<C4A1C1D6B0FAC7D0C8B8C1F628312D37292E687770>
|
|
- 서헉 유
- 5 years ago
- Views:
Transcription
1 대한치주과학회지 28; 38: 314 정은경, 이종철, 서정윤, 김성윤, 김완수, 윤우혁, 김윤상, 피성희, 유형근, 신형식 * 1) 원광대학교치과대학치주과학교실 Inhibitory effects of Enterococcus faecium isolated from Korean infants on oral pathogens Jeong EunGyeong, Lee JongCheol, Seo JungYoon, Kim SeongYoon, Kim WanSu,Yun WooHyuk, Kim YunSang, Pi SungHee,You HyungKeun, Shin HyungShik epartment of Periodontology, School of entistry, Wonkwang University ABSTRACT Purpose: The probiotic effects of lactic acid bacteria have widely been researched in diverse human pathogens, but only a few effects are reported against oral pathogens. The antimicrobial effects of the Enterococcus faecium 7413 isolated from Korean infants on the 9 pathogen including 6 oral streptococci were investigated the clinical use of the antimicrobial peptide for oral microflora control. Materials and Methods: E. faecium 7413 was identified by morphological, biochemical tests and 16S rna sequence analysis. Inhibitory effects of culture supernatants were determined for their ability to grow on agar plate containing pathogenic bacteria. Result: The culture supernatant of Enterococcus faecium 7413 showed inhibitory effects on oral pathogens, namely Streptococcus pyogenes KCTC 3556, S. pneumoniae KCTC 58, S. mutans ATCC 25175, S. anginosus ATCC 33397, S. constellatus KCTC 3268, S. intermedius ATCC and Shigella flexneri KCTC 28. Whereas it did not affect the multiplication of E. coli strains, KCTC 141 and ATCC Conclusion: The data obtained in this study could be useful for future development of effective probiotics allowing prevention for oral pathogens. (J Korean Acad Periodontol 28;38:314) KEY WRS: Enterococcus faecium; infant; oral pathogens. 서론 사람의구강내에존재하는많은종류의세균들은대부분정상세균총으로서병원성세균이발육을억제할뿐만아니라숙주의면역계의형성과선천면역반응을유도하는데중요한역할을한다. 그러나이러한정상세균도구강환경의생태적인변화가일어나거나숙주의방어기전이약해지면급속히증식하여치아우식증과치주질환을비롯한치수및치근단감염, 구강 Correspondence: r. Shin HyungShik epartment of Periodontology, School of entistry, Wonkwang University, 3442 Sinyongong, Iksan City, Jeollabukdo, South Korea, periohs@wonkwang.ac.kr, Tel: , Fax: * 본연구는 27 년도원광대학교의교비지원에의한연구임. 접수일 : 28 년 1 월 16 일 ; 채택일 : 28 년 2 월 29 일 안면조직또는악골감염등구강내질환을일으킨다. 최근에는이들구강미생물들의심혈관질환과당뇨병과같은전신질환에대한밀접한연관성에대한보고가증가하고있다 12). 유산균 (lactic acid bacteria) 은자연계에널리존재하며탄수화물을이용하여유산을생산하는미생물들의총칭이다. 발효식품등을통하여섭취된유산균은장내로유입된후장내상피세포에착생하게되어병원성미생물의저해및길항작용, 면역활성의증진, 암발생률의감소, 그리고아토피피부염의감소등인체에많은도움을준다. 따라서유산균은동서양을막론하고유제품, 육제품, 침채류및각종젓갈류의가공에유용한보조수단뿐만아니라생균제 (probiotics) 로도이용되고있다 35). 생균제는 or life 를의미하는그리스어에서유래하였으 31
2 정은경, 이종철, 서정윤, 김성윤 대한치주과학회지 28 년 38 권 1 호 며, 항생제 (antibiotics) 의 against life 와는반대의미를가진다. 198 년발효된유제품을먹는불가리아농부들의수명이긴것을관찰한러시아과학자 Metchnikoff에의하여처음으로그개념이도입되었다. Stillwell과 Lilly는생균제란용어를처음사용하였으며, Parker는생균제의개념을 숙주장내세균의억제를통하여숙주에게유익한영향을주는물질 이라고정의하였다 6). 가장대표적인생균제는유산균으로 Lactobacillus 와 Streptococcus 가가장많이이용된다. Lactobacillus 종으로는 L. acidophillus, L. bulgaricus, L. plantarum, L. casei, Streptococcus 종으로는 S. faecium, S. thermophilus, S. diacetilactus 가주요균종으로, 최근에 Streptococcus 에속하는유산균은 Enterococcus 라고명명되었다 7). 생균제의병원균에대한항균작용과관련된연구는 Salmonella typhimurium, Salmonella enterititis, Listeria monocytogenes. Pseudomonas aeruginosa, Clostridium difficile, 그리고 Helicobacter pylori 등과같은세균들을대상으로하여수행되었다. 여러구강미생물중 S. mutans 는세포의다당류를생성하는 glucosyltransferase 에의해비수용성 glucan 을형성하여균체가치아표면에부착하도록하고치태형성및치아우식증을유발한다. S. anginosus, S. constellatus 및 S. intermedius 는유전학적으로동일군에속하며호흡기감염증과세균성심내막염의주요원인체이다 8). 이균들은현재에는두경부암과의밀접한연관성때문에임상적중요성이크게증가하고있다 9,1). S. pyogenes는인두염, 성홍열, 피부깊숙이감염되어발생하는연쇄구균성화농증및대중매체에서 살파먹는박테리아감염증 으로알려진괴사성근막염등과속발질환으로류머티즘열과사구체신염 등매우다양한질병을일으킨다. S. pneumoniae 는호흡기를통하거나맥관계통에의해서확산되며신체의다른부위로이동하여폐렴, 이하선염, 결막염, 복막염, 중이염, 심내막염및패혈증등과증상을일으킨다 11). 구강내병원균으로는 S. mutans 12) 와 S. salivarius1 3) 를대상으로수행된바있으나전신질환을일으키는다양한구강병원균을대상으로수행된연구는국내 외적으로찾아보기어렵다. 미생물의동정에는주로배양법, 효소면역법및생화학적검사등의방법으로수행되어왔으나, 현재에는환경적요인에의해서거의영향을받지않는데이터를제공하고또한신속한동정이가능하며유전형질의진화적개념을도입한 16S rna 분석법이널리사용되고있다 14). 이연구에서는한국영아로부터분리한유산균을대상으로구강내병원균과아울러설사를일으키는장내병원균에대한항균효과를조사하여생균제로의이용가능성을조사하고자하였다. 재료및방법 1. 유산균의분리건강한영아의분변 1 g씩을채취하여멸균 Phosphate buffered saline(pbs) 로 1 6 ~1 7 cfu/ ml수준까지십진희석하고 MRS 평판배지 (ifco, etroit, MI, U.S.A.) 에.1 ml씩을도말한후 37 5% C 2 배양기에서 36 시간동안배양하였다. 유산균과유사한집락은 BCP 평판배지 (ifco) 에다시계대배양하여순수집락들을선발하였다. 배양배지의조성은 Table 1과같다. Table 1. Primers Used in PCR Amplification and Sequencing of 16S rna Primer Sequences (5' 3') Size Binding site Usage 5' 3' PCR Seq. 27f AGAGTTTGATCMTGGCTCAAG MG2f GAACGGGTGAGTAACACGT MG3f CTACGGGRSGCAGCAG MG4f AATTCCTGGTGTAGCGGT MG5f AAACTCAAAGGAATTGACGG MG6f GAACGTCAAGTCATCATGCC r AAGGAGGTGWTCCARCC
3 J Korean Acad Periodontol 28; 38(1) 2. 분리균의생리화학적검사분리한유산균들의기초동정을목적으로성상검사와생리화학적검사를실시하였다. 균체를그람염색한후 API 5 CHL Carbohydrate test kit(biomerieux Co., France) 를이용하여생리화학적실험을수행하였다. MRS 평판배지에서성장한균체를 5 ml의용해배지에용해하여 Mcfarland standard 2로균수를맞춘후 API 5 CHL medium 에접종하였다. 접종후 strip에 mineral oil로채운후 37 에서 48시간배양한후 API LAB plus software(biomerieux) 로판정하였다 S rna 분석을이용한분리균의동정분리한유산균주들의최종동정을목적으로 16S rna 분석을실시하였다. (1) Genomic NA 분리 Genomic NA 의분리는 Ausubel 등의방법에준하여실시하였다. 3 ml의 nutrient broth(ifco) 에서배양한분리균주를 1.5 ml tube 로옮기고 15, rpm 에서 2분간원침하여균체를침전시켰다. 침전된균체는 1 μl의 TE buffer(ph 8.) 를가하여잘용해하고 2 μl의 1% sodium dodecyl sulfate 와 1 μl의 proteinase K(1 mg/ ml ) 을가하여 5 에서 1시간반응시켰다. 반응균체는 2 μl의 1% cetyltrimethylammonium bromide/.7 M NaCl 용액을가하여잘혼합한후다시 65 에서 1 분간반응하고여기에동량의 chloroform/isoamylalcohol(24:1) 용액을가하여 5분간진탕한다음 4 에서 5분간원침한후상층액만새로운 tube 로옮겼다. 여기에 1/1 배의 3 M sodium acetate와 2배의 1% ethanol 을가하여 genomic NA 를침전시켰다. 침전된 genomic NA 는 7% ethanol로세척한다음, 5 μl의 TE 완충액에용해하고 RNase를최종농도가 2 μg / ml되도록가하고 42 에서 3 분간반응하여 RNA를제거하였다. 정제한 NA 는 spectrophotometer(model MBA 2, PerkinElmer, Norwalk, CN, USA) 를사용하여 26 nm 에서정량하고 2 에보존하면서실험에사용하였다. (2) Primers 분리유산균주들의 16S rna 증폭및염기서열결정을 위한 primer 들은 Lane의 E. coli 16S rna 에대한보고를기초로하여제작하였다. 염기서열은 Table 1과같다. 각 primers 들은 ( 주 ) 제노텍에주문하여 2 pm scale 로합성하였다. 합성한 primer 는멸균증류수로 PCR 용은 29 μm, sequencing 용은 1.6 pm μl 1 으로희석하고 2 에보관하면서실험에사용하였다. (3) 16S rna 증폭추출한 genomic NA 1 μl (5~1 ng) 에 1X Taq buffer 1 μl, 2.5 mm dntps 8 μl, 1.25 mm MgCl 2 1 μl,.w. 59 μl, 1 μm 27f primer 1 μl, 1 μm 1525r primer 1 μl및 Taq polymerase(roches) 를.5 μl를가하여 NA thermal cycler(model 48, Perkin Elmer, Norwalk, CT, USA) 에서 94 2분, 55 1분, 72 2분간의반응을 3 회반복한후 72 에서 1 분간반응하여 16S rna 를증폭하였다. 증폭한 16S rna 는 1.% LE agarose gel(fmc Bioproducts, Rockland, ME, USA) 에서 1X TAE buffer(45 mm Trisacetate, ph 8.3, 1. mm ETA), 1 V로 2 분간전기영동한후 ethidium bromide(1 mg/ml) 로 1 분간염색하고 Gel oc 2 system(biorad, Hercules, CA, USA) 을이용하여증폭유무와크기를관찰하였다. (4) 염기서열분석분리유산균들로부터증폭된 16S rna 는 Bigye Terminatior Cycle Sequencing Kit(Applied Biosystems, Foster City, CA, USA) 와 ABI PRISM 31 Genetic Analyzer(Applied Biosystems) 를이용하여염기서열을분석하였다. 분석한 16S rna 염기서열은미국 National Center for Biotechnology Information의 BLAST server( 를이용하여검색한후 GenBank 에등재된근연세균들의 16S rna 유전자염기서열들과 Clustal_X (1.7) 프로그램을이용하여다중정렬하고유사성행렬을구하였다 15). 계통도 (phylognetic trees) 의작성은 PHYLIP package 를이용하였으며 neighbourjoining 알고리즘을이용하여추론하였다. 진화적거리는 Jukes와 Cantor 의 neighbourjoining 방법을이용하여계산하였으며 unrooted tree 위상은 PHYLIP package 의 SEQBT 와 CNSENSE 프로그램을이용하여 1, 회 resampling 으로 bootstrap 분석을수행하였다. 33
4 정은경, 이종철, 서정윤, 김성윤 대한치주과학회지 28 년 38 권 1 호 Table 2. The List of Pathogens Used in This Study No. Indicator organism Related disease S. pyogenes KCTC 3556 S. pneumoniae KCTC 58 S. mutans ATCC S. anginosus ATCC S. constellatus KCTC 3268 S. intermedius ATCC E. coli KCTC 141 E. coli 157 H7 ATCC Shigella flexneri KCTC 28 pharyngitis, pyogenic disease pneumonia dental caries periodontitis, endocarditis periodontitis, endocarditis periodontitis, endocarditis diarrhea bleeding diarrhea dysentery * KCTC: Korean Collection for Type Cultures (Taejon, Korea), ATCC: American Type Culture Collection (Manassas, VA, U.S.A.). ** BHI (Brain Heart Infusion), LB (Luria Bertani Broth). 4. 병원균에대한항균활성시험분리한여러유산균중 7413 균주의배양액으로부터주요구강및장내병원성세균들에대한항균활성을측정하였다. 사용균주로는국내유전자은행인 KCTC 와미국의 ATCC 로부터분양받은 S. pyogenes KCTC 3556, S. pneumoniae KCTC 58, S. mutans ATCC 25175, S. anginosus ATCC 33397, S. constellatus KCTC 3268, S. intermidius ATCC 27823, E. coli KCTC 141, E. coli 157 H7 ATCC 및 Shigella flexneri KCTC 28 등다양한구강질환을일으키는연쇄구균들과설사를주증상으로하는장내병원성세균들을사용하였다 (Table 2). S. pyogenes KCTC 3556, S. pneumoniae KCTC 58, S. mutans ATCC 25175, S. anginosus ATCC 33397, S. constellatus KCTC 3268 및 S. intermedius ATCC 27823의경우 Brain Heart Infusion (BHI, ifco) 배지, E. coli KCTC 141, E. coli 157 H7 ATCC 및 Shigella flexneri KCTC 28 의경우 Luria Bertani Broth(LB, ifco) 를사용하여배양하였다. 시험방법으로는먼저시험균주의단일집락을 1 ml의 MRS 액체배지 (ifco) 가들어있는 2 ml플라스크에접종하여 37 에서교반하면서배양하였다. 시료는 1일에서 4일까지 24시간단위로채취하였으며 12xg 에서 1 분간원침한후상청액은배양액으로, 균체추출물은원침균체를 1 ml PBS에희석한후 sonication 하여사용하였다. 실험방법은 agar diffusion assay 를이용하여억제활성을측정하였다 17). 각병원균배양액을 1 ml의영양배지가들어있는 2 ml플라스크에초기.. =.1로접종하여 7시간동안배양하여총균수가 이되도록조절한다음 6 의굳지않은 nutrient agar(ifco) 13 ml와함께 1 mm Petri dish 에부은후잘굳혔다. 그다음 56 배양기에서 24시간동안건조시켜완전히습기를제거한 1 mm 페이퍼디스크 (Toyo Roshi Kaisha, Ltd, Japan) 를 plate 위에올려놓은다음각각의디스크에시료 1 μl씩을주입하였다. Plate 는 37 배양기와 5% C 2 배양기에서 12 시간동안호기또는혐기배양한다음생성된세균의생육저지대즉, 투명환 (clear zone) 을확인하고 vernier calipers 를사용하여직경을측정하였다. 결과 1. 유산균 7413 의생리생화학적특성한국영아분변으로부터분리한여러유산균주중 7413으로명명한균주를선택하여생리생화학적특성을조사한결과 Table 3과같은성적을얻었다. 검사결과양성으로나타낸검사는 VP 반응,.4% NaN 3 에의저항성, Arginine hydrolysis, LArabinose 이었으며 Yellow pigment 생성, Methylaglucosid, Raffinose 시험은음성이었다. 반면 Gluconate, Mannitol, Melibiose, Sucrose, Xylose 시험은의양성으로유산균이지니는일반적인특성을지니고있었다. 34
5 J Korean Acad Periodontol 28; 38(1) Table 3. Characteristics of Bacteria 7413 Isolated from Infant Feces; Characteristics Are Scored as:, Positive;, Intermediate Characteristics Yellow pigment VP reaction Resistance to.4% NaN 3 Arginine hydrolysis Acid from: LArabinose Gluconate Mannitol Melibiose Methylaglucoside Raffinose Sucrose Xylose 2. 유산균 7413 의 16S rna 분석 Results 유산균 7413 의 16S rna 염기서열을미국 NCBI의 BLAST 를통해검색한결과분리균주 7413 은 Enterococcus 에속함을알수있었다. 따라서분리균주 7413의 16S rna 서열을 GenBank 에등재된 Enterococcus 종들의 16S rna 염기서열들과다중정렬하여유사성행렬을구하고계통도를작성한결과 16S rna 상동성의범위는 92.6~99.8% 로나타났다 (Fig. 1). 유산균 7413은 E. faecium 과 99.8% 의가장높은상동성을보여 E. faecium 으로최종동정하였다. 가장낮은상동성은 E. solitarius과의 92.6% 이었다. 3. 유산균 7413 의병원균에대한항균효과 실험결과유산균 7413은구강내치주염을일으키는균주인 S. pyogenes KCTC 3556, S. pneumoniae KCTC 58, S. mutans ATCC 25175, S. anginosus ATCC 33397, S. constellatus KCTC 3268 및 S. intermedius ATCC 에있어서항균효과가있음을확인할수있었다. 특히, 유산균주 7413 배양액의항균효과는치주염원인균인 S. anginosus ATCC 33397, S. constellatus KCTC 3268, S. intermedius ATCC 에대해탁월한것으로나타났으며, 그다음으로는치아우식균인 S. mutans ATCC 에대해항균활성이 높게나타났다. 인두염균인 S. pyogenes KCTC 3556과폐렴균인 S. pneumoniae KCTC 58 에서는미약한활성을보였다. 장내세균에서는분리균주 7413 배양액의항균활성은이질균인 Shigella flexneri KCTC 28 에서는비교적높게나타난반면 2종의대장균주인 E. coli KCTC 141 과 E. coli 157 H7 ATCC 43894에대해서는항균활성이없는것으로나타났다 (Table 4). Table 4. Antibacterial Effects of Lactic Acid Bacteria 7413 Supernatant against Pathogenic Bacteria No Indicator organism Results S. pyogenes KCTC 3556 S. pneumoniae KCTC 58 S. mutans ATCC S. anginosus ATCC S. constellatus KCTC 3268 S. intermedius ATCC E. coli KCTC 141 E. coli 157 H7 ATCC Shigella flexneri KCTC 28 * Characteristics are scored as:, strong positive (> 4 mm of inhibitory zone);, intermediate (25 to 4 of inhibitory zone);. weak positive (< 25 of inhibitory zone);, negative (no inhibitory zone). 4. 배양시간에따른유산균 7413 의병원균에대한항균활성 유산균 7413 을 1일부터 4일까지배양하면서 24 시간마다배양액을취하여병원균에대한억제활성을측정하였다. 실험결과시험균주모두에서경시적인억제효과의별차이는관찰되지않았다 (Fig. 2). 분리균주 7413 배양액은구강내치주염을유발하는균주인 S. anginosus ATCC 33397, S. constellatus KCTC 3268 및 S. intermedius ATCC 27823에대해서는 4일동안모두상당한억제활성을보였으며평균억제부위는 S. anginosus ATCC 33397는 42.45±.17 mm, S. constellatus KCTC 3268는 42.5±.39 mm, S. intermedius ATCC 27823는 42.25±.91 mm로나타났다. 그다음으로는 S. mutans ATCC 의 2.8±2.45 mm이었는데 1~3 일배양액들은 2 mm 내외의활성을보였으나 4일배양액에서 26.3 mm 으로활성이증가하였다. S. pyo 35
6 정은경, 이종철, 서정윤, 김성윤 대한치주과학회지 28 년 38 권 1 호 Lactic acid bacteria E. fa e c iu m (AJ276355) 99.8% 84 E. hirae (AF6111) 99.5% 98 E. m undtii (AF6113) 99.% E. villorum (AJ271329) 99.% E. g ilv u s (AY33814) 98.4% 94 E. m a lo d o ra tu s (AF6112) 98.4% E. avium (Y18274) 98.5% E. pseudoavium (AF612) 98.5% 83 E. p a lle n s (AY33815) 97.4% E. flavescensn (AJ31832) 97.7% 82 8 E. asini (Y11621) 97.2% E. dispar (AF617) 97.7% 82 1 E. colum bae (X56422) 94.3% E. cecorum (AF619) 94.4% 99 E. m oraviensis (AF286831) 96.4% 1 E. haem operoxidus (AF286832) 96.1% E. fa e c a lis (AB12212) 96.1% E. sulfureus (AF611) 96.1% E.saccharolyticus (A F ) %.1 E. s o lita riu s (AF611) 92.6% Figure 1. Phylogenetic tree based on 16S rna sequences of lactic acid bacteria 7413 and validly described strains of the genus Enterococcus. The tree was constructed by using the neighborjoining method. Scale bar represent 1 nucleotide substitution per 1 nucleotide. Figure 2. Inhibitory zone of lactic acid bacteria 7413 daily collected supernatant against pathogenic bacteria. 1: day 1, 2: day 2, 3: day 3, 4: day 4. 36
7 J Korean Acad Periodontol 28; 38(1) Table 5. Clear Zone of Lactic Acid Bacteria 7413 Supernatants against Pathogenic Bacteria No. Indicator organism iameter of inhibitory zone (mm) ay 1 ay 2 ay 3 ay S. pyogenes KCTC 3556 S. pneumoniae KCTC 58 S. mutans ATCC S. anginosus ATCC S. constellatus KCTC 3268 S. intermedius ATCC E. coli KCTC 141 E. coli 157 H7 ATCC S. flexneri KCTC genes KCTC 3556, S. pneumoniae KCTC 58 및 S. flexneri KCTC 28 은각각 2.9±.3 mm, 2.5±.26 mm, 21.3±.22 mm의활성을나타냈다 (Table 5). 고찰 생균제는 in vitro 또는 in vivo 에서많은병원균과부패균의성장을억제한다. 생균제미생물이병원균의성장을억제하는기전은장관내에서의한정된영양물질에대한경쟁, 생성된저급지방산, 항생물질및 H 2 2 등의작용등이다 16). 유산균은박테리오신 (bacteriocin) 이라는생리활성물질을생산하여여러부패성미생물및병원성미생물에대한생육억제작용을한다. 박테리오신은여러종의미생물이생산하는천연의항균성단백질또는단백질계의물질로서박테리오신을생산하는균주는면역에관계되는단백질을합성하여그것에의해사멸되지않지만형태와계통학적으로유사한균종에대하여살균기작을갖는물질을지칭한다 17). 항생제의경우사람에게투여시부작용이있다는단점이있으나박테리오신은단백질로이루어져있어인체에섭취되는즉시소화기관의단백질가수분해효소에의해분해됨으로써인체에무독성이고잔류성이없다는장점이있다. 박테리오신을생산하는미생물들은 Lactobacillus spp., Bifidobacterium spp. Streptococcus salivarius subsp. thermophilus, Lactococcus lactis subsp., lactis and cremoris, Enterococcus faecium, Pediococcus acidilactici, Leuconostoc mesenteroides subsp. dextranicum, Propionibacterium freudenreichii, Escherchia coli 그리고 Saccharomyces boulardii 등이있다 18). 구강내병원균의억제는치태, 치아우식, 구내염등의구강질환뿐아니라심혈관질환, 당뇨병과같은전신질환의예방및치료에매우중요하다. 구강내병원균억제후보물질개발은식물추출물, bakuchiol, propolis, 마늘등의천연물을대상으로연구들이수행되어항균물질의개발및효과등이보고되고있다. 항균물질의경우대부분이 terpenoid 계와페놀성화합물로알려져있으며, 이들은당또는단백질과결합할수있기때문에병원균에대한방어화합물로작용할수있다 19). 그러나생균제미생물을대상으로는극소수의연구만이수행되었다 2,21). 본연구에서는구강내병원균을억제하는생균제의개발을위하여당을분해하여유산을생산하는 Lactobacillus 를비롯한다양한유산균을분리하였다. 그러나진행성치아우식증의경우구강내에서 L. salivarius 등 Lactobacillus의수가증가하며 22), 이균은 S. sanguis, S. mutans 및 Actinomyces viscosus 등과공통항원을보유하고있으므로 23), 구강내병원균억제용생균제로서는 Lactobacillus 는적합지않다고판단하여 Enterococcus 로동정된분리균주 7413을구강내병원균을억제하는생균제후보균주로선정하였다. Stackbrandt와 Goebel 은세균의종에대하여 16S rna 상동성이 97% 이상이며 NANA reassociation values 가 7% 이상인균주의집단이라고정의 하였으며현재까지세균종의결정에있어서지표가되고있다 14). 본연구에서는영아로부터분리균주 7413 의생리화학적검사를실시한결과이균이유산균에속함을알수있었으며 BCP 평판배지에서노란색집락을형성하지않았으므로 Lactobacillus 가아닌것으로판 37
8 정은경, 이종철, 서정윤, 김성윤 대한치주과학회지 28 년 38 권 1 호 정하였다. 분리균주 7413 은 16S rna 염기서열을분석으로 E. faecium 으로최종동정하였다. Enterococcus 는사람과동물의장내에서식하는세균으로그람양성세균으로탄수화물을이용하여유산을생산한다. 특히 E. faecium 은유해세균의생장을억제하고장점막부착성이좋은것으로알려져있어사람과동물의설사예방제나정장제로사용되고있다 24,25). 본연구에서도분리균주 7413은구강내질환을유발하는 S. pyogenes KCTC 3556, S. pneumoniae KCTC 58, S. mutans ATCC 25175, S. anginosus ATCC 33397, S. constellatus KCTC 3268 및 S. intermedius ATCC 27823에있어서탁월한항균효과가있음을확인할수있었다. 장내세균에서는분리균주 7413 배양액의항균활성은이질균인 Shigella flexneri KCTC 28 에서는비교적높게나타난반면 2종의대장균주인 E. coli KCTC 141 와 E. coli 157 H7 ATCC 43894에대해서는항균활성이없어이균주가장관용보다구강용생균제로유용하게사용될수있음을시사하였다. 또한배양시간에따른억제활성에서 S. mutans ATCC 를제외한다른균주들에서는대수성장기부터사멸기까지큰차이를보이지않았다. 박테리오신은성장기이후정체기에그활력이감소하는데이것은균체가성장하면서생산하는단백질분해효소때문으로생각되나박테리오신이성장기전반에걸쳐서생성된다는보고도있다 26). 따라서본연구에서사용한분리균주 7413은단백질분해효소를생산하지않거나박테리오신이대수성장기부터일정하게생산되는것으로생각된다. E. faecium 은보편적으로안전한미생물로인식되고있으나최근에는 vancomycinresistant Enterococcus faecium (VREF) 의출현에대한보고도있어주목되고있다 27,28). 따라서앞으로이균주에대한 vancomycin 등항생제내성에대한추가연구와실제구강환경에서생균제로의기능에대한 in vivo 항균활성에대한연구가수행되어야한다고생각된다. 결론적으로, 이연구에서는구강생균제의개발을목적으로한국영아로부터유산균주를분리동정하여구강내병원균과장내병원균에대한항균효과를조사하였다. 1. 한국영아분변으로부터분리한유산균 7413 의생리생화학적특성은 VP 반응,.4% NaN 3 에의저항성, Arginine hydrolysis, LArabinose 은양성, Yellow pigment 생성, Methylaglucosid, Raffinose는음성이었다. 반면 Gluconate, Mannitol, Melibiose, Sucrose, Xylose 는의양성이었다. 2. 유산균 7413 은생리생화학적검사와 16S rna 분석으로 Enterococcus faecium로동정되었다. 3. 유산균 7413은구강병원균인 S. pyogenes KCTC 3984 T, S. pneumoniae KCTC 58, S. mutans ATCC 25175, S. anginosus ATCC 33397, S. constellatus KCTC 3268 및 S. intermedius ATCC 에는탁월한억제활성이있었다. 장내병원균인 Shigella flexneri KCTC 28 에대해서는억제활성이비교적높게나타난반면, 대장균 E. coli KCTC 141 과 E. coli 157 H7 ATCC 43894에대해서는억제활성이없었다. 4. 배양시간에따른항균활성시험결과유산균 7413 은 S. mutans ATCC 에대해서는 1일째배양액보다 4일째배양액에서억제활성이증가하였으나다른구강및장내병원균에대해서는차이를보이지않았다. 이상으로유산균 7413 은구강용생균제개발을위한후보균주로유용하게사용될수있을것으로생각되었다. 참고문헌 1. Williams RC, ffenbacher S. Periodontal medicine: the emergence of a new branch of periodontology. Periodontol 2;23: Beck J, ffenbacher S. The association between periodontal diseases and cardiovascular diseases: a stateofthe science review. Ann Periodontol 21;6: Guandalini S. Probiotics for children: use in diarrhea. J Clin Gastroenterol 26;4: Madsen K. Probiotics and the immune response. J Clin Gastroenterol 26;4: Shaw L. Effects of probiotics on atopic dermatitis. Arch is Child 26;91: Parker RB. Probiotics, the other half of the antibiotic story. Ani Nutr Health 1974;29: Ruoff KL. Recent taxonomic changes in the genus Enterococcus. Eur J Clin Microbiol Infect is 199;9(2): Shinzato T, Saito, A. The Streptococcus milleri group as a cause of pulmonary infections. Clin Infect is 1995;21:
9 J Korean Acad Periodontol 28; 38(1) 9. Shiga K, Tateda M, Saijo S et al. Takasaka T, Miyagi T. Presence of Streptococcus infection in extraoropharyngeal head and neck squamous cell carcinoma and its implication in carcinogenesis. ncol Rep 21;8: Tateda M, Shiga K, Saijo S et al. Streptococcus anginosus in head and neck squamous cell carcinoma: implication in carcinogenesis. Int J Mol Med 2;6: Whatmore AM, Efstratiou A, Pickerill AP et al. Genetic relationships between clinical isolates of Streptococcus pneumoniae, Streptococcus oralis, and Streptococcus mitis: characterization of Atypical pneumococci and organisms allied to S. mitis harboring S. pneumoniae virulence factorencoding genes. Infect Immun 2;68(3): Caglar E, Sandalli N, Twetman S, et al. Effect of yogurt with Bifidobacterium N173 1 on salivary mutans streptococci and lactobacilli in young adults. Acta dontol Scand 25; Zhou JS, Rutherfurd KJ, Gill HS. Inability of probiotic bacterial strains Lactobacillus rhamnosus HN1 and Bifidobacterium lactis HN19 to induce human platelet aggregation in vitro. J Food Prot 25; 68: Stackebrandt E, Goebel BM. A place for NANA reassociation and 16S rrna sequence analysis in the present species definition in bacteriology. Int J Syst Bacteriol 1994;44: Thompson J, Gibson TJ, Plewniak F et al. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tool. Nucleic Acid Res 1997;24: Schillinger U, Lucke FK. Antibacterial activity of Lactobacillus sake isolated from meat. Appl Environ Microbiol 1989;55: Konisky J. Colicins and other bacteriocins with established modes of action. Annu Rev Microbiol 1982;36: Tagg JR, ajani AS, Wannamaker LW. Bacteriocins of grampositive bacteria. Bacteriol Rev 1976;4: Lee H, Lee KH, Park NK et al. Antibacterial Effects of Sophora flavescens on Streptococcus mutans. The Korean Journal of Food And Nutrition 2;13: Chung J, Ha ES, Park HR, Kim S. Isolation and characterization of Lactobacillus species inhibiting the formation of Streptococcus mutans biofilm. ral Microbiol Immunol 24;19: Meurman JH. Probiotics: do they have a role in oral medicine and dentistry? Eur J ral Sci 25;113: Kohler B, Bjarnason S. Mutans streptococci, lactobacilli and caries prevalence in 11 and 12yearold Icelandic children. Community ent ral Epidemiol 1987;15: Aguilera Galaviz LA, Premoli G, Gonzalez A, Rodriguez RA. Caries risk in children: determined by levels of mutans streptococci and Lactobacillus. J Clin Pediatr ent 25; 29: Audisio MC, liver G, Apella MC. Effect of different complex carbon sources on growth and bacteriocin synthesis of Enterococcus faecium. Int J Food Microbiol 21;63: Benyacoub J, Perez PF, Rochat F et al. Enterococcus faecium SF68 enhances the immune response to Giardia intestinalis in mice. J Nutr 25;135: Joerger MC, Klaenhammer TR. Characterization and purification of helveticin J and evidence for a chromosomally determined bacteriocin produced by Lactobacillus helveticus 481. J Bacteriol 1986;167: Lund B, Edlund C, Barkholt L et al. Impact on human intestinal microflora of an Enterococcus faecium probiotic and vancomycin. Scand J Infect is 2;32: Lund B, Adamsson I, Edlund C. Gastrointestinal transit survival of an Enterococcus faecium probiotic strain administered with or without vancomycin. Int J Food Microbiol 22;77:
1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More information미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
More informationuntitled
理 葉 CNFH-88-04 行 87 年 9 1 88 年 6 30 類 葉 Staphylococcus aureus Staphylococcus epidermidis Streptococcus mutans Streptococcus sanguis Escherichia coli Klebsiella pneumoniae Pseudomonas aeruginosa Candida
More informationPowerPoint 프레젠테이션
구강미생물 7 주차 병원성세균 (pathogenic bacterium) 사람에게감염하여질병을일으키는세균 김희은교수 가천대학교보건과학대학치위생학과 구강미생물의구성 구강내에존재하는대부분의세균은그람양성또는그람음성으로분류» 연쇄상구균 (Streptococcus) 은구강미생물의주요한부분차지 치아우식증, 화농성구강감염증, 감염성심내막염등 Need to know biofilm
More information로의 흡수 및 에너지 대사 등을 조절한다 면서 유산균은 유해균의 성장을 억제하면서 동시에 유산균의 증식 을 도울 수 있는 능력이 있다. 따라서 프레바이오틱스(prebiotics)나 프로바이오틱스가 함유된 식품이나 의약 품을 꾸준히 섭취하는 것이 중요하다 고 강조했다.
프로바이오틱스의 진면목(2) 저자 김성철 영남대학교 임상약학대학 겸임교수 약학정보원 학술자문위원 개요 인간의 위장관에는 숙주세포, 영양소, 미생물로 이루어진 복잡하고 다양한 생태계(ecosystem)가 존재한 다. 장관에서 배양 가능한 미생물의 종류는 500종 이상이며, 위, 십이지장, 공장에는 미생물의 수가 10 5 CFU/g으로 증가한다. 장내 세균의 수는
More information- 2 -
- 1 - - 2 - - 3 - - 4 - - 5 - [ 그림 1] 산수유 [ 그림 2] 더덕 - 6 - - 7 - sample [ 그림 3] 균분리를위한접종 - 8 - PCA PCA with inoculum Slide glass [ 그림 4] Slide culture 모식도 - 9 - - 10 - Nutrient Medium Paperdisk with Antibiotics
More information<B8F1C2F72E687770>
제1장 제17장 성홍열 및 사슬알균 감염증 사슬알균 (Streptococci)은 증식 중의 특징적으로 쌍 또는 사슬모양의 그람양성 알균 으로 catalase 음성, 통성혐기성균이며, 보통 한천배지에서는 발육이 어렵고 혈액이나 혈청 등을 첨가한 배지에서 잘 발육한다. 포도당이나 다른 탄수화물을 분해하나 포도당 을 분해하여 가스를 생성하지 않는다. 이들은 최소
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More information( )Kju225.hwp
비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin
More informationca_02.hwp
SPSPSPSP SPSPSPS SPSPSP SPSPS SPSP SPS 공기청정기 항균필터 SPS - KACA009-139 한국공기청정협회 2002년 12월 31일 제정 2016년 -월 -일 개정예정 http://www.kaca.or.kr 1.1 적용범위 이 표준은 에어필터로 공기중의 입자제거 및 미생물 제균 성능을 지닌 필터에 대하여
More information(....).hwp
연구기관 한국식품연구원 농림부 연구기관 한국식품연구원 농림부 Analytical Semi-preparative Solution A 1) Solution B 2) Mixing Spreading Coating medium Corona treated OPP 3) film Casting Drying
More informationJournal of Life Science 2011, Vol. 21. No μ μ
Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More informationMicrosoft PowerPoint - PDFCoTemp.PPT
주요유방염세균의검출및 항생제감수성검사 임숙경 1. 검사시료 1. 시료채취 유방염우유 2. 체세포수측정 3. 대상세균 - Staphylococcus aureus - Coagulase negative staphylococci -Escherichia coli 3. 균분리방법 E. coli CHEC Agar 직접도말 (37 18-24h) 보라색집락 EMB Agar
More information22 (07-29-OK).hwp
J Korean Soc Food Sci Nutr 한국식품영양과학회지 43(2), 328~332(2014) http://dx.doi.org/10.3746/jkfn.2014.43.2.328 김치의저장성향상을위한항균활성우수유산균선발 연구노트 최학종 1 김유진 1 이나라 1 박해웅 1 장자영 1 박성희 1 강미란 1 김현주 1 이종희 1 이종훈 2 변유량 3 김태운
More information2 - ceftazidime-clavulanate 디스크를이용하여 ESBL 생성균주를확인하였다. 또한 2009년도에수집된균주인 P. aeruginosa(386주 ), A. baumannii(349주 ) 를대상으로 imipenem에대한감수성을확인하였고 imipenem-h
1 - 국내종합병원을대상으로한항균제내성모니터링 Monitoring of antimicrobial resistance on general hospitals in Korea 질병관리본부국립보건연구원감염병센터약제내성과 연세대학교의과대학진단검사의학교실, 세균내성연구소 Ⅰ. 들어가는말 항균제내성세균의출현과확산으로인하여세균감염증치료는점점어려워지고있다 [1-4]. 항균제내성률은흔히국가간,
More information2003_17_어영.hwp
임상병리와정도관리 : 제 25 권제 2 호 2003 J. Lab. Med. & Quality Assuarance 2003:25:215-221 215 Microplate 를이용한장구균동정법 어영 황규열 장인호 윤갑준 이경원 * 이형환 ** 연세대학교원주의과대학진단검사의학과, 연세대학교의과대학진단검사의학과 *, 건국대학교생명과학과 ** Identification
More information석사논문.PDF
ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh
More information04_HM hwp
The Korean Journal of Microbiology (2010) Vol. 46, No. 4, pp. 334-340 Copyright c 2010, The Microbiological Society of Korea 흡연자와비흡연자간의구강내세균분포및항균제감수성 정현자 1 김수정 2 * 1 대구보건대학치위생과, 2 대구보건대학임상병리과 Distribution
More informationAbstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie
Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung
More information(....).hwp
sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial
More information43-4(08) fm
KOREAN J. FOOD SCI. TECHNOL. Vol. 43, 4, pp. 446~452 (2011) The Korean Society of Food Science and Technology 김치에서항균활성유산균의분리및동정 김수영 1 김종두 1 손지수 1 이시경 2 박갑주 3 박명수 * 안양과학대학호텔조리과, 1 건국대학교생명과학과, 2 건국대학교응용생명과학부,
More information43(2)-10(단보)023(p ).fm
The Korean Journal of Microbiology, Vol. 43, No. 2, June 2007, p. 142-146 Copyright 2007, The Microbiological Society of Korea Ginsenoside y ƒ w z ½ ³Á½» Á * w w w œw l (Panax ginseng) z w x š. ù, w š
More informationJ Korean Acad Pediatr Dent 36(3) 2009 유산균발효유가 Streptococcus mutans 의생균수및 biofilm 형성에미치는영향 신혜성 김선미 최남기 양규호 강미선 * 전남대학교치의학전문대학원소아치과학교실, 치의학연구소및 2 단계 BK
유산균발효유가 Streptococcus mutans 의생균수및 biofilm 형성에미치는영향 신혜성 김선미 최남기 양규호 강미선 * 전남대학교치의학전문대학원소아치과학교실, 치의학연구소및 단계 BK, * 의과대학미생물학교실 국문초록 유산균이위장관과구강건강에 probiotics로서긍정적인영향을미치고있음이보고되고있다. 이에시판되는유산균발효유 5종과우유를선택하여우식유발원인균인
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information8(4) fm
Journal of Dental Hygiene Science Vol. 8, No. 4 pp. 367~373 (008) 황금 (Scutellaria baicalensis) 추출물에의한 Streptococcus mutans 의항균및부착억제효과 Á½ xá«x Á½ Á½ Áw w w w, 1 w e Effects of Antibacteria and Adhesive
More information..........5-45..
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals
More informationuntitled
대한내과학회지 : 제 70 권제 5 호 2006 감염성심내막염환자에서 16S rrna 유전자염기서열분석을통한 Gemella 동정 2예 성균관대학교의과대학삼성서울병원내과 1, 아시아태평양감염연구재단 2 손경목 1 고관수 2 김정 1 이지영 1 오원섭 1, 2 백경란 1, 2 송재훈 1, 2 =Abstract= Identification of Gemella species
More information보도자료 장내미생물유전자의장관련감염질환유도원리규명 - 항생제오용으로발생하는장관련감염질환의진단및치료에기여
보도자료 장내미생물유전자의장관련감염질환유도원리규명 - 항생제오용으로발생하는장관련감염질환의진단및치료에기여 . 1. 연구의필요성 항생제의복용은장내미생물군집변화와더불어미생물에의해생산되는대사산물의 변화, 세균신호전달물질의감소등을유발하여인체의장면역시스템을약화 시키며다양한질병의원인이될수있다고알려져있다. 입원환자의항생제치료과정중발생하는의료관련감염병인클로스트리디움디피실 감염증
More informationmau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More informationuntitled
ORIGINAL ARTICLE Korean J Clin Lab Sci. Vol. 45, No. 1, Mar. 2013 21 Korean J Clin Lab Sci. 2013, 45(1):21-25 ISSN 1738-3544 Errors of Antibiotic Susceptibility Testing from Automated and Manual Systems
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More informationTrd022.hwp
김신태, 이선녕, 이석정, 정필문, 박홍준, 신명상, 김종환, 이부길, 김상하, 리원연, 신계철, 용석중 Shin-Tae Kim, M.D., Shun Nyung Lee, M.D., Seok Jeong Lee, M.D., Pil Moon Jung, M.D., Hong Jun Park, M.D., Myung Sang Shin, M.D., Chong Whan Kim,
More information<C7D1BDC4BFAC20B1E8B5BFBCF6B9DABBE7B4D4676C75636F20C3D6C1BE5B315D2E687770>
Glucomannan 을이용한 기능성소재화연구 Study on the Functional and Processing Properties of Glucomannan for Food Material 연구기관 한국식품개발연구원 농림부 - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More information01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
More information14.fm
pissn 1229-1153 J. Fd Hyg. Safety Vol. 30, No. 1, pp. 103~108 (2015) http://dx.doi.org/10.13103/jfhs.2015.30.1.103 Journal of Food Hygiene and Safety Available online at http://www.foodhygiene.or.kr 실시간정량
More informationViridans Streptococci 균혈증 247 나이며, 이는류마티스성열, 승모판탈출, 선천성결손, 인공판막등으로인한심장판막손상이나결손이있는사람에서주로발생한다 [4]. 최근에는혈액종양이나고형암또는골수이식등의치료에사용된항암제에따른심각한호중구감소증, 구강점막의궤양등과
대한진단검사의학회지 : 제 23 권제 4 호 2003 Korean J Lab Med 2003; 23: 246-50 임상미생물학 Viridans Streptococci 균혈증의임상적의의 조은해 이남용 성균관대학교의과대학삼성서울병원진단검사의학교실 Clinical Significance of Viridans Streptococcal Bacteremia Eun Hae
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More information27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
More information03(12-65)p fm
한국임상약학회지제 23 권제 1 호 Kor. J. Clin. Pharm., Vol. 23, No. 1. 2013 화상감염소아환자에서분리된주요균종에대한항생제의내성률 강주연 신혜순 * 덕성여자대학교약학대학 (2012 년 12 월 28 일접수 2013 년 3 월 2 일수정 2013 년 3 월 4 일승인 ) Antimicrobial Resistance of Clinically
More information노영남
Purpose: Delayed massive hemorrhages from pseudoaneurysm rupture of the peripancreatic large arteries, after pancreaticoduodenectomy, are fatal. We reviewed the clinical course and outcome of bleeding
More information<31335FB1C7B0E6C7CABFDC2E687770>
에너지기후변화교육 4(2):203~211(2014) 203 초등학교 교과서 에너지 단원의 탐구활동과 시각자료 기능 분석 사례 연구 신명경 권경필 * 경인교육대학교 Abstract : This study aimed to analyze energy related inquiry activity and visual materials in elementary textbook.
More information27 2, 17-31, , * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** ( :
27 2, 17-31, 2009. -, * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** (: dminkim@cau.ac.kr) 18 한국교육문제연구제 27 권 2 호, 2009. Ⅰ. (,,, 2004). (,, 2006).,,, (Myrick,
More information°Ç°�°úÁúº´6-2È£
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 2 www.cdc.go.kr 2013 1 11 6 2 ISSN:2005-811X Flavivirus surveillance in mosquitoes collected from the quarantine
More informationA Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran
More information<31382D322D3420BDC5B1D4C8AF5FB3EDB9AE28C3D6C1BEBABB292E687770>
醫 史 學 제18권 제2호(통권 제35호) 2009년 12월 Korean J Med Hist 18ː57 72 18ː173-188 Dec. Dec. 2009 2009 C 大 韓 醫 史 學 會 ISSN ISSN 1225 505X 1225-505X 지방병 연구와 식민지배 : 1927년 영흥 및 해남지역 에메틴 중독사건을 중심으로 신 규 환* 1. 머리말 2. 일제의
More information환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
More informationDBPIA-NURIMEDIA
Korean Society for Biotechnology and Bioengineering Journal 31(4): 214-218 (2016) http://dx.doi.org/10.7841/ksbbj.2016.31.4.214 ISSN 1225-7117 / eissn 2288-8268 연구논문 전복 (Haliotis discus) 에서분리한 Serratia
More information학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici
학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and
More information<C8B2BCBABCF62DB8D4B0C5B8AEBFCDB0C7B0AD2E687770>
먹거리와 건강 황성수 인도주의실천의협의회(humandoctor.org) 황성수 의사님의 글 http://humandoctor.org/technote/main.cgi?board=whang 서적 곰탕이 건강을 말아먹는다 로도 출판되어 있음. lightworker.kr 편집 1. 이 글을 읽는 분들에게 황성수의 먹거리와 건강 을 읽는 모든 분들에게 인사드립니다.
More informationDBPIA-NURIMEDIA
Korean Society for Biotechnology and Bioengineering Journal 32(2): 146-152 (2017) http://dx.doi.org/10.7841/ksbbj.2017.32.2.146 ISSN 1225-7117 / eissn 2288-8268 Research Paper 질내유산균의 Candida albicans 에대한항진균효과연구
More information주간건강과질병 제 12 권제 16 호 연구단신, Brief report 년국내표본감시기관의료관련감염병 ( 항생제내성균 6 종 ) 발생현황 질병관리본부감염병관리센터의료감염관리과이승재, 이은주, 박현정, 이상은, 김성남, 이형민 * * 교신저자 : s
연구단신, Brief report 2 2013 2017 년국내표본감시기관의료관련감염병 ( 항생제내성균 6 종 ) 발생현황 질병관리본부감염병관리센터의료감염관리과이승재, 이은주, 박현정, 이상은, 김성남, 이형민 * * 교신저자 : sea2sky@korea.kr, 043-719-7580 Results of healthcare-associated infection
More informationTable 1. Allelic profiles of 194 C. jejuni analyzed in this study Gene locus Fragment length (bp) No. of alleles No. of polymorphic sites (%) Ave. p d
연구논문, Research article 국내설사환자분리캄필로박터제주니의유전형분석 질병관리본부감염병분석센터세균분석과정수미, 강병학, 홍사현, 김재옥 * * 교신저자 : kimjo70@korea.kr, 043-719-8110 Genetic analysis of Campylobacter jejuni isolates from diarrheal patients in
More informationAbstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More information101~110 ¿õ´ã.¿ìȲ
101 DOI : 10.3831/KPI.2010.13.2.101 Received : 10. 05. 06 Accepted : 10. 05. 27 The Experimental Study on the Effect of Fel Ursi & Bovis Calculus Pharmacopuncture Solution in Bacterial Species which cause
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales
More information대한임상병리학회지 : 제 19 권제 1 호 1999 Korean J Clin Pathol 1999; 19: 임상미생물학 장구균의간략동정법개발 어영 장인호 윤갑준 연세대학교원주의과대학임상병리과학교실 Development of Simple Identificati
대한임상병리학회지 : 제 19 권제 1 호 1999 Korean J Clin Pathol 1999; 19: 57-61 임상미생물학 장구균의간략동정법개발 어영 장인호 윤갑준 연세대학교원주의과대학임상병리과학교실 Development of Simple Identification Method of Enterococci Young Uh, M.D., In Ho Jang,
More informationpissn eissn J. Milk Sci. Biotechnol. 2019;37(2): ARTICLE 전통김치로부터 Probiotic 유산균의
pissn 2384-0269 eissn 2508-3635 J. Milk Sci. Biotechnol. 2019;37(2):115-128 https://doi.org/10.22424/jmsb.2019.37.2.115 ARTICLE 전통김치로부터 Probiotic 유산균의분리및우유발효특성 임영순 * 김지연 강현철 서울에프엔비식품연구소 Isolation and Identification
More informationJksvs019(8-15).hwp
Grade I Grade II Grade III 12 대한혈관외과학회지 : 제 20 권 제 1 호 2004 Control Group A Group B Fig. 4. Microscopic findings of vein wall in control, group A and group B on the day of 7 after venous occlusion. The
More information( )Jkstro011.hwp
비인강암의방사선치료결과및생존율에관한예후인자분석 2005 2 1 2005 3 28. :, Tel: 053)250-7665, Fax: 053)250-7984 E-mail: jhkim@dsmc.or.kr 정영연외 2 인 : 비인강암의예후인자분석 정영연외 2 인 : 비인강암의예후인자분석 Carcinoma of the nasopharynx treated by radiotherapy
More information어린이기호식품1회제공량표시-결과보고서-줄임.hwp
우리는소비자와함께행복한세상을만든다 어린이기호식품 1 회제공량표시조사보고서 2010. 11 식품미생물팀 차례 Ⅰ. 조사개요 1 1. 추진배경 1 2. 조사기간및조사내용 2 Ⅱ. 조사결과 2 1. 어린이기호식품 2 2. 가공식품의영양표시제도 4 3. 1회제공량표시 9 4. 영양성분앞면표시제 12 5. 신호등표시제 14 6. 고열량 저영양식품 16 7. 어린이기호식품품질인증
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More information항체 포털 서비스 Preparation Peptide 총 4주 소요 / 473,000 ~ 511,000 Free of charge 2~3 days 243,000 ~ 281,000 의뢰서 작성 Peptide epitope prediction 유전자 정보
Preparation Service AbFrontier Custom service 장점 실험 담당자와의 원활한 1:1 커뮤니케이션 (신속한 feedback을 통한 맞춤형 제작 서비스) 고객연구센터 - 개별 서비스의 진행 상황 및 결과 즉시 확인 http://center.abfrontier.com (e-mail & SMS 전송) 회원제 -연구자의 프로젝트 보안
More information( )Jkspen001.hwp
한국정맥경장영양학회지제 1 권제 1 호 2007 JKSPEN Vol. 1, No. 1, 2007 원저 Enterococcus faecium 함유프로바이오틱스복용자에서발생한 Enterococcus faecium 유발원내감염증의항생제내성양상 중앙대학교의과대학내과학교실 김정욱 The Antimicrobial Resistance of Nosocomial Enterococcus
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More information164-2.fm
J. Fd Hyg. Safety 16(4), 264 273 (2001) Lactobacillus reuteri t w w w³ z «ûz 1 Á½ x 1 Á»Á½ Á Á Á½ Á *Áx Á y œ» w œw w w Antimicrobial Activity of Lactobacillus reuteri Against Major Food-Borne Pathogens
More informationhttp://www.kbc.go.kr/pds/2.html Abstract Exploring the Relationship Between the Traditional Media Use and the Internet Use Mee-Eun Kang This study examines the relationship between
More informationDBPIA-NURIMEDIA
Korean Society for Biotechnology and Bioengineering Journal 32(4): 251-255 (2017) http://dx.doi.org/10.7841/ksbbj.2017.32.4.251 ISSN 1225-7117 / eissn 2288-8268 Research Paper 유산균의생존율향상을위한동결건조보호제로서호박분말의효과
More information7.ƯÁýb71ÎÀ¯È« š
J KMA Special Issue Myelodysplastic Syndrome June Won Cheong, MD Yoo Hong Min, MD Department of Internal Medicine, Yonsei University College of Medicine E mail : jwcheong70@yumc.yonsei.ac.kr minbrmmd@yumc.yonsei.ac.kr
More informationDBPIA-NURIMEDIA
Korean Society for Biotechnology and Bioengineering Journal 30(3): 109-113 (2015) http://dx.doi.org/10.7841/ksbbj.2015.30.3.109 ISSN 1225-7117 / eissn 2288-8268 연구논문 프로바이오틱스의동결보호및장관안정성개선을위한첨가제효과분석 정은지
More information면우식증을예방할수있으며, 이를위하여치아의내산성을증대시키거나재석회화를촉진시키는방법과함께산을생성하는세균의성장을억제하는방법등이있다 7). 미생물학적관점에서살펴본다면우식을일으키는미생물이치면에정착하여증식되는것을막고, 미생물들이우식작용을유발하기위해필수적인기질의공급을가능한한억제하는
구강내세균에대한 Essential oil 의항균효과에관한연구 이선영 김재곤 백병주 양연미 이경열 이용훈 김미아 전북대학교치과대학소아치과학교실및구강생체과학연구소 국문초록 Essential oil은식물로부터추출한휘발성의호지방성화합물로서 essential oil은잠재적으로항균, 항진균, 진경련, 항말라리아성, 곤충퇴치능력등의생물학적효과를가지고있다. 본연구에서는다양한방향식물에서추출한
More information(2005\263\342\271\351\274\255_final.hwp)
제 2 절 식 의약품 종합정보서비스 243 제1장 평 가 분 야 제1절 식품규격평가 분야 제2절 식품안전평가 분야 제3절 의약품평가 분야 제4절 생약평가 분야 제5절 생물의약품평가 분야 제6절 의료기기평가 분야 제 1 절 식품규격평가 분야 245 제1장 평가분야 제1절 식품규격평가 분야 제1 항 식품의 기준 규격 1. 식품공전 식품의 기준 규격은 식품위생법
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More information04서종철fig.6(121~131)ok
Development of Mobile Applications Applying Digital Storytelling About Ecotourism Resources Seo, Jongcheol* Lee, Seungju**,,,. (mobile AIR)., 3D.,,.,.,,, Abstract : In line with fast settling trend of
More informationDBPIA-NURIMEDIA
Korean Society for Biotechnology and Bioengineering Journal 32(2): 153-159 (2017) http://dx.doi.org/10.7841/ksbbj.2017.32.2.153 ISSN 1225-7117 / eissn 2288-8268 Research Paper 한국인장관에서분리한유산균의항균활성및프로바이오틱스특성연구
More informationJournal of Educational Innovation Research 2016, Vol. 26, No. 2, pp DOI: * The Mediating Eff
Journal of Educational Innovation Research 2016, Vol. 26, No. 2, pp.159-177 DOI: http://dx.doi.org/10.21024/pnuedi.26.2.201608.159 * The Mediating Effects of Self-esteem on the Relationship between Social
More information(1) 04. 오계헌.fm
Korean Society for Biotechnology and Bioengineering Journal 28(1): 1823 (2013) http://dx.doi.org/10.7841/ksbbj.2013.28.1.18 연구논문 장기간발효김치인묵은지에서분리한 Lactobacillus sakei JK17 의기능성조사 김동선, 조형우, 김대한, 오계헌 * Functional
More information,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012). (2007) 26%., (,,, 2011;, 2006;
,,.. 400,,,,,,.,,, -, -, -., 3.. :, Tel : 010-9540-0640, E-mail : sunney05@hanmail.net ,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012).
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More information우리몸속장건강을챙기는것은바쁜생활중에도균형잡힌장건강을바라는현대인이가져야할상식입니다. 밸런스위드인프로바이오틱스 뉴트리라이트만의기준으로더까다롭게완성한밸런스위드인프로바이오틱스를만나보세요! 하지만불규칙한생활, 과도한스트레스, 인스턴트식품등이장내유익균들에게부정적인영향을주어현대인은건강한장을유지하기힘듭니다. 뉴트리라이트는검증된원료와진보한과학기술을적용하여다섯균주의독점포뮬라를완성하였습니다.
More informationDevelopment of culture technic for practical cultivation under structure in Gastrodia elate Blume
Development of culture technic for practical cultivation under structure in Gastrodia elate Blume 1996. : 1. 8 2. 1 1998. 12. : : ( ) : . 1998. 12 : : : : : : : : : : - 1 - .. 1.... 2.. 3.... 1..,,.,,
More informationK O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis
More information- 1 -
발간등록번호 11-1541000-001345-01 전통된장의농가기업형대량생산 system 개발 - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23
More information류코노스톡발현시스템개발연구동향 충북대학교식품생명공학과한남수교수 1. 류코노스톡및이의발현벡터류코노스톡속은락트산, 아세트산, 알코올, 이산화탄소, 아세토인등의방향족화합물및네개의탄소함유화합물을생성하는이종발효유산균이다. 이는광범위하게채소 ( 김치, 사우어크라우트, 피클 ) 와
류코노스톡발현시스템개발연구동향 충북대학교식품생명공학과한남수교수 1. 류코노스톡및이의발현벡터류코노스톡속은락트산, 아세트산, 알코올, 이산화탄소, 아세토인등의방향족화합물및네개의탄소함유화합물을생성하는이종발효유산균이다. 이는광범위하게채소 ( 김치, 사우어크라우트, 피클 ) 와유발효에사용되며구연산대사및디아세틸배양유제품의주된맛화합물인휘발성화합물을생산한다. 일반적으로독소를생성하지않으며호기성및혐기성조건에서성장하고
More informationÀÇÇа�ÁÂc00Ì»óÀÏ˘
Common Allergic Diseases in Children Sang - Il Lee, M.D. Department of pediatrics Sungkyunkwan University School of Medicine, Samsung Medical Center E - mail : silee@smc.samsung.co.kr Abstract Allergy
More information54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3
27 2, 53-70, 2009. (Nursing Home) * ** (Nursing Home). 5 50 5 2 1,,,,, SPSS t.,,,,,,,. :,, : 2009/08/27 : 2009/09/24 : 2009/09/30 * ** (: hjkim@daelim.ac.kr) 54 한국교육문제연구제 27 권 2 호, 2009. I. 1.,,,,,,, (,
More informationORIGINAL ARTICLE Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resist
ORIGINAL ARTICLE http://dx.doi.org/10.15263/jlmqa.2015.37.4.209 Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resistance: MicroScan versus Etest Goeun Kang, Hyun Soo Kim,
More informationDBPIA-NURIMEDIA
J Korean Soc Food Sci Nutr 한국식품영양과학회지 39(4), 595~601(2010) DOI: 10.3746/jkfn.2010.39.4.595 Multiplex Polymerase Chain Reaction(PCR) 법을이용한 Staphylococcus aureus, Salmonella enterica subsp., Vibrio parahaemolyticus
More informationKJMB fm
Korean J. Microbiol. Biotechnol. (2014), 42(3), 211 218 pissn 1598-642X eissn 2234-7305 Korean Journal of Microbiology and Biotechnology 장내유해세균을억제하는양돈용프로바이오틱스개발을위한비피도박테리아탐색 이재연, 신영오, 김근 * 수원대학교바이오산업연구소
More informationJkbcs016(92-97).hwp
Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean
More information2016 학년도약학대학면접문제해설 문제 2 아래의질문에 3-4분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세
본문제에대한지적소유권은동국대학교에있습니다. 본교의서면허락없이무단으로출판, 게재, 사용할수없습니다. 문제 2 2016 학년도약학대학면접문제 아래의질문에 3-4 분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신 인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세포의생존과증식
More information