대한임상병리학회지 : 제 20 권제 1 호 2000 Korean J Clin Pathol 2000; 20: 임상미생물학 유전자종분석을이용한 Acinetobacter 의균종동정 이승호 이미경 박애자 최응상 * 중앙대학교의과대학임상병리과학교실, 소아과학교실 *

Transcription

1 대한임상병리학회지 : 제 20 권제 1 호 2000 Korean J Clin Pathol 2000; 20: 임상미생물학 유전자종분석을이용한 Acinetobacter 의균종동정 이승호 이미경 박애자 최응상 * 중앙대학교의과대학임상병리과학교실, 소아과학교실 * Identification of Acinetobacter Genospecies by Analysis of rrna Spacer Regions Seung Ho Lee, M.D., Mi Kyung Lee, M.D., Ae Ja Park, M.D., and Eung Sang Choi, M.D.* Departments of Clinical Pathology and Pediatrics,* Chung-Ang University College of Medicine, Seoul, Korea Background : Recently, the genus Acinetobacter have become increasingly important as nosocomial pathogens. Colonization and infection caused by multiresistant epidemic strains are common manifestations in intensive care units. Up to now 21 genomic species have been described, of which 7 have been named. However, there is no approach about distribution of Acinetobacter species in Korea. The objective of this study was to evaluate the performance of PCR analysis for the accurate identification and distribution of Acinetobacter species. Methods : trna intergenic spacer length polymorphism (trna-ilp), 16S-23S rrna spacer length polymorphism (16S-23S ILP) and restriction analysis of the 16S-23S rrna intergenic spacer sequences (RA 16S-23S) were performed to identify the 7 type strains and 83 clinical isolates of Acinetobacter. Results : 1. In the 7 Acinetobacter type strains, trna-ilp data could be easily analyzed by visual comparision. Eighty one of 83 (97.6%) clinical isolates of Acinetobacter were identified as A. baumannii and the others were identified as A. haemolyticus and A. calcoaceticus. 2. The 16S-23S ILP patterns were not distinguished among the species, except A. haemolyticus, A. johnsonii and A. lwoffii. The three species could be discriminated by a number of specific DNA fragments. 3. In RA 16S-23S, restriction endonuclease Alu I was able to not only digest the amplification products but also gave characteristic restriction patterns for the 7 type strains. Conclusion : The trna-ilp analysis and RA 16S-23S can be used as a tool for the rapid identification of Acinetobacter species with a high degree of specificity. (Korean J Clin Pathol 2000; 20: 48-55) Key words : Acinetobacter, trna intergenic spacer length polymorphism, 16S-23S rrna spacer length polymorphism, Restriction analysis of the 16S-23S rrna intergenic spacer sequences 서 접수 : 1999 년 7 월 24 일접수번호 : KJCP1323 수정본접수 : 1999 년 11 월 27 일교신저자 : 이미경우 서울시중구필동 2 가 82-1 중앙의대부속필동병원임상병리과전화 : , 2262, Fax: 론 1970년대병원감염에서약제에내성을갖는장내세균 (Enterobactericeae) 의증가는새로운광범위항균제를감염환자의치료에도입하게하였고, 이는 Pseudomonas aeruginosa, Stenotrophomonas (Xanthomonas) maltophilia, Acinetobacter 종을포함하는호기성그람음성간균의증가를가져왔다 [1]. Acinetobacter 는항균제에다제내성을나타내면서최근주로중환자실의입원환자들로부터분리되어병원감염의심각한원인균으로새롭게인식되고있으며 [2] 입원환자나면역기능이저하된환자에서패혈증, 요로감염, 수막염및폐렴등을유발한다 [3-5]. 특히 Acinetobacter 에의한병원감염에서의중요한문제는중증환자에서주로발생하며, 항균제에다제내성을나타내어치료제선택에어려움이있고, 환자간전파의병원소가될수있다는점이다 [6]. 48

2 유전자종분석을이용한 Acinetobacter 의균종동정 49 Acinetobacter는 1908년처음으로명명된 oxidase 음성, catalase 양성, 비운동성, nitrate 비환원등을특징으로하는포도당비발효그람음성구간균이다. 이세균은토양, 물등의자연환경과우유, 달걀등의식품및옷, 고무, 유리, 금속등의건조한환경에서도오랫동안생존한다고하며 [7-9], 특히병원내환경및의료기구에서흔히분리된다 [10-14]. 사람의피부에도서식하는상재균으로알려져있는데 [15, 16], 손, 서혜부, 발가락, 이마, 귀, 코, 겨드랑이, 회음부, 인후의순으로흔히분리되는것으로보고되고있어 [17], 여러가지의료용기구와의료인의손등이지속적인감염원으로서병원감염의역할을할수있는것으로알려져있다. 그러나다약제내성 Acinetobacter 감염의빈도와그의미가증가함에도불구하고, 많은임상의들은아직까지병원감염원으로써이들세균의중요성에대하여인식이부족한상태이다. 이러한이유중일부는Acinetobacter 가최근까지분류학적으로명명이확실하게결정되지못하고혼용되어쓰이고있는것과연관될것으로생각된다. 1950년대 Acinetobacter 속의개념은비운동성, 그람음성, oxidase 양성혹은음성인, 균일하지않은잡균류에속하는것으로분류되었었다 [1]. 그이후광범위한연구로 oxidase 양성인균과음성인균이다르다는것이명백해졌고 [18], 1971년 Acinetobacter 속만이 oxidase 음성임이제시되었다 [19]. 이러한분류는전환검사 (transformation test) 들이보충됨으로서 [20] 지금까지 20여년간사용되고있다. 현재 Acinetobacter 속에속하는그람음성비발효세균은최소 15가지의속명으로분류되어왔는데, 이중잘알려진것으로 Bacterium anitratus [21], Herellea vaginicola와 Mima polymorpha[22], Achromobacter, Alcaligenes, Micrococcus calcoaceticus, B5W [23], Moraxella glucidolytica와 Moraxella lwoffii[24] 등이있다. 1984년 Bergey s Manual of Systemic Bacteriology 에서는 Neisseriaceae 과에속하는 Acinetobacter group에는 Acinetobacter calcoaceticus 한종이있으며, 두아종으로분류하여 glucose로부터산을합성할수있는 var. anitratus ( 이전의 Herellea vaginicola) 와산을합성하지못하는 var. lwoffii ( 이전의 Mima polymorpha) 로기술하였다. 또한 1991년 Rossau 등은 Moraxellaceae 라고하는새로운과로분류하여여기에 Moraxella, Acinetobacter, Psychrobacter 및연관균주들을포함할것을제안하였다 [25]. 현재쓰이고있는 Acinetobacter 속분류의기초는 1986년 Bouvet와 Grimont가 DNA-DNA hybridization 연구에의해분류한 12가지의 DNA 유전자종 (genospecies) 에근거하고있다 [26]. 이들 12가지유전자종중 6가지에서종명이지정되어유전자종 1, 2, 4, 5, 7 및 8이각각 A. calcoaceticus, A. baumannii, A. haemolyticus, A. junii, A. johnsonii 및 A. lwoffii 로명명되었고, 나머지유전자종은아직도종번호로만불리우고있다. 그후 1988년에명명된 A. radioresistens는유전자종 12에해당하는것으로밝혀졌으며 [27, 28], 현재 21가지의유전자종이존 재하는것으로보고되어있다 [28-31]. Acinetobacter의동정을위하여여러가지전통적인생화학적반응을이용한검사들이시행되고있지만, 모든유전자종의감별은불가능하여유전자종 1, 2, 3과 13은 A. calcoaceticus-a. baumannii complex 라불리며, 일부병원검사실에서는 A. baumannii 와 A. calcoaceticus 가혼용되어사용되기도한다 [32]. Acinetobacter 균종중임상검체에서흔히분리되며집단병원감염과관련되는것은대부분 A. baumannii이고, 드물게 A. lwoffii 나 Acinetobacter 유전자종 3도분리되나그외의유전자종은임상검체에서거의볼수없다고한다 [8, 33]. 우리나라의경우도임상검체에서분리동정된 Acinetobacter 균종중 91.5% 가 A. baumannii였고나머지 8.5% 가 A. lwoffii였다는보고는있으나 [34], 생화학적방법으로동정된결과일뿐아직까지정확한유전자종의분포에대한보고는없는실정이다. 그러므로우리나라의역학적균종분류와병원내집단유행시특정균종의전파경로를알기위해서 Acinetobacter 균종의유전자종에대한분석이필요하다고생각된다. 본연구에서는 Acinetobacter의정확한분류를위하여, rrna operon내의 trna gene spacer 부위에서균종간의다형성 (trna intergenic length polymorphism: 이하 trna-ilp로약함 ) 분석과 16S-23S rrna spacer 부위의다형성 ( 이하 16S- 23S ILP로약함 ) 분석및 16S-23S rrna spacer 부위에대한제한효소절단 (Restriction analysis of the 16S-23S rrna intergenic spacer sequences: 이하 RA 16S-23S로약함 ) 을통한 Acinetobacter의분자생물학적동정을시도하여국내분리균주의분포를알아보고, 이러한분자생물학적방법들의 Acinetobacter 균종동정에서의유용성을평가하였다. 재료및방법 1. 연구대상 1998년 11월부터 1999년 5월까지중앙대학교의과대학부속병원에내원한환자의각종임상검체에서전통적방법에의하여분리된 Acinetobacter 83 균주를대상으로하였다. 표준균주로는 DNA-DNA hybridization 방법에의해분류된 7 균종의표준균주즉, A. baumannii ATCC 19606, A. calcoaceticus ATCC 23055, A. haemolyticus ATCC 17906, A. johnsonii ATCC 17909, A. junii ATCC 17908, A. lwoffii ATCC 15309, A. radioresistens ATCC 등을사용하였다 (Table 1). 2. 연구방법 1) DNA 추출한개의집락을백금이로취하여 proteinase K (10 mg/ml)

3 50 이승호 이미경 박애자외 1 인 Table 1. Delineation of Acinetobacter genomic species by different laboratories 16S rrna trna 23S rrna Species name Strains Genomic species number according to BG a TU b and V c A. calcoaceticus ATCC A. baumannii ATCC A. haemolyticus ATCC A. junii ATCC A. johnsonii ATCC A. lwoffii ATCC A. radioresistens ATCC Not tested 12 a BG, Bouvet and Grimont[26]; b TU, Tjernberg and Ursing[28]; c V, Vaneechoutte et al[31]. 가첨가된완충액 (10 mm Tris HCl, ph 8.3; 50 mm KCl; 0.1 mg/ml gelatin; 0.45% NP40; 0.45% Tween 20) 에풀어 55 에서 1시간방치한후, proteinase K의활성을제거하기위하여 10분간끓이고약 1분간원심분리하여그상층액을주형 DNA로사용하였다. 2) trna intergenic length polymorphism을이용한 Acinetobacter 균종동정 trna-ilp 분석은시발체를제외한 PCR 반응혼합물 (1 U DNA polymerase, 250 M dntp, 50 mm Tris-HCl, ph 8.3, 40 mm KCl, 1.5 mm MgCl2) 이동결건조되어들어있는 PreMix TM -Top Kit (Bioneer Inc, Seoul, Korea) 에주형 DNA 및 Welsh와 McClelland[35] 에의해기술된시발체 (Fig. 1, Table 2) 를함께첨가하여자동온도조절기 (OmniGene, Hybaid Co, Middlesex, England) 로 94 에서 5분간전변성시킨후 94 에서 30초, 50 에서 30초및 72 에서 2분씩 35회증폭합성하였다. 증폭산물은 1 Tris-Boric acid-edta (TBE, ph 8.3) 완충액에서 6% 한천겔 (Agarose MP, Boehringer Mannheim, Germany) 을이용하여 100 volt로 1시간 10분동안전기영동하고 ethidium bromide로염색한후투조기 (transilluminator) 에서분절의크기및수를확인하였다. 결과는전기영동상의분절크기와수를근거로하여표준균주양상과비교하여판독하였다. 3) 16S-23S rrna spacer length polymorphism을이용한 Acinetobacter 균종동정 16S-23S ILP 분석은 PreMix TM -Top Kit에주형 DNA 및 Jensen 등 [36] 에의해기술된 16S-23S spacer에인접한 16S rrna부위의시발체 (Fig. 1, Table 2) 를함께첨가하여자동온도조절기로 94 에서 5분간전변성시킨후 94 에서 1분, 55 에서 7분및 72 에서 2분씩 25회증폭합성하였다. 증폭산물은 1.5% 한천겔에 50 volt로 1시간전기영동하여 ethidium bromide로염색한후투조기에서분절의크기및수를확인하였다. 결과는전기영동상의분절크기와수에근거하여표준균주양상 과비교하여판독하였다. G1 T5A T3B L1 Fig. 1. Schematic representation of an rrna operon showing the priming sites for the PCR of the trna and 16S-23S spacer region. The dark lines represent the spacer regions that separate the various rrna genes. Table 2. Primers used for PCR Amplified gene Primer Sequences (5 to 3 ) trna spacer T5A GTCCGGTGCTCAACCAACTGAG T3B AGGTCGCGGGTTCGAATCC 16S-23S spacer G1 GAAGTCGTAACAAGG L1 CAAGGCATCCACCGT 4) 16S-23S rrna intergenic spacer sequences의제한효소처리를이용한 Acinetobacter 균종동정 (1) 증폭산물의정제 16S-23S ILP 분석후남은 PCR 반응액을 Geneclean R II Kit (BIO 101 Inc, USA) 로정제하였다. 즉, PCR 반응액의 3 배부피의 NaI 용액과 5 L의 glass milk 용액을가하여혼합한후실온에 5분간방치하면서 2-3회잘섞었다. 13,000 rpm으로 20초간원심분리하여상층을제거하고남은침전물에새로운세척액을사용하여 3회세척한후실온에서건조시켰다. 건조된침전물에 40 L의증류수를가해재부유시키고 13,000 rpm으로원심분리하여그상층액을제한효소처리에이용하였다. (2) 제한효소처리제한효소로 Sma I, Xba I, Pst I, EcoR I ( 이상 Boehringer Mannheim, Mannheim, Germany), Alu I, Hae III ( 이상 Bioneer Inc, Seoul, Korea), Kpn I (Takara, Japan) 을사용하였다. 정제한 DNA g당제한효소를 2 unit씩넣고 Sma I은 30 에서, 그외의제한효소는 37 에서 2시간반응시킨후 4% 한천겔에서 100 volt로 50분간전기영동하여 ethidium bromide로염색한후투조기에서분절의크기및수를확인하였다. 결 과 1. trna-ilp 분석에의한 Acinetobacter 균종동정 본실험에사용한표준균주의전기영동상 trna-ilp 양상은분절수가 7개에서 11개까지나타났으며분절의크기는약 60 bp 에서 900 bp에해당하여, 이들분절의수와크기로각균종간감

4 유전자종분석을이용한 Acinetobacter 의균종동정 51 M M bp 200 bp 175 bp 150 bp 100 bp 300 bp 200 bp 175 bp 150 bp Fig. 2. trna-ilp patterns of 7 type strains of Acinetobacter species in a 6% agarose gel electrophoresis. Lane M, molecular size marker (25/100 DNA ladder); lane 1, A. baumannii ATCC 19606; lane 2, A. calcoaceticus ATCC 23055; lane 3, A. haemolyticus ATCC 17906; lane 4, A. johnsonii ATCC 17909; lane 5, A. junii ATCC 17908; lane 6, A. lwoffii ATCC 15309; lane 7, A. radioresistens ATCC bp Fig. 3. trna-ilp patterns of clinical isolates in a 6% agarose gel electrophoresis. Lane M, molecular size marker (25/100 DNA ladder); lane 1-6, Clinical isolates were identified as A. baumannii. M M bp 900 bp 800 bp 500 bp 300 bp 200 bp 175 bp 150 bp 100 bp Fig S-23S ILP patterns of 7 type strains of Acinetobacter species in a 1.5% agarose gel electrophoresis. Lane M, molecular size marker (25/100 DNA ladder); lane 1, A. baumannii ATCC 19606; lane 2, A. calcoaceticus ATCC 23055; lane 3, A. haemolyticus ATCC 17906; lane 4, A. johnsonii ATCC 17909; lane 5, A. junii ATCC 17908; lane 6, A. lwoffii ATCC 15309; lane 7, A. radioresistens ATCC 별이가능하였다 (Fig. 2, 3). 임상검체에서분리된총 83균주중 81균주 (97.6%) 가 A. baumannii로동정되었으며 (Fig. 3), 나머지균주는 A. haemolyticus 와 A. calocoaceticus 였다. 또한동일균주의반복검사시에도일정하게같은결과를나타내었다 S-23S ILP 분석에의한 Acinetobacter 균종동정 Fig. 5. The electrophoretic patterns of 7 type strains of Acinetobacter species obtained after restriction of the amplified 16S- 23S spacer regions with Alu I in a 4% agarose gel. Lane M, molecular size marker (25/100 DNA ladder); lane 1, A. baumannii ATCC 19606; lane 2, A. calcoaceticus ATCC 23055; lane 3, A. haemolyticus ATCC 17906; lane 4, A. johnsonii ATCC 17909; lane 5, A. junii ATCC 17908; lane 6, A. lwoffii ATCC 15309; lane 7, A. radioresistens ATCC 43998; lane 8, A. baumannii clinical isolates. 만, 나머지균종은분절의수가 1개이면서분절의크기차이가근소하여쉽게감별할수없었다 (Fig. 4). 임상검체에서분리된 83균주중 1균주는 A. haemolyticus 로감별되었으나, 나머지균주는모두분절의수와크기가비슷하여 A. baumannii, A. calcoaceticus, A. junii, A. radioresistens 중의어느균종인지는감별이되지않았다. 본실험에사용한표준균주의전기영동상 16S-23S ILP 양상은분절수가 1개에서 4개정도였고분절의크기는약 900 bp에서 1300 bp에해당하여, 이들분절의수와크기로감별하였다. A. haemolyticus, A. johnsonii, A. lwoffii는감별이가능하였지 3. RA 16S-23S 를이용한 Acinetobacter 균종동정 16S-23S ILP 분석후의 PCR 산물을 7가지제한효소로처리하여분석하였는데, Sma I, EcoR I, Hae III, Pst I, Kpn I에

5 52 이승호 이미경 박애자외 1 인 대해서는본 PCR 증폭산물내에절단부위를갖고있지않았다. 한편 Xba I은 7가지표준균주중 A. baumannii, A. junii, A. lwoffii의 PCR 증폭산물내에절단부위를갖고있었으나절단된분절의수가 1-2 개이고, 절단부위를갖지않는균종도있으므로본실험에사용된 7가지표준균주의정확한균종동정이어려웠다. 그러나 Alu I은 PCR 증폭산물을절단하여 100 bp에서 400 bp사이에 5-6개의각기다른크기의분절을보임으로 16S- 23S ILP 분석으로유전자종감별이어려웠던균종을포함하여 7 가지표준균주의균종동정이가능하였다 (Fig. 5). 고찰 Acinetobacter 의균종동정은크게표현형적특성을이용한검사와유전형검사로나눌수있다. 표현형적특성을이용한동정검사로는집락모양, 용혈성, 그람염색및여러가지생화학적시험등의전통적인방법을이용하여왔으나, 유전자종이밝혀진이후일부유전자종은감별이되지않음이알려졌고특히유전자종 1과 3, 2와 13, 8과 15의감별에어려움이있었다 [28, 32]. 또한전통적인방법은시험종목이매우많아서흔히쓰이지않는생화학시험도추가하여야하고, 시험결과가동일균주에서도다양하게나타날수있어서모든균종을정확히동정하기는어렵다. 더욱이일부검사는반응시간이길어서신속한동정결과를얻기가어려운단점도있다. 간편하고신속한세균동정을위해서상품화된동정키트들이개발되어사용되고있기는하지만, 대부분생화학적시험결과에의한 database에기초하여동정하게되므로제품과균종명에따라정확도가다양하게나타난다. Bernards 등은 DNA-DNA hybridization 검사에서 18가지유전 자종으로동정된 130 균주를 API 20NE system (biomerieux, France) 으로비교하였을때 45% 에서만유전자종과동일한동정 결과를보였다고보고하여, 유전자종수준의정확한균종동정에는문제가있는것으로나타났다 [37]. 이러한표현형적특성을이용한검사의문제점을극복하기위하여세균동정을위한연구들이전통적인기법에서분자생물학적인방향으로전환되어시도되고있으며, Acinetobacter 의균종동정에도분자생물학적기법에기초한방법들이소개되고있다. Acinetobacter 의균종동정을위한분자생물학적방법에는 DNA-DNA hybridization[17, 26, 28, 32], ribotyping 분석 [17, 38], pulsed-field gel 전기영동 [39], PCR을이용한동정등이보고되었는데, PCR법이흔히이용된다. 세균동정을위한 PCR 법은시발체의선택이중요하다. 흔히사용되는시발체는모든세균에공통적으로있는반복염기서열, 결합확률이높은임의의염기서열, 또는한염색체내에다양한수가존재하는특정염기서열부위등을선택하여이용할수있다 [40]. PCR법에는 random amplified polymorphic DNA analysis (RAPD)[41], repetitive extragenic palindromic sequence-based PCR[42],, amplified ribosomal DNA restriction analysis (ARDRA)[31, 43, 44], 16S rrna 유전자의 PCR-single-strand conformation polymorphism (PCR-SSCP)[45], rrna operon 내의일정부위를선택하여균종간의다형성을이용하는방법 [36, 44-48], reca 유전자를이용하는방법 [49] 등이보고되어있다. rrna 유전자는모든생물의생존에필수적이며 16S, spacer, trna, spacer, 23S, spacer 그리고 5S rrna의순서로구성되어있어 (Fig. 1) 이를이용한동정방법이흔히이용되고있다. Widjojoatmodjo 등 [45] 은 16S rrna 유전자를이용한시발체로 PCR-single strand conformation polymorphism (PCR- SSCP) 법을세균의분자생물학적동정에시도하였다. 그러나이방법은 PCR 산물의크기가 100 bp에서 400 bp정도로고안이되어야감별가능한해상도를유지할수있으며, PCR 후의 SSCP 전기영동과염색이매우번거롭고비교적많은시간을필요로하기때문에임상검사실에서일상적으로이용하기에는어려운점이있었다. 또한 16S rrna 유전자를 PCR로증폭하여제한효소로절단한후그분절의크기및수에따른균종동정도보고되어있는데이방법은여러균종의동정에널리이용될수있고재현성도우수한방법으로제안되었으나, 균종에따라각기다른제한효소가필요한단점이있다 [31, 43, 44]. trna 유전자는대부분균종의 genome에 multiple copies로퍼져있어반복되는 trna 염기서열에대한시발체를이용하여 PCR을시행하면특징적인수의 PCR 산물을나타내므로균종감별에이용이가능하다. trna-ilp 법은분절수가비교적많고크기의차이도현저하여균종감별에유용한것으로알려져있다 [33, 48]. 본연구에서도 Acinetobacter 의유전자종중종명이지정된표준균주에서각기다른특징적인전기영동양상을보였다. 즉 60 bp에서 900 bp의분절이 7개에서 11개가관찰되었고, 그크기의차이도현저하여균종간의감별이용이하였다. 임상검체에서분리된총 83균주를표준균주의전기영동양상과비교하여동정하였는데, 81균주 (97.6%) 가 A. baumannii로동정되었으며나머지균주는 A. haemolyticus 와 A. calcoaceticus 였다. 또한동일균주의반복검사시에도일정하게같은결과를나타내어 trna-ilp 분석으로 Acinetobacter 의균종감별이가능하였고, 임상검체에서분리되는 Acinetobacter 의균종이대부분 A. baumannii 임이유전자종수준에서확인되었다. 그러나이결과는한정된균주에대한결과이므로좀더많은임상분리균주를대상으로유전자종수준에서의균종동정을통한정확한국내의균종분포를확인해볼필요가있을것으로사료되었다. 또한 trna-ilp 법은한집락을취하여 PCR로증폭한후통상사용되는한천겔에전기영동하여그양상을판독하므로, 약 8시간내에결과를확인할수있어신속한균종동정이가능하였고특수한시설없이도 PCR 검사가가능한검사실에서는쉽게이용할수있으며, 비용도경제적인장점이있다고생각되었다. 또한다양한농도의한천겔과전기영동시간을비교하여본결과본원

6 유전자종분석을이용한 Acinetobacter 의균종동정 53 에서사용되는다용도한천겔을 6% 로조제하여 100 volt에서약 70분간전기영동하였을때증폭산물의분절크기와수가가장잘감별되었고, 동일균주를반복검사하였을때의재현성도우수하였다. 반면에 16S-23S ILP법은분절수가 1개에서 4개로 trna- ILP보다적었고, 그크기의차이도많지않아서균종감별에어려움이있었다. 즉표준균주중 A. haemolyticus, A. johnsonii, A. lwoffii 는감별이가능하였지만, 나머지균종은분절의수가 1 개이면서분절의크기차이가적어서쉽게감별할수없었다. 마찬가지로임상검체에서분리된총 83균주중 A. haemolyticus 로감별된 1균주를제외한나머지는 A. haemolyticus, A. johnsonii, A. lwoffii가아닌다른균종으로는보였으나, 모두분절의수와크기가비슷하여, A. baumannii, A. calcoaceticus, A. junii, A. radioresistens 간의균종감별이되지않았다. 그러므로 16S-23S ILP법은 Acinetobacter 의균종동정에는적합하지않는것으로판단되었다. 또한 16S-23S ILP 분석후의 PCR 산물을 7가지제한효소로처리하여분석한 RA 16S-23S의결과, SmaI, EcoR I, Hae III, Pst I Kpn I, Xba I, Alu I중Alu I이 PCR 증폭산물을절단하여 100 bp에서 400 bp사이에 5-6개의각기다른크기의분절을보임으로 16S-23S ILP 분석으로유전자종감별이어려웠던균종을포함하여 7가지표준균주의균종동정이가능하였고반복검사시의재현성도우수하였다. 그러므로 16S-23S ILP PCR 산물에대한제한효소 Alu I 처리는 Acinetobacter 균종감별에좋은방법으로사료된다. 그러나 trna-ilp 법에비해 PCR 산물을제한효소로절단하는과정이추가되므로결과판독까지의시간이약 4시간정도더소요되었다. 이상의결과를통해최근항균제에다제내성을나타내어병원감염의원인균으로그중요성이증가하고있는 Acinetobacter 의유전자종수준의동정검사시, trna-ilp과 RA 16S-23S 분석이비교적간편하고신속하게정확한균종동정이가능하므로임상검사실에서매우유용하게이용될수있을것으로판단되었다. 요약배경 : 원내감염을일으키는병원균중항균제에다제내성을나타내면서최근주로중환자실의입원환자들로부터분리되어병원감염의심각한원인균으로새롭게인식되고있는 Acinetobacter species는현재 21가지의유전자종이존재하는것으로보고되어있고, 이중 7가지에서종명이지정되어명명되고있다. 그러나아직까지국내에서는 Acinetobacter 의유전자종에대한연구나그분포에대한시도는없는상태이다. 이에본연구에서는 Acinetobacter 의유전자종수준의정확한분류와국내분리균주의분포를알아보기위하여 PCR을이용한균종동정을시도하였다. 방법 : 7균종의표준균주와임상에서분리된 83균주의 Acinetobacter 를대상으로하여 rrna operon내의 trna gene spacer 부위에서균종간의다형성 (trna-ilp) 분석과 16S- 23S rrna spacer 부위의다형성 (16S-23S ILP) 분석및 16S- 23S rrna spacer 부위에대한제한효소절단 (RA 16S-23S) 을시행하였다. 결과 : 1. 표준균주의 trna-ilp 분석은분절수가 7개에서 11 개까지나타났고분절의크기는약 60 bp에서 900 bp에해당하여, 이들분절의수와크기로각균종간감별이가능하였다. 또한임상검체에서분리된총 83균주중 81균주 (97.6%) 가 A. baumannii 로동정되었으며나머지는 A. haemolyticus 와 A. calcoaceticus 였다. 2. 표준균주의 16S-23S ILP 양상은분절수가 1 개에서 4개정도였고분절의크기도큰차이를보이지않아, A. haemolyticus, A. johnsonii, A. lwoffii 는감별이가능하였지만나머지균종은감별할수없었다. 총 83균주중 A. haemolyticus 로감별된 1균주를제외한나머지는 A. haemolyticus, A. johnsonii, A. lwoffii 가아닌다른균종으로는보였으나, 모두분절의수와크기가비슷하여, A. baumannii, A. calcoaceticus, A. junii, A. radioresistens 간의균종감별이되지않았다 S- 23S ILP 분석후의 PCR 산물을제한효소 Alu I으로처리할경우 Acinetobacter 균종감별에좋은방법이었다. 결론 : 항균제에다제내성을나타내어최근병원감염의원인균으로그중요성이증가하고있는 Acinetobacter 의유전자종수준의동정검사로서 trna-ilp과 RA 16S-23S 분석은비교적간편하고신속하게정확한균종동정이가능하므로임상검사실에서매우유용하게이용될수있을것으로판단되었다. 참고문헌 1. Bergogne-Berezin E and Towner KJ. Acinetobacter spp. as nosocomial,, pathogens: microbiological, clinical, and epidemiological features. Clin Microbiol Rev 1996; 9: Rapert K, Jo-Anne B, Lynda C, Helen D, Marta G, Catharine K, et al. Investigation of a multiyear multiple critical care unit outbreak due to relatively drug-sensitive A. baumannii: risk factors and attributable mortality. J Infect Dis 1996; 174: Tilley PA and Robert FJ. Bacteremia with Acinetobacter species: risk factors and prognosis in different clinical settings. Clin Infect Dis 1994; 18: Sherertz RJ and Sullivan ML. An outbreak of infections with Acinetobacter calcoaceticus in burn patients: contamination of patients matresses. J Infect Dis 1985; 151: 박철호, 박성규, 우준희. Acinetobacter 균혈증의임상적특성. 감염 1995; 27: Humphreys H, Towner KJ, Crowe M, Webster C, Winter R. Acine-

7 54 이승호 이미경 박애자외 1 인 tobacter infections, intensive care units, and hand washing. Lancet 1995; 345: Baumann P. Isolation of Acinetobacter from soil and water. J Bacteriol 1968; 96: Gennari M and Lombardi P. Comparative characterization of Acinetobacter strains isolated from different foods and clinical sources. Int J Med Microbiol Virol Parasitol Infect Dis 1993; 229: Constanze W, Beate D, Ekkehart D, Henning R. Survival of A. baumannii on dry surface. J Clin Microbiol 1997; 35: Allen KD and Green HT. Hospital outbreak of multi-resistant Acinetobacter anitratus: an air-borne mode of spread? J Hosp Infect 1987; 9: Cefai C, Richards J, Gould FK, McPeake P. An outbreak of Acinetobacter respiratory tract infection resulting from incomplete disinfection of ventilatory equipment. J Hosp Infect 1990; 15: Smith W and Massanari RM. Room humidifiers as the source of Acinetobacter infections. JAMA 1977; 237: Weernink A, Severin WPJ, Tjernberg L, Dijkshoorn L. Pillows, an unexpected source of Acinetobacter. J Hosp Infect 1995; 29: Contant J, Kemeny E, Oxley C, Perry E, Garber G. Investigation of an outbreak of Acinetobacter calcoaceticus var anitratus infections in an adult intensive care unit. Am J Infect Control 1990; 18: Guenthner SH, Hendley JO, Wenzel RP. Gram-negative bacilli as nontransient flora on the hands of hospital personnel. J Clin Microbiol 1987; 25: Larson EL. Persistent carriage of gram-negative bacteria on hands. Am J Infect 1981; 9: Seifert H, Dijkshoorn L, Gerner-Smidt P, Pelzer N, Tjernberg I, Vaneechoutte M. Distribution of Acinetobacter species on human skin: comparison of phenotypic and genotypic identification methods. J Clin Microbiol 1997; 35: Baumann P, Doudoroff M, Stanier RY. A study of the Moraxella group. II. Oxidase-negative species (genus Acinetobacter). J Bacteriol 1968; 95: Lessel EF. Minutes of the Subcommittee on the Taxonomy of Moraxella and Allied Bacteria. Int J Syst Bacteriol 1971; 21: Juni E. Interspecies transformation of Acinetobacter genetic evidence for a ubiquitous genus. J Bacteriol 1972; 112: Schaub IG and Hauber FD. A biochemical and serological study of a group of identical unidentifiable gram-negative bacilli in human sources. J Bacteriol 1948; 56: De Bord GG. Organisms invalidating the diagnosis of gonorrhea by the smear method. J Bacteriol 1939; 38: Juni E. Genetics and physiology of Acinetobacter. Ann Rev Microbiol 1978; 32: ,, 24. Brisou J. Contributional etude des Pseudomonadaceae. Pr cisions taxonomiques sur le genre Acinetobacter. Ann Inst Pasteur 1957; 93: Rossau R, van Landschoot A, Gillis M, De Ley J. Taxonomy of Moraxellaceae fam. nov., a new bacterial family to accommodate the genera Moraxella, Acinetobacter, and Psychrobacter and related organisms. Int J Syst Bacteriol 1991; 41: Bouvet PJM and Grimont PAD. Taxonomy of the genus Acinetobacter with the recognition of Acinetobacter baumannii sp. nov., Acinetobacter haemolyticus sp. nov., Acinetobacter johnsonii sp. nov., and Acinetobacter junii sp. nov. and emended descriptions of Acinetobacter calcoaceticus and Acinetobacter lwoffii. Int J Syst Bacteriol 1986; 36: Nishimura Y, Ino T, Iizuka H. Acinetobacter radioresistens sp. nov. isolated from cotton and soil. Int J Syst Bacteriol 1988; 38: Tjernberg I and Ursing J. Clinical strains of Acinetobacter classified by DNA-DNA hybridization. APMIS 1989; 97: Gerner-Smidt P. Acinetobacter: epidemiological and taxonomic aspects. APMIS 1994; 102(Suppl. 47): Gerner-Smidt P and Tjernberg I. Acinetobacter in Denmark. II. Molecular studies of the Acinetobacter calcoaceticus-acinetobacter baumannii complex. AMPIS 1993; 101: Vaneechoutte M, Dijkshoorn L, Tjernberg I, Elaichouni A, Vos PD, Claeys G, et al. Identification of Acinetobacter genomic species by amplified ribosomal DNA restriction analysis. J Clin Micorbiol 1995; 33: Gerner-Smidt P, Tjernberg I, Ursing J. Reliability of phenotypic tests for identification of Acinetobacter species. J Clin Microbiol 1991; 29: Bouvet PJM, Jeanjean S, Vieu JF, Dijkshoorn L. Species, biotype, and bacteriophage type determinations compared with cell envelope protein profiles for typing Acinetobacter strains. J Clin Microbiol 1990; 28: 송호연, 조성란, 김휘준, 고광균. 임상검체에서분리된 Acinetobacter 의항균제내성 ( ). 대한화학요법학회지 1998; 16: Welsh J and McClelland M. PCR-amplified length polymorphisms in trna intergenic spacers for categorizing staphylococci. Mol Microbiol 1992; 6: Jensen MA, Webster JA, Straus N. Rapid identification of the basis of polymerase chain reaction-amplified ribosomal DNA spacer polymorphism. Appl Environ Microbiol 1993; 59: Bernards AT, Toorn J, Boven CPA, Dijkshoorn L. Evaluation of the ability of a commercial system to identify Acinetobacter genomic species. Eur J Clin Microbiol Infect Dis 1996; 15: Gerner-Smidt P. Ribotyping of the Acinetobacter calcoaceticus-acinetobacter baumannii complex. J Clin Microbiol 1992; 30: Seifert H and Gerner-Smidt P. Comparision of ribotyping and pulsedfield gel electrophoresis for molecular typing of Acinetobacter isolates. J Clin Microbiol 1995; 33: Van Belkum A. DNA fingerprinting of medically important microorganisms by use of PCR. Clin Microbiol Rev 1994; 7:

8 유전자종분석을이용한 Acinetobacter 의균종동정 Graser Y, Klare I, Halle E, Gantenberg R, Buchholz P, Jacobi HD, et al. Epidemiological study of an Acinetobacter baumannii outbreak by using polymerase chain reaction fingerprinting. J Clin Microbiol 1993; 31: Snelling A, Gerner-Smidt P, Hawkey PM, Heritage J, Parnell P, Porter C, et al. Validation of use whole-cell repetitive extragenic sequence-based PCR (REP-PCR) for typing strains belonging to the Acinetobacter calcoaceticus-acinetobacter baumannii complex and application of the method to the investigation of a hospital outbreak. J Clin Micorbiol 1996; 34: Koeleman JGM, Stoof J, Biesmans DJ, Savelkoul PHM, Vandenbroucke-Grauls CMJE. Comparison of amplified ribosomal DNA restriction analysis, random amplified polymorphic DNA analysis, and amplified fragment length polymorphism fingerprinting for identification of Acinetobacter genomic species and typing of Acinetobacter baumannii. J Clin Microbiol 1998; 36: Dijkshoorn L, van Harsselaar B, Tjernberg I, Bouvet PJM, Vaneechoutte M. Evaluation of amplified ribosomal DNA restriction analysis for identification of Acinetobacter genomic species. System Appl Microbiol 1998; 21: Widjojoatmodjo MN, Fluit AC, Verhoef J. Molecular identification of bacteria by fluorescence-based PCR-single strand conformation polymorphism analysis of the 16S rrna gene. J Clin Microbiol 1995; 33: Dolzani L, Tonin E, Lagatolla C, Prandin L, Monti-Bragadin C. Identification of Acinetobacter isolates in the A. calcoaceticus-a. baumannii complex by restriction analysis of the 16S-23S rrna intergenic spacer sequences. J Clin Microbiol 1995; 33: Garcia A, Montoya R, Bello H, Gonzalez G, Dominguez M, Zemelman R. Differentiation of Acinetobacter baumannii biotypes by amplification of 16S-23S rrna intergenic spacer sequences. Microbios 1996; 88: Ehrenstein B, Bernards AT, Dijkshoorn L, Gerner-Smidt P, Towner KJ, Bouvet PJM, et al. Acinetobacter species identification by using trna spacer fingerprinting. J Clin Microbiol 1996; 34: Nowak A and Kur J. Differentiation of seventeen species of Acinetobacter by multiplex polymerase chain reaction and restriction fragment length polymorphism analysis. Mol Cell Probes 1996; 10: