawano Y, Goto Y, Yoshimasa Y, et al. Verification of 525 coding SNPs in 79 hypertension candidate genes in the Japanese population: identification of 59 SNPs in 93 genes. J Hum Genet 2002;47:387-94. 28. Lee JK, Kim HT, Cho SM, Kim KH, Jin HJ, Ryu GM, et al. Characterization of 458 single nucleotide polymorphisms of disease candidate genes in the Korean population. J Hum Genet 2003;48:23-6.