임앙병리럼마파악외 711 : 며 133 뀐머 12 보, 65-73, ICU 환자에서 Imipenem 내성 Acinetobacter baumannii 와 MRSA 의분리및항균제감수성 원광보건대학임상병리과 원광대학병원임상병리과 * 김신무 이나영 정재옥 * Pre

Size: px

Start display at page:

Download "임앙병리럼마파악외 711 : 며 133 뀐머 12 보, 65-73, ICU 환자에서 Imipenem 내성 Acinetobacter baumannii 와 MRSA 의분리및항균제감수성 원광보건대학임상병리과 원광대학병원임상병리과 * 김신무 이나영 정재옥 * Pre"

하나 원
5 years ago
Views:

1 임앙병리럼마파악외 711 : 며 133 뀐머 12 보, 65-73, ICU 환자에서 Imipenem 내성 Acinetobacter baumannii 와 MRSA 의분리및항균제감수성 원광보건대학임상병리과 원광대학병원임상병리과 * 김신무 이나영 정재옥 * Prevalence and Antimicrobial Susceptibility against Imipenem-Resistant Acinetobacter baumannii and MRSA Isolates from Intensive Care Unit Patients Kim, Shin M., Lee, Na YOlmg., 다 umg, Jae Ok* Department of Clinical Laboratory Science, W onkwang H ealth Science, Iksan , Korea *Department of Clinical Pathology, Wonkang University Hospital, Iksan , Korea Infections in ICU patients are often due to mu1tiple antibiotic resistant bacteria, such as MRSA and Acinetobacter spp. hnipenem-resistant gram-negative bacilli has been increasingly reported in other countries. The aim of this study was to determine the prevalence of MRSA and Acinetobacter spp. In ICU patients and to compare antimicrobial reisistance of imipenem-resistant and susceptible Acinetobacter isolates. Respiratory specimens were taken from ICU patients in Wonkwang University Hospital in 2α)(). Antimicrobial susceptibility was tested by NCCLS disk diffusion test and agar dilution test. MRSA and A. baumannii from ICU patients were isolated from 66.7% and 25% of specimens, respectively. Among the 24 ICU patients, 6 A. baumannii isolates were resistant to imipenem by agar dilution test. The MIC range of imipenem for imipenem-resistant A. baumannii was μ g/ml. Resistance rate of imipenem-resistant A. baumannii to other antibiotics were higher than that of imipenem-susceptible isolates. Key wards Imipenem-Resistant Acinetobacter baumannii, Antimicrobial Susceptibility, MRSA, meca gene, Intensive Care Unit 이논문은 2001 년도원광보건대학교내학술비지원에의해서이루어졌음 65

2 1. 서를람음성간균이많이출현되고있다 (Bergogne Berezin 때d Towner, 1996; Bergogne-Berezin 때d Acinetobacter baumannii는 호기성 그람음성 Joly-Guillou, 1991; Crombach et al., 1989; Lambert oxidase 음성포도당비발효구간균으로자연과 ea al., 1990; Quinn, 1998; Vila et al., 1997; Vila et 병원환경에많이분포되어있고임상겸체에서는 al., 1999) 년 9월에스페인에서 1400명의환 포도당비발효그람음성간균가운데 Pseudomo1U1S 자가중환자실에입원하고있는동안다약제 A. aeruginosa다음순으로분리율이높으며특히중 baumannii 균주에의해서 60-70% 환자에 정착되 환자실 (intensive care unit, ICU) 에서 병원감염 (no- 거나감염된것으로알려졌으며 (Corbella et al., socomial infection) 이 증가되는추세이고 (Corbella 2000), 100명의 ICU입원환자중 1992년에는 6.3 명 et al., 1996; Cisneros et al., 1996) 대부분호흡기감염을일으키나, 그외에도뇌막염, 패혈증, 비뇨 에서 1996년에는 14 명이새로이세균에정착되거나감염이증가된것으로보고되고있고, 근년 기 감염및창상감염등다양한감염증을유발 에다약제내성 A. baumannii 균주가 ICU환자에 하며 (Bouvet and Grimont, 1986; Horrevorts et al., 가장흔한감염균주로증가되고있다. 1995; Murray et al., 1995), 병원외 Acinetobacter 본연구에서는전북지역 W 대학병원 ICU환자 폐렴 (community-acquired Acinetobacter pneumonia) 의 기관후두부검체에서 A. baumannii와 MRSA 도보고되고었다. 또한이 세균은매우빠르게 의 보균율을조사하고 imipenem-resistant과감수 항균제에내성이생기는경향이있으며임상겸 성인 A. baumannii 에 대한항균저1 감수성을규명 처l 뿐만아니라건강한사람의피부나점막에 하고자하였다. 정상세균총으로존재하기도한다. 이세균은낮 은병원성균임에도불구하고병원감염을일으 11. 재료및발법 킬수있으며, 다약제내성을나타내는균주는 환자치료에까다로운것으로알려지고있다 (Leonov et al., 1990; Sato and Nakae, 1991; 조등, 2000년 1-12월에전북지역 W대학병원환자에서분리된 A. baumannii 46주와 ICU환자 24 명의 1998). 기관후두부를 dacron 면봉으로채취하여 Mac 서 -lactamase 생성으로 imipenem-resistant (lr) A. baumannii 균주가 1985 년에영국에서처음보고되었으며 (Paton et al., 1993), 이어서 carbapenemresistant(cr) A. baumannii 감염은 1991 년에미국 Conkey agar와 mannitol salt agar (MSA, oxacillin 6 μgjml포함 ) 에접종하여 37 oc 에서하룻밤배양후 MacConkey agar에서 A. baumannii가의심되는무색또는연한분홍색집락이그람음성구간균, 의 뉴욕병원에서 (Go et al., 1994; Urban et al., TSI agar에서고층과사면이알카리, oxidase 음 1993) 보고하였고, 그이후로아르헨티나, 벨기 성, 운동성음성, glucose OP시험에서산화, fruc 에, 브라질, 큐바, 영국, 프랑스, 홍콩, 쿠웨이트 tose OP} l 험에서비산화, 혈액한천배지에서비용 싱가포르, 스페인등여러나라에서도보고되었 혈성집락, 44 0 C 증식시험에서증식되고, imipenem 다 (Mzal-Sh때 et al., 1998; Bou et al., 2α)(); 10 μg 디스크를이용한디스크확산법에서 억제 Brown et al., 1997; Da Silva et al., 1999; Paton et 대가드 13 mm 이하이고한천희석법으로 imipenem al., 1993; Tankovic et al., 1994). 병원감염에는주 MIC가능 16 μgjml 일때 IR A. baumannii로동정 로 methicillin-resistant Staphylococcus aureus(mrsa), 하였으며, 6 주를분리하였다. MRSA 분리를위해 vancomycin-resistant enterococci(vre) 와더불어서는 MSA (oxacillin 6 μ앙ml포함 ) 배지에집락주최근에는다약제내성인 A. baumannii과같은그위가노란색인 16주를통상방법으로배양하였다. 66

gel로전기영동하여그분획을 ethidium bromide 로염색후 554 bp로증폭된 meca 유전자띠는 자외선하에서관찰하였다.

3 MRSA확인을위한 meca 유전자위한 PCR용 ( 전자염색시약, 4%) 를 parafilm위에 1 방울놓고 primer는이등 (1 998) 의보고에따라서 (Table 1) 다시 fonn var coating 된 grid (200 mesh로구리 합성한것 (Genotek co., 대전 ) 을사용하여, thennal 로된것임 ) 를부유액방울위에올려수초후여 cycler (Turbo thermal cycler, Bioneer, 대전 ) 를이 과지로염색시약을제거하여, 75 kv하에관찰하 용하여 증폭하였고, PCR 산물은 1.2 % agarose 여 촬영하였다 (Fig. 1). gel로전기영동하여그분획을 ethidium bromide 로염색후 554 bp로증폭된 meca 유전자띠는 자외선하에서관찰하였다. 혈액한천배지에서용혈성집락, 그람양성구 균, DNase agar with methyl green (Difco) 에서의 반응과시험관법 coagulase 시험에서양성인균주를 oxacillin 디스크확산법 (NCCLS, 1993) 과 oxacillin 한천선별법으로시험하였다. 즉 oxacillin 한천선별법은 tryptic soy broth (TSB, Difco) 에 접종한균주를 McFarland 0.5 관탁도로맞춘균액을 Mueller-돼nton 한천에 NaCl 4% 와 oxacillin 6 μ앙ml를넣은배지에면봉으로접종하고, 35 0 C 에 24시간배양후증식된균주를 MRSA로동정하였으며, PCR 법 ( 김등, 1999) 으로 meca 유전자 (554 bp) 를검출하여최종적으로 MRSA균주로확인하였다. 분리된세균은감수성시험에쓰열때까지탈지우유 (skim milk) 에넣어 -70 oc 에보관하였다. 또한형태를관찰하기위하여투과전자현미경 (Hitachi 710) 을이용한음화염색 (negative stain) 법으로염색하였다. 즉 tryptic soy agar (TSA, Difco) 배양된 A. baumannii를멸균식염수에소량의집락을부유시킨후이부유액을 parafilm위에 1 방울올려놓고 fonn var coating 된 grid를부유액방울 (drop) 위에올려 1 분간두었다. 여과지로물기를제거하고 5분정도건조시킨후, uranyl acetate Fig. 1. Transmission electron microscopy of A. baumannii WHC-ll which shows a coccoid rod organism (bar 0.92 cm = 0.1 μm) 항균저 l 감수성은 NCCLS 의표준디스크확산 법 (NCCLS, 1997) 에따라, cefotaxime 30 μg, ceftazime 30 μg, gentamicin 10 μg, tobramycin 10 μg, ciprofloxacin 5 μg, trimethoprim/sulfamethozaxole l.25/23.75 μg 의 하였다. 디스크를사용하여시험 시험관내한천희석법에의한 MIC 사험은 cefotaxime (Sigma chemical), ceftazidime (Sigma chemical), ciprofloxacin (Miles Phannaceuticals West Haven), imipenem (Merck Sharp & Dohme) 의표 준분말을사용하였으며 NCCLS 방법 (NCCLS 2,α)()) 에의하였다. 항균제를규정된용제로녹이 Table 1. Oligonucleotide sequences of primers used for detection of the meca gene from S. aureus Oligonucleotide sequence Gene Orientation Primer (5-3 ) k R s g Pi 때빼) m meca -4 meca-l - meca-2 ATGAGATTAGGCATCGTTTC TGGATGACAGTACCTGAGCC

4 고 Mueller-돼nton한천배지에 μ gjml농도로 m. 결 과 만들었다. 시험세균을 TSA배지에 35 0 C 하룻밤배양후 2000년 12월사이에전북지역 W대학병원 24 tryptic soy broth (TSB, Difco) 에부유하여탁도를 명의 ICU환자기관후두에서 MRSA균주의보균 McFarland의 제 0.5 관탁도에맞추고이어서식 율이 16주 (66.7%) 로가장많았고, PCR에 의한 염수로 1/10로희석하였다. 시험세균의 접종을 meca 유전자로 확인되었으며, 다음은 IR A. 위해서는 inoculator를이용하였다. 접종된평판 baumannii균주로 6주 (25%) 이었으며, 그외는대 은 35 oc 에 24시간배양한후결과를판독하였 부분이 장내세균으로 2-4주 ( %) 가분리 다. 세균의증식을완전히억제시킨최소의항균 되었다 (Table 2, Fig. 1). 제 농도를 최소억제농도 (minimum inhibitory Imipenem-susceptible (IS) A. baumannii에 대한 concentration, MIC) 로하되 1 개의집락이생긴것 imipenem의 MIC범위는드 1-4 μ압ml 이었고 MIC5Q 은무시하였다. 항균제감수성의정도관리를위 과 MIC90은각각드 1 μgjml, 4 μ밍ml 이었으며, IR 해서 S. aureus ATCC 25923와 E. coli ATCC A. baumannii균주에대해서 MIC범위는 μg 25922를동시에시험하였다. MIC해석을위해서 /ml 이었고, MIC50과 MIC90은각각 16 μgjml, 64 는 NCCLS (2α)()) 에의해규정된 breakpoint를적용하였다. μgjml 이었다 (Table 3, Fig. 2). Table 2. Isolation rate of imipenem-resistant Acinetobacter baumannii, MRSA and gram-negative bacilli from translaryngeal aspiration in patients in intensive care unit Gram-negative bacilli Species Imipenem-resistant Acinetobacter baumannii Citrobacter freundii Enterobacter aerogenes Enterobacter sakazakii Escherichia coli Klebsiella pneumoniae Strains isolated from lcu pt s No. (n = 24)" % Pseudomonαs FJ pu m m.찌때1n pu aeruginosa -- 鋼m mi In qu 따 Methicillin-resistant S'taphylococcus aureus ano. of specim 뻐 s cultured 68

M 2 3 4 5 6 7 8 9 10 11 554 bp ~ Fig. 2. Agarose gel electrophoresis of the PCR products against S. aureus isolated from ICU patients.

5 M bp ~ Fig. 2. Agarose gel electrophoresis of the PCR products against S. aureus isolated from ICU patients. Lane M, a 100 bp size marker; lane 1-9, MRSA strains; lane 10 뻐d 11, S. aureus ATCC and -negative control (without bacteria). Table 3. Antimicrobial susceptibi1ity of imipenem against imipenem-susceptible and -resistant A. baumannii by agar dilution test. Organisms No. (cumulative %) of isolates inhibited at (μgjml) (No. tested) 드 ISAB* (n=46) 54 (26) 63 (4) 100 (1 8) IRAB / n l (n=6) (3) (2), *ISAB, Imipenem-susceptible A. baumannii; IRAB, Imipenem-resistant A. baumannii **No. of is이ates tested =EB80 그월)1뭘 s S F I i (Z.) 얻@ --E그iQ월 i Fig. 3. In vitro activities of imipenem against imipenem-susceptible and resistant A. baumannii by agar dilution test 69

6 IR A. baumannii 에낮은 MIC를보인항균제는 Acinetobacter균속은 Bergey manual (1 986) 에 ciprofloxacin으로 MIC범위는드 μ예ml, MIC5Q Family Nesseriaceae에속하였으나최근에 Mora- 와 MIC90는각각르 1 μ밍ml와 64 μ앙 'm1이었고 xellaceae로변경되었다 (Rossau et a1., 1991). cefotaxime 과 ceftazidime 의 MIC90는각각 2: 128 Acinetobacter는여러가지이명을가지고있으며, μ와m1이었다. 한편 IS A. baumannii에역시낮은 glucose를산화하는 A. anitratus와산화하지않는 MIC를보인항균제는 ciprofloxacin으로 MIC범위 A. 1011핸 i로구별했으나, DNA-DNA 하이브라드는 μ앙m1' MIC50와 MIC90는각각드 1 μgjm1 형성 (hybridization) 에의해서 DNA 상동성군과 64 μ씹m1이었고, cefotaxime의 MIC50와 MICw (homology group) 즉유전적균종 (genomospecies) 은각각 64 μgjm1, 는 128 μgjm1이었고, ceftazidime 으로 21 가지를분류하였고, 생화학적시험과증의 MIC 50와 MIC 90는모두는 128 μ예m1이었다. 내식시험으로 16가지로구별하였다 ( Schreckenber 성기준 (breakpoint) 을적용하여내성균주의비율 and Graevenitz, 1999). 임상검체에서구별이까다을비교하면 IR A. baumannii균주에서 ciprofloxa- 로운 genomospecies 1, 2, 3 및 13은 Acinetobacter cin 이 50%, cefotaxime과 ceftazidime은모두내성을보인반면 IS A. baumannii균주에서 ciprofloxacin 이 65%, cefotaxime은 91 %, ceftazidime은 100% 내성을보여 IR A. baumannii균주가 IS A. baumannii보다내성이다소높았다 (Table 4). N. 고찰및결론 calcoaceticus-acinetobacter baumannii complex라고칭하고있으며현재명명되어있는 Acinetobacter 균종은 A calcoaceticus, A baumannii, A haemolyticus, A. junii, A. johnsonii, A. lwoffii, A. radioresistens 의 7종으로알려지고있다. 그동안사용되었던 A. anitratus는 A. calcoaceticus (41 oc 음성 ), A. baumannii (44 oc, 양성 ) 및 genomospecies 3 (41 Table 4. In vitro activities of six antimicrobial agents against imipenem-resistant and susceptible Acinetobacter baumannii isolates from clinical specimens Organism MIC (μ앙ml)" MIC (μ밍ml) and antimicrobial brealφoint of agents Range 50% 90% resistant isolatesa Imipenem-resistant A. baumannii (n = 6)b % reslstant Cefotaxime 128- 는 는 128 는 64 1ω Ceftazidime 는 128 는 128 ::::: 128 는 Ciprofloxacin 드 드 1 64 는 4 50 lmipenem-susceptible A. baumannii (n = 43) Ce 하 fo 아 Itax 차 ime 8- 는 는 128 는 Ceftazidime ::::: 128 늘 128 늘 128 는 Ciprofloxacin 1- 는 는 4 65 a50% and 90%, MICs at which 50% and 90% of strains are inhibited, respectively. 'No. of strains tested 70

양성, 44 0 C 음성 ) 으로, A. lwoffii 는동일하게그 리고용혈성 Acinetobacter 는 A. haemolyticus (glucose 양성및음성 ) 와 genornospecies 6, 13-17 역시 ICU 환자의보균균주로써는 MRSA 균주가 가장많은것에는변함이없음을알수있었고, IR A. baumannii.

7 양성, 44 0 C 음성 ) 으로, A. lwoffii 는동일하게그 리고용혈성 Acinetobacter 는 A. haemolyticus (glucose 양성및음성 ) 와 genornospecies 6, 역시 ICU 환자의보균균주로써는 MRSA 균주가 가장많은것에는변함이없음을알수있었고, IR A. baumannii. 균주역시본연구에서 25% 로 으로현재분류되고있다. Acinetobacter 균종들가 스페인과송등이보고한것보다현저히높아 운데 Acinetobacter calcoaceticlα -Acinetobacter 이 세균에의한 ICU 환자의보균율이적지않음 baumannii cornplex 에속하는균주가가장많이인처1 감염을일으키는균종이며, 그중 A. baumannii가원내감염의가장흔한원인균으로알려지고있다. 일반적으로 Acinetobacter 는- 성상인에게는비병원성이나면역이약한사란이 1 가 1 감염증을열으킬수있으며, 특히 ICU환자의소화관이병원감염에중요하고, 다약제내성 A. baumannii감염에대한역학적보균소라고하였 을알수있었다. Takahashi et al., (2000) 은 irnipenern (lpm) 과 caftazidirne (CAZ) 과같은다른여러 ß -lactarn항균제에내성균주를보고하였다. IPM은대부분이더 -lactarnase 에의해서가수분해되므로내성을보이는더 -lactarn 계열항균제이다. 최근에는 IMP와 CAZ에내성을보이는 A. baumannii. (IPM and CAZ-resistant A. baumannii.) 균주가보고되고있는데이것은 carbapenernase 다 (Corbella et al., 1996). 병원감염은기도 ( 내기관 즉 class B 분자에속하는 rnetallo- 서 -lactarnase 에 튜브나기관절개술환자 ) 로인한것이가장많고 의한것으로우리나라에서논 1 예가보고되었다 그외에요로및창상을통해서패혈증으로진 ( 이, 200 1). A. baumannii. 균주에대해서스페인에 행할수도있다고하였다 (Bergo 맹 e and Towner, 서 Bou 와 Beltran (2000) 에의하면 IMP 는 128 μg 1996). Corbella et al., (2000) 은스페인에서 1836 명의 ICU 환자로부터 carbapenern-resistant (CR) A. baumannii. 균주가 8% 라고하였고 (Corbella et al., Irnl, CAZ는 >256 μgfrnl 의 MIC 를, 이태리의 Riccio et al., (2000) 은각각 >64 μgfrnl를보고하 였다. 저자들은 IR A. baumannii. 균주에대해서 2α)()), 송등 (1998) 은우라나라일부지방대학 MIC 범위가 IMP 에 μ 앙 rnl, CAZ 에는 128μg 병원의입원환자중 년까지는 IR A. Irnl 이었으나 ciprofloxacin 에는 드 μ 에 rnl 로 baumannii. 균주가분리되지 않았으나 1996 년과 내성 breakpoint 를적용시 cefotaxirne 과 CAZ 에는 1997 년에입원환자에서분리된 A. baumannii. 균 모두가 ciprofloxacin 에는 50% 의 내성율을보인 주중각각 9.2%, 4.4% 가 IR A. baumannii. 균주라 반면 IS A. baumannii. 균주는 ciprofloxacin 에 65%, 고하였다. 한편 MRSA 는여러나라에서 ICU 환자 cefotaxirne 에 91% 그리고 ceftazidirne 에는모두 로부터 0-81 % ( 평균 60%) 까지보균율이알려지고있다.ICU감염에대한병원균은 1960년대와 1970년대에그람음성균가운데장내세균과 P aeruginosa 가현저하였고, 1990년대에는 S. aureus 와 coagulase-negative staphylococci 및 enterococci 가포함된그람양성구균이증가하였으며, 2000 년대에는항균제에내성이많은뼈SA, vancornycinresistant enterococci(vre), rnultiple-drug resistant (MDR) Pseudomonas와 Acinetobacter 등이증가추세라고하였다 (Ibelings and Bruining, 1998). 본연구에서는 ICU환자에서 MRSA(mecA 유전자양성 ) 가 66.7% 로여러나라평균 60% 보다많아서 내성으로 IR A. baumannii. 균주에비하여내성율이낮음을알수있었으며, 암으로 IMP 내성 A. baumannii. 균주에의한감염시치료가까다롭기때문에이세균에의한감염치료대책과병원감염의전파억제대책이더욱필요하겠다. 칩고문흰 l. Afzal-Shah, M., and Liverrnore DM. Worldwide ernergence of carbapenirn-resistant Acinetobacter spp. Antimicrob J Chemother 41: , Bergogne-Berezin, E., and Towner KJ. Acineto- 71

8 bacter spp. as nosocomial pathogens: microbiological, clinical, and epidemiological features. Clin Microbiol Rev , Bergogne-Bereziα E., and Joly-Guillou ML. Hospita1 infection with Acinetobacter spp.: an increasing problem. J Hosp l빼 ct 18(Suppl. A): , Bergogne-Bere깅n E and Towner KJ. Acinetobacter spp. as nosocomial pathogens: microbi외, clinical and epidemiological features. Clin Microbiol Rev 9: , Bou, G., Cervero G, Dominguez MA, Quereda C, and Martinez-Beltran 1. Characterization of a nosocomial outbreak caused by a multiresis Acinetobacter baumannii strain with a carbapenem-hydrolyzing enzyme: high-level carbapenem resistance in A. baumannii is not due solely to the presence of 더 -lactamases. J Clin Microbiol 38: , 2αm 6. Brown, S., Bantar C, Young HK, and Amyes SGB. Limitation of Acinetobacter baumannii treatment by plasmid-mediated carba야 nemase ARI 2. Lμncet 351: , Bouvet PJM and Grimont PAD: Taxonomy of the genus Acinetobacter with the recognition of Acinetobacter baumannii sp. nov., Acinetobacter haemolyticus sp. nov., Acinetobacter johnsonii sp. nov., Acinetobacter junii sp. nov., and emended descriptions of Acinetobacter calcoacetecus and Acinetobacter lwoffii. Int J Syst Bacteriol 36: , Cisneros JM, Reyes MJ, Pachon J, Beceπil B, Caballero FJ, Garcia-Garmendia JL, Ortiz C, and Cobacho F. Bacteremia due to Acinetobacter baumannii: epidemiology, clinical findings, and prognostic features. Clin Ii빼 ct Dis 22: , Corbella XM, Pujol M, Ayats J, Sebdra M, Ardanuy C, Dominguez MA, Linares J, Ariza J, Gudiol F. Relevance of digestive tract colonization in the epidemiology of nosocomial infections due to multiresistant A. baumannii. Clin l뺑 ct Dis 23: , Corbella X, Montero A, Pujol M, Dominguez A, Ayats J, Argerich MJ, Garrigosa F, Ariza J, Gudiol F. Emergence and rapid spread of carbapenem resistance during a 1따ge and sustained hospital outbreak of multiresistant Acinetobacter baumannii. J Clin Microbiol 38: , 2αm 11. Crombach, WHJ, Dijkshoom L, van Noort Klaassen M, Niessen J, and van Knippenberg Gordebeke G. Control of an epidemic spread of a multi-resistant strain of Acinetobacter calcoaceticus in a hospital. Intensive Care Med 15: , Da Silva, GJ, Leitao GJ, and Peixe L. Emergence of carbapenem-hydrolyzing enzymes in Acinetobacter baumannii clinical isolates. J Clin Microbiol , Go, E. S., Urban C, Burns J, Kreiswirth B, Eisner W, M따iano N, Mosinka-Snip없 K, and Rahal J1. Clinical and molecular epidimiology of Acinetobacter infections sensitive only to polymyxin B and sulbactam. Lancet 344: , lbelings MMS, Bruining HA. Methicillinresistant Staphylococcus aureus: Acquisition and risk of death in patients in the intensive care unit. Eur J Surg 164: , Leonov S, Karpuch J, Bourvin A, Shemesh Y and Lewison G: Ciprofloxacin in the treatment of nosocomial mu1tiply resistant Acinetobacter calcoacetic따 Bacteremia. l뼈 ct 42: , Lambert TG, Gerbaud G, Bouvet P, Vieu JF, and Courvalin P. Dissemination of amikacin resistance gene apha6 in Acinetobacter spp. An- 72

9 timicrob Agents Chemother 34: , Murray PR, Baron EJ, Pfaller MA, Tenover FC and Y olken RH: Manual of clinical microbiology. 6th ed. American society for microbiology, Washington, D.C., pp , National Committee for Clinical Laboratoη Stan, 없rds (NCCLS) 1993 Performance Standards for antimicrobial Disk Susceptibility Tests. Approved standard M2-A5. National Committee and ginotypic methαls. J Clin Microbiol 32: , Urban, c., Go E, M 따 iano N, Berger BJ, Avraham E, Rubin D, and Rahal JJ. Effcet of sulbactam on infections ca 뻐 ed by imipenemresistant Acinetobacter calcoaceticus biotype anitratus. J 1, 빼 ct Dis 167: , Vila J, Navis, Ruiz J, and Casal C. Cloning and nucleotide sequence analysis of a gine for Clinical Laboratoη Standa 5rds, Villanova, Pa. enconding a OXA-derived 더 -lactamase in A. 19. Paton R, Miles RS, Hood J, Amyes SGB. ARI-l: 서 -lactamase-mediated imipenem resistance in Acinetobacter baumannii. Int J Antimicrobial Agents 2: 81-88, Quinn JP. Clinical problems posed by mu1tiresistant nonfermenting Gram-negative pathogens. Clin Infect Dis 27(Suppl. 1): S117-S124, Rossau RA, Landschoot A V, Gillis M, deley 1. baumannii. Antimicrob. Agents Chemother. 41: , Vila J, Ruiz J, Navia M, Becerril, Garcia 1, Perea S, Lopez-Hernandez, Alamo 1, Ballester F, Planes SM, M따tinez-Beltran J, and Jimenez de Anta MT. Spread of amikacin resistance in A. baumannii strains isolated in Spain due to an epidemic strain. J Clin Microbiol 37: , Taxonomy of Moraxellaceae fam. nov., a new 1999 bacterial family to accommodate the genera Moraxella, Acinetobacter, and Psychrobacter and related organisms. Int J Syst Bacteriol 41: , Sato K and N때ae T: Outer membrane permeability of Acinetobacter calcoaceticus and its implication in antibiotic resistance. J Antimicrob Chimother 28: 35-45, Schreckenber PC and von Graevenitz A. Acinetobacter, Achrobactewr, Alcaligenes, Moraxella, Methylobacter, and other nonfermentative gramnegative rods, p In Murray PR, Baron EJ, Pfaller MA, Tenover FC, Yolken RH (ed). Manual of clinical microbiology, 7th ed. Am Soc Microbiol Washington DC, Tankovic J, Legrand P, de Gatines G, Chemineau V, Brun-Buisson C, and Duval 1. Characterization of a gospital outbreak of imipenemresistant Acinetobacter baumannii by phenotypic 28. 김선무, 송남경, 신상희, 정재옥, 이규식, 김유현, 오재세, 차정단, 문상은, 김강주, 심은숙, 김은철, 성치남, 정윤섭. 건강인의비강내 MRSA보균율과 methicillin 내성포도구균에서 meca와 fema유전자의검출. 임상병리검사과학회지 31: , 이경원. Carbapenem 내성그람음성간균. 대한임상미생물학회지 4: SI4-S22, 이혜경, 이은정, 박연중, 김병기, 강문원, 심상인 : 포도구균의메티실린내성정도와내성관련유전자 meca, meci, mecrl, fema와의연관성. 감염 30: 36-44, 송호연, 조성란, 김휘준, 고강균. 임상검체에서분리된 Acinetobacter의항균제내성 ( ). 대한화학요법학회지 16: 85-95, 조동택, 이제철, 김정민, 선행섭, 장희경, 안 수열. Acinetobacter calcoaceticus-acinetobacter baumannii복합군의 ribotyping 에의한동정. 대한미생물학회 33: ,

Microsoft PowerPoint - PDFCoTemp.PPT

Microsoft PowerPoint - PDFCoTemp.PPT 주요유방염세균의검출및 항생제감수성검사 임숙경 1. 검사시료 1. 시료채취 유방염우유 2. 체세포수측정 3. 대상세균 - Staphylococcus aureus - Coagulase negative staphylococci -Escherichia coli 3. 균분리방법 E. coli CHEC Agar 직접도말 (37 18-24h) 보라색집락 EMB Agar