Journal of Climate Change Research 2017, Vol. 8, No. 3, pp DOI: 지리산국립공원세석지역의아고산관속식물상 노일 * 정재민 *

Size: px
Start display at page:

Download "Journal of Climate Change Research 2017, Vol. 8, No. 3, pp DOI: 지리산국립공원세석지역의아고산관속식물상 노일 * 정재민 *"

Transcription

1 Journal of Climate Change Research 2017, Vol. 8, No. 3, pp DOI: 지리산국립공원세석지역의아고산관속식물상 노일 * 정재민 ** 조민기 *** 김태운 **** 문현식 **** * 국립공원관리공단내장산사무소, ** 국립수목원산림자원보존과, *** 국립산림과학원남부산림자원연구소, **** 경상대학교산림자원학과 ( 농업생명과학연구원 ) The Flora of Subalpine Vascular Plants in Seseok Area of Jirisan National Park Noh, Il *, Chung, Jae-Min **, Cho, Min-Gi ***, Kim, Tae-Woon **** and Moon, Hyun-Shik **** * Korea National Park Service, Jeongeup 56199, Korea ** Plant Conservation Division, Korea National Arboretum, Pocheon 11186, Korea *** Southern Forest Resources Research Center, Korea Forest Research Institute, Jinju 52817, Korea **** Dept. of Forest Environmental Resources, Gyeongsang National University, Jinju 52828, Korea ABSTRACT This study was conducted to investigate the vascular plants which can be an indicator of environmental change in Seseok of Jirisan National Park. The purpose of this study was to find out the basic information for the subalpine species. This study showed that the area had a total 295 taxa including 63 families, 177 genus, 252 species, 2 subspecies, 36 variants 5 forms and Pte-Q was 1.7. Among them, Korea endemic plants were 15 taxa such as Abies koreana. Rare plants were 14 taxa such as Viola diamantiaca. Naturalized plants consisted of 5 taxa such as Rumex crispus. The floristic regional indicator plants found in surveyed area were 72 taxa comprising 3 taxa of grade, 7 taxa of grade and 24 taxa of grade. In summary, The subalpine plants of the survey region consisted of 37 taxa including Abies koreana and Gymnadenia cucullata. As rare plants distributed in subalpine zone respond sensitively to climate change, accuracy distribution range, environmental characteristics of habitat and population dynamics of rare plants should be evaluated quantitatively. Key words: Subalpine Zone, Vascular Plants, Climate Change, Rare Plant, Subalpine Plant 1. 서론 아고산대는산림한계선부터교목한계선에이르는범위로경관과식생이분포하는공간이매우좁고생물자원의분포와가치가중요한의미를갖는곳이다 (Kong, 2007). 아고산지대의생태계는물리적, 환경적여건이열악하여, 외부의작은교란요인이라도식물의생리적인면이나성장및주변생태계전체에미치는영향이매우크다 (Kayama et al., 2009; Iijima et al., 2009). 하지만최근전세계적으로가속화되고있는기후변화의영향으로아고산대에서식하는생물자원들은생존의위협을받고있다. 특히한반도는다른지역에비하여기온상승의가능성이높고, 그증가율도높을것으로예상되기때문에 (Lee, 2011), 아고산대의환경변화는다른곳에비해더욱가 속화될것이다. 아고산대주요식물은외부의작은교란에도생장이감소할것으로보이기때문에, 이들아고산식물의개체유지와보존의중요성이높게평가되고있다 (Kong, 1998). 산림내생육하는식물은각각의사소한식물일지라도식물종의고유한특성과그지역의생태정보를제공하기때문에체계적이고객관적인관점에서조사 분석되어야하며 (Choi, 2009), 생물종다양성을파악하는것은기후변화로인한생태계구성원들의유전적가치를파악하고확보하기위한기초적인연구분야이다. 아고산대의식생에대해서는구상나무군락 (Kim et al., 2012; Cho et al., 2015; Cho et al., 2016; Noh, 2017), 가문비나무군락 (Cho et al., 2012), 주목군락 (Cho et al., 2012) 을대상으로한식생구조연구를통해기후변화등으로이들아고산성수종의개체수및분포지면적이감소하고있 Corresponding author: hsmoon@gnu.ac.kr Received June 29, 2017 / Revised July 21, 2017 / Accepted August 16, 2017

2 202 노일 정재민 조민기 김태운 문현식 다는결과가제시되고있다. 특정지역에나타나는식물종은그지역의환경에적응한결과이기때문에기후변화등과같은환경변화는직접적으로식물상조성에영향을미칠것으로생각된다. 특히아고산대에분포하는식물종들은기후변화와같은환경변화에민감하게반응할것이기때문에, 식물종분포에대한지속적인모니터링과분석은어떤분야의연구보다도더중요하다고할수있다. Kim(2017) 은금오산의과거 50년간의식물상을분석하여기온상승으로대형지상식물과소형지상식물의비율이감소하고, 지중식물과반지중식물의비율이상대적으로증가하였다고보고한바있다. 아고산대에서의식물상분석은기후변화로인한환경변화의지표가될수있으나, 덕유산아고산대 ( 향적봉- 중봉 ) 의식물상 (Han, 2013), 남덕유산아고산대의식물상 (Lee et al., 2013) 에관한연구를제외하면전무한실정이다. 본연구는지리산국립공원세석지역아고산대에분포하는식물상을파악하여기후변화에취약한이들의보전관리및향후기후변화에따른아고산대식물상의추이를파악하기위한기초자료를제공함에목적이있다. 노고단에서천왕봉에이르는능선부와높은봉우리주변에아고산식생이군락을형성하고있다. 지리산국립공원에존재하는아고산대에는구상나무, 가문비나무등대표적아고산수종이군락을이루며생육하고있으나, 최근기후변화로인하여활력이떨어지거나, 고사 쇠퇴현상이발생하는등식물환경의변화가일어나고있다 (Cho et al., 2015). 본연구가수행된세석지역은 1,490 1,864 m의해발고에위치하며, 남한에서가장높은고위평탄면이다. 1990년대까지는야영이가능하였고, 군부대의산악훈련등으로황폐화되었지만, 국립공원관리공단의복원사업등으로생태계가안정되었고, 주변으로구상나무, 가문비나무등아고산식물이군락을이루어생육하고있다. 식물구계학적으로는남부아구에속하며, 식물군계수준에서는한국냉온대, 식물지리학적분포는한반도아형의남부 / 산지형이다. 본조사지의기상자료는경남산청군의최근 10년간기상자료에온도체감율 (0.56 /100 m) 을적용하여분석한결과, 연평균기온은 4.34, 연평균강수량은 1,556.8 mm로분석되었다 (KMA, 2017). 2. 재료및방법 2.1 연구대상지 백두대간의끝자락에위치하고있는지리산국립공원은 1967 년에지정된 1호국립공원이며, km 2 의면적을지닌가장넓은면적의산악형국립공원이다. 천왕봉 (1,915 m) 을중심으로동 서방향으로 20여개의봉우리가펼쳐져있으며, 2.2 연구방법현장조사는 2014년 6월부터 2015년 10월까지총 8회 15일에걸쳐현지조사를실시하였다. 조사경로는크게 5개로설정하였으며, 대피소부근도포함시켰다. 식물의동정은 Lee(2003) 의문헌을참고하여현장에서동정하여직접기록하는것을원칙으로하였으며, 현지에서동정이어려운종은채집후정밀동정을실시하였다. 본연구에서는일부동정이불가능한종 Fig. 1. The location map of this study. Journal of Climate Change Research 2017, Vol. 8, No. 3

3 지리산국립공원세석지역의아고산관속식물상 203 이외에는식물체를채집하지않았다. 분류군배열은 Engler 체계 (Melchoir, 1964) 에따라나열하였고, 학명과국명은 Korea National Arboretum and The Plant Taxonomic Society of Korea(2007) 의국가표준식물목록에의거하여작성하였다. 특산식물은 Oh et al.(2005), 희귀식물은 Korea National Arboretum (2008), 식물구계학적특정식물은 Ministry of Environment(2012), 귀화식물은 Lee et al.(2011) 의문헌을이용하여분류하였다. 식물상에대한정량적이고객관적인분석과평가를위해서식물상을활용한생태적지수를활용하였다 (Oh and You, 2012). 3. 결과및고찰 3.1 식물상 본연구지에서나타난관속식물상은 63과 177속 252종 2 아종 36변종 5품종 295분류군 (Table 1) 으로, 한반도관속식물 4,495분류군 ( Korea National Arboretum, 2014) 의 6.6%, 지리산국립공원관속식물 1,825분류군 (Jang, 2007) 의약 16% 에해당한다. 분류체계별현황을살펴보면양치식물 19분류군 (6.4%), 나자식물 7분류군 (2.4%), 단자엽식물 42분류군 (14.2%), 쌍자엽식물 227분류군 (76.9%) 으로나타났다. 쌍자엽식물이양치식물, 단자엽식물보다상대적으로높은구성비율을나타내고있는데, 이는쌍자엽식물의분포가높게나타나는중부지역의특성이나타났기때문으로판단된다 (Kim et al., 2008). 과별분포현황은국화과 32분류군 (10.8%), 벼과 21분류군 (7.1%), 장미과와사초과 14분류군 (4.7 %), 면마과와미나리아재비과 13분류군 (4.4%), 범의귀과 12 분류군 (4.1%) 순으로나타났다. 본연구지와유사한아고산대인덕유산향적봉 -중봉의과별분포현황은백합과, 국화과, 장미과, 범의귀과, 미나리아재비과 (Han, 2013) 순으로나타나, 국화과가높은비율의분포를보였는데, 이는국화과의식물이다른과의식물에비해종자결실량이많아번식에유리하기 때문이다 (Ko et al., 1995). 조사대상지면적등의차이때문에분류군의단순한비교보다는식물의종다양도를나타내는방법인종 / 속비율을분석하였다. 세석지역의종 / 속비율은 1.67 로지리산국립공원의종 / 속비율 2.06(Jang et al., 2007) 보다낮게나타났는데, 이는본연구의공간적범위가아고산대로한정되어있기때문으로판단된다. 덕유산국립공원 ( 향적봉 -중봉) 아고산대의 1.48(Han, 2013), 남덕유산아고산대의 1.71(Lee et al., 2013) 과는큰차이가없었다. 비교적교란이적은고온다습한지역에많이분포하는양치식물은 19분류군으로지리산국립공원에자생하는 135분류군 (Gwon et al., 2013) 의 14.1 %, 국내양치식물 334분류군 (Korea National Arboretum, 2008) 의 5.7% 에해당한다. 또한자연의파괴정도를나타내는지수로사용되는양치식물계수 (Pte-Q = 25 양치식물종수 / 현화식물종수 ) 는 1.61로, 지리산국립공원의 1.80(Gwon et al. 2013) 보다는낮았으나, 덕유산국립공원 ( 향적봉 -중봉 ) 의 1.48(Han, 2013) 보다다소높게나타났다. 3.2 특정식물종 특산식물특산식물은한반도자연환경의지리적특수성에적응하여진화해온식물자원으로다양한유전정보가담겨있는귀중한자원이다. 본연구지에자생하는특산식물은구상나무, 키버들, 좀고채목, 진범, 노각나무등 15분류군 (Table 2) 이확인되었다. 세석지역관속식물 295분류군의 5.1%, 우리나라특산식물 328분류군 (Oh et al., 2005) 의 4.6% 에해당한다. 덕유산국립공원아고산대 ( 향적봉-중봉 ) 의 5.9%(Han, 2013) 와유사한경향이었다. 본조사지의구상나무는지리산국립공원의다른구상나무자생지와달리쇠퇴하지않는다고보고된바있다 (Cho et al., 2015). Oh et al.(2005) 은특산식물은과거에는광범위하게분포하던종이여러환경요인에의해분포역이좁아진잔존고유종 (relic endemics) 이거나, 분화에의해신규 Table 1. The flora of vascular plant in survey site Taxa Fam. Gen. Sp. Subsp. Var. For. Total Pteridophyta Gymnospermae Angiospermae Dicotyledoneae Monocotyledonea Total

4 204 노일 정재민 조민기 김태운 문현식 Table 2. The list of Korean endemic plants in survey site No. Family name 1 Pinaceae Abies koreana 2 Salicaceae Salix koriyanagi 3 Betulaceae Betula ermanii var. saitoana 4 Ranunculaceae Aconitum pseudolaeve 5 Theaceae Stewartia pseudocamellia 6 Saxifragaceae Philadelphus schrenkii 7 Rosaceae Filipendula formosa 8 Araliaceae Eleutherococcus divaricatus var. chiisanensis 9 Umbelliferae Angelica cartilagino-marginata var. distans 10 Oleaceae Fraxinus chiisanensis 11 Rubiaceae Asperula lasiantha 12 Caprifoliaceae Weigela subsessilis 13 Compositae Crepidiastrum koidzumianum 14 Cyperaceae Carex erythrobasis 15 Cyperaceae C. okamotoi 로형성된신고유종 (neo-endemics) 일것이기때문에개체군의 크기가축소되거나, 소집단상태를유지하는경향을보여보 전학적으로중요하다고하였다. 또한특산식물은다양한요인 에의해자생지의생육환경이위험해질수있어특별한관리 가필요한종이다 (Cuenca et al., 1999). 지리산국립공원은연 간약 3 백만명이상의탐방객이찾는곳이며, 세석지역에는 세석대피소가위치하고있어탐방객에의한생태계교란의 위험이특히높은지역이다. 또한기존의식물상을다룬연구 에서는특산식물의출현유무에만초점이맞춰져있었지만, 현지내 외보전을위한기초정보를제공하기위해자생지 주변의입지및생태적특성에대한분석까지이루어져야할 것이다 희귀식물 희귀식물은개체군의크기가극히적거나감소하여보존이 필요한식물로서일반적으로보호가필요한식물을의미하며, 유전적으로경쟁력이약한식물종들이기때문에, 특산식물과 마찬가지로관찰및관리가필요한종이다. IUCN 에서는멸종 (EW), 멸종위기종 (CR), 위기종 (EN), 취약종 (VU), 약관심종 (LC) 및자료부족종 (DD) 의범주로분류하고있다 (Korea National Arboretum, 2008). 지리산국립공원세석지역의희귀식물을등급별로보면, 멸종위기종은진퍼리잔대, 구름병아리난초 2분류군, 위기종은땃두릅나무, 흰참꽃나무, 나도씨눈란 3분류군, 취약종은가문비나무, 주목, 백리향, 나도제비란, 큰방울새란 5분류군, 약관심종은늦고사리삼, 구상나무, 세잎종덩굴, 금강제비꽃, 만병초, 꽃개회나무, 과남풀, 덩굴꽃마리, 금마타리 9 분류군등총 19분류군 (Table 3) 이출현하여희귀율 ( 희귀식물분류군수 / 출현식물의분류군수 100) 은 6.4%, 지리산국립공원희귀식물 66분류군 (Jang, 2007) 의약 29% 에해당한다. 희귀식물의보전전략을수립하기위해서는대상식물개체군에대한생태와분포범위, 크기, 동태등에관한서식처정보를통해보전지위평가가우선적으로이루어져야하지만, 객관적정보가수집되지못한실정이다. 희귀 특산식물인매미꽃자생지의생태적특성을분석한 Son et al.(2013) 의연구를제외하면지금까지희귀 특산식물에대해서는대상지역의관속식물상을다룬연구에서특정희귀 특산식물분류군의출현유무만을다룬연구들이대부분이었다. 향후현지내 외보전을위한기초정보를제공하기위해서라도희귀 특산식물자생지의서식처정보를다룬연구가많이이루어져야할것이다 귀화식물귀화식물은외국을원산지로하면서국내에들어와자생하고있는식물로, 주로인위적교란으로침입하는종이다. 귀화식물은자연생태계에대하여인간의간섭정도를직접적으로반영하는지표이며, 식물상조성의변화와자생식물과의경쟁관계등을나타내기도한다 (Oh and Kim, 2008). 본연구지에서출현한귀화식물은소리쟁이, 미국자리공, 토끼풀, 달맞이꽃, 돼지풀등총 5분류군 (Table 4) 으로, 귀화율 ( 귀화식물의분류군수 / 출현식물의분류군수 100) 은약 1.7% 로우리나라산지의평균귀화율 4.4%(Kim et al., 2000) 보다낮게나타나, 비교적산림이잘보존되어있는것으로판단된다. 세석대피소를이용하는많은탐방객의영향으로귀화율이높을것이라는예상과는달리귀화식물의출현율이낮은것은생태복원이후부터지속적인귀화식물제거등의관리가이루어진결과로판단된다. 본연구에서출현한귀화식물중끊어진뿌리나줄기에서도성체가발생하여자생식물의생육에피해를주는소리쟁이, 토양을산성화시키고생태계를파괴하는미국자리공, 개화기에꽃가루가호흡기질환의원인이되는돼지풀은아고산대의생태계와지리산국립공원을찾는탐방객에게피해를줄수있는식물로즉시제거등지속적인관리가필요한종이다. Journal of Climate Change Research 2017, Vol. 8, No. 3

5 지리산국립공원세석지역의아고산관속식물상 205 Table 3. The list of Korean rare plants in the survey area No. Family name Rare plants list (2010) 1 Valerianaceae Botrychium virginianum LC 2 Pinaceae Abies koreana LC 3 Pinaceae Picea jezoensis VU 4 Taxaceae Taxus cuspidata VU 5 Ranunculaceae Clematis koreana LC 6 Violaceae Viola diamantiaca LC 7 Araliaceae Oplopanax elatus EN 8 Ericaceae Rhododendron brachycarpum LC 9 Ericaceae Rhododendron tschonoskii EN 10 Oleaceae Syringa wolfii LC 11 Gentianaceae Gentiana triflora var. japonica LC 12 Boraginaceae Trigonotis icumae LC 13 Labiatae Thymus quinquecostatus VU 14 Valerianaceae Patrinia saniculaefolia LC 15 Campanulaceae Adenophora palustris CR 16 Orchidaceae Gymnadenia cucullata CR 17 Orchidaceae Herminium monorchis EN 18 Orchidaceae Orchis cyclochila VU 19 Orchidaceae Pogonia japonica VU CR: Critically endangered, EN: Endangered species, VU: Vul- nerable, LC: Least concerned. Table 4. The list of naturalized plants in the survey area No. Family name N.D Int.P. 1 Polygonaceae Rumex crispus Phytolaccaceae Phytolacca americana Leguminosae Trifolium repens Onagraceae Oenothera biennis Compositae Ambrosia artemisiifolia 5 2 N.D.: Naturalized degree, Int.P.: Introduced period (1: , 2: , 3: 1964-recent) 식물구계학적특정식물식물구계학적특정식물은그지역의생태적특성을분류하기위한지표이며, 서로유사한지역의환경을서로유사하게표현하는데이용된다 (Takhtajan, 1986). 식물구계학적특정식물 (Ministry of Environment, 2012) 을등급별로보면, 등급은땃두릅나무, 진퍼리잔대등 3분류군, 등급은털동자꽃, 지리터리풀, 산쥐손이등 7분류군, 등급은늦고사리삼, 진저리고사리, 족제비고사리등 24분류군, 등급은가래고사리, 동의나물, 털괭이눈등 19분류군, 등급은관중, 전나무, 잣나무등 19분류군등총 72분류군이출현하였다 (Table 5). 세석지역전체분류군의 24.4% 이며, 덕유산국립공원아고산대 ( 향적봉 -중봉) 의 32.1%(Han, 2013) 보다낮았으나, 남덕유산아고산대의 15.8%(Lee et al., 2013) 보다는높게나타났다. 본조사지역에나타난특정식물은지리산국립공원전체특정식물 121분류군 (Jang, 2007) 의약 60% 에해당한다. 식물구계학적특정식물중특이성이높아분포지에대한상세한조사가필요하다고알려진 등급이상식물은총 34분류군이나타났다. 식물구계학적특정식물은그지역의생태적특성을분류하고종보전순위의지표가될수있기때문에, 자생지에대한지속적인모니터링을통해기후변화에의한아고산대식물생태계보전및보호를위한방안을마련되어야할것이다. 3.3 아고산대식물지리산국립공원세석지역에분포하는아고산대식물을 Lee (2000), Lee(2003), Korea National Arboretum의국가생물종지식정보시스템의자료를참조하여정리한결과, 21과 29속 33종 1품종 3변종, 총 37분류군의아고산식물들이분포하는것으로확인되었다 (Table 6). 남덕유산에분포하는아고산식물 24분류군 (Lee, 2013) 보다많은분류군이나타났으며, 구상나무, 사스래나무, 시닥나무, 곰취, 마가목, 눈개승마, 흰송이풀, 미역줄나무, 과남풀, 흰참꽃나무, 산오이풀은두지역에서공통적으로출현한아고산식물이었다. 세석지역에서는이들아고산식물이세석에서촛대봉으로이어지는능선의암벽지대와구상나무군락에서주로나타났다. 본조사지인세석지역은구상나무군락이유지되고있기때문에구상나무군락및군락내식물자원보호를위해보호지역의확대, 탐방로정비등을통한보호조치및종자발아를통한개체수증식등적극적인보전대책이마련되어야할것이다. 아고산대는북방계식물들의잔존적피난처로아고산대에분포하는식물들은기후와의연관성이높아기후변화등의환경변화속도가빨라짐에따라생장량감소등으로멸종및절멸위험에크게노

6 206 노일 정재민 조민기 김태운 문현식 Table 5. The list of specific plant species in the survey area No. Family name Degree 1 Araliaceae Oplopanax elatus 2 Campanulaceae Adenophora palustris 3 Orchidaceae Gymnadenia cucullata 4 Caryophyllaceae Lychnis fulgens 5 Rosaceae Filipendulaformosa 6 Geraniaceae Geranium dahuricum 7 Aceraceae Acer pictum subsp. mono 8 Aceraceae Acer tegmentosum 9 Ericaceae Rhododendron tschonoskii 10 Oleaceae Syringa wolfii 11 Ophioglossaceae Botrychium virginianum 12 Dryopteridaceae Dryopteris maximowiczii 13 Dryopteridaceae Dryopteris varia 14 Pinaceae Abies koreana 15 Pinaceae Picea jezoensis 16 Taxaceae Taxus cuspidata 17 Betulaceae Betula costata 18 Ranunculaceae Clematis koreana 19 Theaceae Stewartia pseudocamellia 20 Cruciferae Cardamine amaraeformis 21 Crassulaceae Meterostachys sikokiana 22 Saxifragaceae Saxifraga oblongifolia 23 Rosaceae Sanguisorba hakusanensis 24 Aceraceae Acer barbinerve 25 Aceraceae Acer komarovii 26 Aceraceae Acer ukurunduense 27 Violaceae Viola diamantiaca 28 Umbelliferae Angelica gigas 29 Ericaceae Rhododendron brachycarpum 30 Oleaceae Syringareticulata var. mandshurica 31 Gentianaceae Swertia tetrapetala 32 Rubiaceae Asperula lasiantha 33 Labiatae Thymus quinquecostatus 34 Orchidaceae Herminium monorchis (3 taxa) (7 taxa) (24 taxa) (24 taxa) Table 6. The list of subalpine plants in the surveyed area No. Family 1 Pinaceae Abies koreana 2 Pinaceae Picea jezoensis 3 Taxaceae Taxus cuspidata 4 Betulaceae Betula ermanii 5 Betulaceae B. ermanii var. saitoana 6 Caryophyllaceae Lychnis cognata 7 Ranunculaceae Aconitum jaluense 8 Ranunculaceae Cimicifuga dahurica 9 Ranunculaceae C. simplex 10 Actinidiaceae Actinidia arguta 11 Rosaceae Aruncus dioicus var. kamtschaticus 12 Rosaceae Sanguisorba hakusanensis 13 Rosaceae Sorbus commixta 14 Oxalidaceae Oxalis obtriangulata 15 Geraniaceae Geranium dahuricum 16 Geraniaceae G. koreanum 17 Aceraceae Acer barbinerve 18 Aceraceae Acer tegmentosum 19 Aceraceae A. komarovii 20 Aceraceae A. ukurunduense 21 Celastraceae Euonymus sachalinensis 22 Celastraceae Tripterygium regelii 23 Violaceae Viola diamantiaca 24 Araliaceae Oplopanax elatus 25 Ericaceae Rhododendron brachycarpum 26 Ericaceae R. tschonoskii 27 Oleaceae Syringa wolfii 28 Gentianaceae Gentiana triflora var. japonica 29 Labiatae Thymus quinquecostatus 30 Scrophulariaceae Pedicularis resupinata 31 Scrophulariaceae P. resupinata for. albiflora 32 Caprifoliaceae Lonicera sachalinensis 33 Compositae Dendranthema sichotense 34 Compositae Ligularia fischeri Journal of Climate Change Research 2017, Vol. 8, No. 3

7 지리산국립공원세석지역의아고산관속식물상 207 Table 6. Continued No. Family 35 Compositae Saussurea grandifolia 36 Orchidaceae Gymnadenia cucullata 37 Orchidaceae Orchis cyclochila 출되어있는실정이다 (Chung et al., 2013). 특히아고산대에분포하는희귀식물은기후변화에따른영향에민감하게반응할수있는분류군이기때문에, 구상나무, 가문비나무, 주목, 금강제비꽃, 땃두릅나무, 만병초, 흰참꽃나무, 꽃개회나무, 과남풀, 백리향, 구름병아리난초, 나도제비란등에대해서는식물의정확한분포범위, 자생지의환경특성, 개체군동태등의생물학적특성이정량적으로평가되어야할것이다 (Son et al., 2013). 본연구는지리산국립공원세석지역의아고산식물상을분석하여향후기후변화에따른아고산대식물상변화를파악하기위한기초자료를구축하기위한것이다. 아고산대에대해서는구상나무, 가문비나무, 주목, 분비나무등침엽수림의식생구조및동태에관한연구가대부분이었지만, 식생구조보다는식물상변화에미치는기후변화의영향이더직접적일것으로판단된다. 향후정기적이고지속적인모니터링을통해아고산대식물상의변화와기후변화와의관련성을밝히기위한연구가이루어진다면, 아고산생태계의효율적인보전및관리방안을마련할수있을것으로기대된다. REFERENCES Cho MG, Chung JM, Jung HR, Kang MY, Moon HS Vegetation structure of Taxus cuspidata communities in subalpine zone. J Agric Life Sci 46:1-10. Cho MG, Chung JM, Jung HR, Kang MY, Moon HS Vegetation structure of Picea jezoensis communities in Mt. Deogyu and Mt. Gyebang. J Agric Life Sci 46: Cho MG, Chung JM, Kim TW, Kim CY, Noh I, Moon HS Ecological characteristics of Abies koreana forest on Seseok in Mt. Jiri. J Clim Chan Res 6: Cho MG, Chung JM, Im HI, Noh I, Kim TW, Kim CY, Moon HS Ecological characteristics of sub-alpine coniferous forest on Banyabong in Mt. Jiri. J Clim Chan Res 7: Choi HR Analysis of forest resources in Mt. Youngin arboretum development region and its floral investigation. MS Thesis, Sangmyeong University. p 91. Chung JM, Son SW, Kim SY, Park GW, Kim SS Genetic diversity and geographic differentiation in the endangered Primula farinosa subsp. modesta, a subalpine endemic to Korea. Korean J Pl Taxon 43: Cuenca S, Amo-Marco JB, Parra R Micro-propagation form inflorescence stems of the Spanish endemic plant Cnetaurea paui Loscos ex Willk (Compositae). Plant Cell Reports 18: Gwon JH, Sin MK, Lee KH, Song HK The pteridophytes flora of Jirisan National Park, Korea. Kor J Env Ecol 27: Han SH A study of the flora and forest vegetation classification of Hyangjeukbong to Jungbong in subalpine zone of Deogyusan National Park. MS Thesis, Gongju University. p 49. Jang CG, Kim YY, Ji SJ, Ko EM, Yang JC, Jang CS, Eom JA, Yoon CY, Chang CS, Lee CH, Kim KS, Oh BU The floristic study of Chirisan National Park in Korea. Korean J Pl Taxon 37: Iijima H, Shibuya M, Saito H Examination of the coexistence mechanism of two major conifers in Hokkaido, northern Japaj, based on differences in suitable germination conditions and shade tolerance. Ecoscience 16: Kayama M, Makoto K, Nomura N, Sasa K, Koike T Growth characteristics of Sakhalin spruce (Picea glehnii) planted on the northern Japanese hillsides exposed to strong winds. Trees 23: Kim CH, Cho MG, Kim JK, Choi MS, Chung JM, Kim JH, Moon HS Vegetation change and growing characteristics of Abies koreana population by altitude in Georim valley of Mt. Jiri. J Agric Life Sci 46:1-8. Kim JH, Kim YH, Yoon YC, Kim JH The flora of Mt. Biseul in Daegu. Kor J Env Eco 22: Kim JM, Yim YJ, Jeon ES Naturalized plants of Korea. Science Books, Seoul. p 272. Kim NS, Lee HC A study on changes and distributions of Korean fir in sub-alpine zone. Kor Soc For Env Res Rev Tec 16: Kim WT A study on the variation in floral diversity of Geumosan according to climate change. Dissertation,

8 208 노일 정재민 조민기 김태운 문현식 Daegu Haany University. p 80. Ko KS, Kang IG, Suh MH, Kim JH, Kim DG, Kil GH, Jeon ES Survey for ecological impact by naturalized organisms. Natural Institute of Environmental Research pp Kong WS The distributional patterns of alpine plants of Mt. Halla. Cheju island, Korea. J Kor Geo Soc 32: Kong WS Biogeography of Korean plants. Geobook, Seoul. p 355. Korea Forest Service, Korea National Arboretum Rare plants data book in Korea. Korea National Arboretum. p 332. Korea Meteorological Adminstration go.kr Korea National Arboretum Illustrated pteridophytes of Korea. p 548. Lee DH, Jin DP, Lee JH, Choi IS, Choi BH Floristic study of Mt. Namdeogyu. Korean J Pl Taxon 43: Lee HY The phytosociological characteristics of Abies nephrolepis community and population dynamics as climate condition changes in Mt. Seorak, Korea. Dissertation, Dongguk University. p 184. Lee SG Effects of temperature increases on the distribution of plants and vulnerability analysis. MS Thesis, Kyunghee University. p 284. Lee TB Coloured flora of Korea. Hyangmunsa. Seoul. Lee YM, Park SH, Jung SY, Oh SH, Yang JC Study on the current status of naturalized plants in South Korea. Korean J Pl Tax 41: Lee YN Alpine flowers of Korea. Kyohak Publishing Co., Seoul. Melchoir H A engler s syllabus der pflanzenfamilien. Band. Gebruder Borntraeger. p Ministry of Environment The 4th national environmental survey guidelines. Ministry of Environment. p 486. Noh I Ecological characteristics of subalpine coniferous forest in Jirisan National Park. Dissertation, Gyeongsang University. p 108. Oh BU, Jo DG, Kim KS, Kang CG Endemic vascular plants in the Korean Peninsula. Korea National Arboretum, Pocheon. Oh HK, Kim HJ, The plant resources of the sand dune on southern coast and Jeju Island. Korean J Pl Res 21: Oh HK, You JH The basic study for developing plant ecological indices of Sacheon-si, Gyeongsangnam-do. J Env Imp Ass 21: Son SW, Choi KS, Park KT, Kim EH, Park SJ Genetic diversity and structure of the Korean rare and endemic species, Deutzia paniculata Nakai, as revealed by ISSR markers. Korean J Pl Res 26: Takhtajan A Floristic regions of world. University California Pre 20: Journal of Climate Change Research 2017, Vol. 8, No. 3

9 지리산국립공원세석지역의아고산관속식물상 209 Appendix 1. The vascular plants list of this study Lycopodiaceae Ophioglossaceae Pteridaceae Dryopteridaceae Aspleniaceae Polypodiaceae Pinaceae Taxaceae Salicaceae Betulaceae Fagaceae Urticaceae Polygonaceae Phytolaccaceae Caryophyllaceae Chenopodiaceae Magnoliaceae Schisandraceae Ranunculaceae Berberidaceae Lardizabalaceae Aristolochiaceae Actinidiaceae Theaceae Guttiferae Fumariaceae Cruciferae Lycopodium serratum Botrychium virginianum Dennstaedtia hirsuta, Pteridium aquilinum var. latiusculum Arachniodes borealis, Athyrium vidalii, Deparia conilii, D. coreana, D. crassirhizoma, D. maximowiczii, D. varia, Onoclea orientalis, Polystichum tripteron, Thelypteris japonica, T. palustris, T. phegopteris, Woodsia manchuriensis Asplenium yokoscense Lepisorus ussuriensis Abies holophylla, A. koreana, Larix kaempferi, Picea jezoensis, Pinus densiflora, P. koraiensis Taxus cuspidata Salix caprea, S. gracilistyla, S. koreensis, S. koriyanagi Betula costata, B. ermanii, B. ermanii var. saitoana, Corylus sieboldiana var. mandshurica Quercus mongolica Pilea japonica Bistorta incana, Fallopia japonica, Persicaria hastatosagittata, P. nepalensis, Rumex acetosa, R. crispus Phytolacca americana Cerastium holosteoides var. hallaisanense, Cucubalus baccifer var. japonicus, Lychnis cognata, L. fulgens, Pseudostellaria heterophylla, P. palibiniana, Stellaria media Chenopodium album var. centrorubrum Magnolia sieboldii Schisandra chinensis Aconitum chiisanense, A. jaluense, A. pseudolaeve, A. triphyllum, Actaea asiatica, Caltha palustris, Cimicifuga dahurica, C. simplex, Clematis apiifolia, C. heracleifolia var. davidiana, C. koreana, Thalictrum aquilegifolium var. sibiricum, T. filamentosum var. tenerum Berberis amurensis Akebia quinata Asarum sieboldii Actinidia arguta, A. kolomikta, A. polygama (Siebold & Zucc.) Stewartia pseudocamellia Hypericum ascyron, H. attenuatum var. confertissium, H. erectum Corydalis remota Arabis gemmifera, Cardamine amaraeformis, C. komarovii

10 210 노일 정재민 조민기 김태운 문현식 Appendix 1. Continued Crassulaceae Saxifragaceae Rosaceae Leguminosae Oxalidaceae Geraniaceae Aceraceae Balsaminaceae Celastraceae Vitaceae Tiliaceae Violaceae Onagraceae Cornaceae Araliaceae Umbelliferae Pyrolaceae Ericaceae Primulaceae Styracaceae Symplocaceae Oleaceae Gentianaceae Hylotelephium erythrostictum, Meterostachys sikokiana, Sedum aizoon, S. kamtschaticum, S. polytrichoides Astilbe rubra, Chrysosplenium pilosum, Deutzia glabrata, D. parviflora, D. uniflora, Hydrangea serrata f. acuminata, Parnassia palustris, Philadelphus schrenkii, Ribes mandshuricum, R. maximowiczianum, Saxifraga fortunei var. incisolobata, S. oblongifolia Agrimonia pilosa, Aruncus dioicus var. kamtschaticus, Filipendula formosa, F. glaberrima, Geum aleppicum, Geum japonicum, Malus baccata, M. baccata var. mandshurica, Rubus crataegifolius, Sanguisorba hakusanensis, Sorbus alnifolia, S. commixta Lespedeza bicolor, L. cyrtobotrya, Maackia amurensis, Trifolium repens Oxalis corniculata, O. obtriangulata Geranium dahuricum, G. koreanum, G. sibiricum, G. wilfordii Acer barbinerve, A. komarovii, A. pictum subsp. mono, A. pseudosieboldianum, A. tegmentosum, A. ukurunduense Impatiens nolitangere, I. textori Celastrus orbiculatus, Euonymus macropterus, E. oxyphyllus, E. pauciflorus, E. sachalinensis, Tripterygium regelii Vitis amurensis, V. ficifolia var. sinuata Tilia amurensis, T. taquetii Viola diamantiaca, V. japonica, V. mandshurica, V. orientalis, V. rossii Epilobium pyrricholophum, Oenothera biennis Cornus controversa Aralia elata, Eleutherococcus divaricatus var. chiisanensis, Kalopanax septemlobus, Oplopanax elatus Angelica amurensis, A. cartilagino-marginata var. distans, A. decursiva, A. gigas, A. polymorpha, Bupleurum longeradiatum, Heracleum moellendorffii, Pimpinella brachycarpa, P. koreana, Pleurospermum camtschaticum Chimaphila japonica Rhododendron brachycarpum, R. mucronulatum, R. schlippenbachii, R. tschonoskii, R. yedoense for. poukhanense, Vaccinium hirtum var. koreanum Lysimachia barystachys, L. clethroides Styrax obassia Symplocos chinensis f. pilosa Fraxinus chiisanensis, F. rhynchophylla, F. sieboldiana, Syringa patula, S. reticulata var. mandshurica, S. wolfii Gentiana scabra, G. triflora var. japonica, Swertia pseudochinensis, Asperula lasiantha, Paederia scandens Journal of Climate Change Research 2017, Vol. 8, No. 3

11 지리산국립공원세석지역의아고산관속식물상 211 Appendix 1. Continued Boraginaceae Verbenaceae Labiatae Scrophulariaceae Plantaginaceae Caprifoliaceae Valerianaceae Campanulaceae Compositae Gramineae Cyperaceae Orchidaceae Trigonotis icumae Callicarpa japonica Isodon excisus, I. excisus var. chiisanensis, I. excisus var. coreanus, Meehania urticifolia, Prunella vulgaris var. lilacina, Scutellaria pekinensis var. transitra, Thymus quinquecostatus Euphrasia hirtella, Melampyrum roseum, M. roseum var. ovalifolium, Pedicularis resupinata f. albiflora, P. resupinata, Phtheirospermum japonicum, Scrophularia kakudensis, Veronica linariifolia, V. rotunda var. subintegra Plantago asiatica Lonicera cerasoides, L. sachalinensis, L. vidalii, Sambucus williamsii var. coreana, Viburnum erosum, V. opulus var. calvescens, Weigela florida, W. subsessilis Patrinia saniculaefolia, P. scabiosaefolia, P. villosa, Valeriana fauriei Adenophora palustris, A. remotiflora, A. remotiflora for. leucantha, A. verticillata Adenocaulon himalaicum, Artemisia japonica, A. keiskeana, A. montana, A. princeps, A. stolonifera, Aster ageratoides, A. meyendorfii, A. scaber, Atractylodes ovata, Cirsium japonicum var. maackii, C. pendulum, Crepidiastrum denticulatum, C. koidzumianum, Dendranthema sichotense, D. zawadskii, Eupatorium japonicum, Hieracium umbellatum, Lactuca raddeana, Leibnitzia anandria, Ligularia fischeri, Parasenecio auriculata var. kamtschatica, P. auriculata var. matsumurana, Saussurea gracilis, S. grandifolia, Serratula coronata var. insularis, Solidago virgaurea subsp. asiatica, Syneilesis palmata, S. deltoides, S. excelsus Agrostis clavata, A. clavata var. nukabo, Agrostis flaccida var. trinii, Arundinella hirta, Brachypodium sylvaticum, Calamagrostis arundinacea, Digitaria ciliaris, Echinochloa crusgalli, Festuca ovina, F. subulata var. japonica, Miscanthus sinensis, M. sinensis var. purpurascens, Molinia japonica, Muhlenbergia japonica, Oplismenus undulatifolius, Paspalum thunbergii, Poa sphondylodes, Spodipogon cotulifer, S. sibiricus Carex erythrobasis, C. fernaldiana, C. hakonensis, C. humilis var. nana, C. lanceolata, C. leiorhyncha, C. nervata, C. okamotoi, C. planiculmis, C. sabynensis, C. siderosticta, C. tenuiformis, Rhynchospora alba, Scleria parvula Cephalanthera longibracteata, Gymnadenia cucullata, Herminium monorchis, Orchis cyclochila, Platanthera freynii, P. hologlottis, Pogonia japonica

12

도감본문(수정)~10p

도감본문(수정)~10p 두번째이야기 덩굴나무 두번째이야기덩굴나무 6 00 Pinus densiflora Siebold & Zucc. 4 5 6 6 5 4 7 8 9 P. densiflora P. densiflora for. multicaulis P. densiflora for. erecta 0 6 산에서자주만나는큰키나무 덩굴나무 8 산에서자주만나는큰키나무 덩굴나무 덩굴나무차례 9

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012년전국자연환경조사 - 식물 - 김영동 - 태백 목명과명출현종태백 (378164) 도엽특이사항영문한글영문한글학명국명 E8 E9 Lycopodiales 석송문 Lycopodiaceae 석송과 Huperzia selago 좀다람쥐꼬리 식물구계학적등급 (Ⅳ) Lycopodiales 석송문 Lycopodiaceae 석송과 Lycopodium

More information

UM00003782.PDF

UM00003782.PDF 1 북한 산림 생태계의 지속가능한 관리 방안에 관한 연구 강 호 상 (서울대 객원연구원) 목 차 요약문 3 1. 서 론 5 2. 북한의 자연자원 8 3. 북한의 산림자원 16 4. 북한의 산림황폐화 원인 및 현황 18 5. 훼손된 북한 산림생태계의 복원 25 6. 장기생태연구지 설정 및 연구 31 7. 동북아시아 국가간 산림 network 조성 및 교류 협력

More information

Journal of Climate Change Research 2015, Vol. 6, No. 4, pp DOI: * ** *** *** * ***, *, **, ***

Journal of Climate Change Research 2015, Vol. 6, No. 4, pp DOI:   * ** *** *** * ***, *, **, *** Journal of Climate Change Research 2015, Vol. 6, No. 4, pp. 379 388 DOI: http://dx.doi.org/10.15531/ksccr.2015.6.4.379 * ** *** *** * ***, *, **, *** ( ) Ecological Characteristics of Abies koreana Forest

More information

이상훈 심재국 Vegetation of Mt. Yeonin Provincial Park Department of Life Science, Chung-Ang University The forest vegetation of Mt. Yeonin Provincial Park

이상훈 심재국 Vegetation of Mt. Yeonin Provincial Park Department of Life Science, Chung-Ang University The forest vegetation of Mt. Yeonin Provincial Park 이상훈 심재국 Vegetation of Mt. Yeonin Provincial Park Department of Life Science, Chung-Ang University The forest vegetation of Mt. Yeonin Provincial Park was surveyed from August 2016 to October 2016. The

More information

13-ºÎ·Ï¸ðÀ½-0312

13-ºÎ·Ï¸ðÀ½-0312 Pinus thunbergii Parlatore Abies holophylla Maximowicz Pinus densiflora Siebold et Zuccarini Juniperus chinesis Linnaeus Pinus densiflora for. erecta Uyeki Juglans mandshurica Maximowicz Ginkgo biloba

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012년전국자연환경조사 - 식물 - 심정기 - 도곡 목명과명출현종도곡 (377162) 도엽특이사항영문한글영문한글학명국명 E1 E2 E4 E5 Equisetales 속새목 Equisetaceae 속새과 Equisetum arvense 쇠뜨기 Filicales 고사리목 Aspleniaceae 꼬리고사리과 Athyrium iseanum

More information

Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard by Yoo Kyung Lee, Gyu Lee, Eun Ju Lee 다산과학기지 주변에서 볼 수 있는 북극 식물 Arctic Plants living in N

Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard by Yoo Kyung Lee, Gyu Lee, Eun Ju Lee 다산과학기지 주변에서 볼 수 있는 북극 식물 Arctic Plants living in N 다산과학기지 주변에서 볼 수 있는북극 식물 Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard 북극식물-본문p001-019(0409).indd 1 2012-04-10 오후 4:36: Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard by Yoo

More information

韓資植誌 Korean J. Plant Res. 24(5) : 549~556(2011) Chen, 2002; Walther et al., 2002; Lee et al., 2009). 기후변화에따른생물계절변화연구는장기간의모니터링을통해이루어지며, 계절변화연구는최근기후변화와기

韓資植誌 Korean J. Plant Res. 24(5) : 549~556(2011) Chen, 2002; Walther et al., 2002; Lee et al., 2009). 기후변화에따른생물계절변화연구는장기간의모니터링을통해이루어지며, 계절변화연구는최근기후변화와기 연구논문韓資植誌 24(5) : 549~556(2011) Korean J. Plant Res. 한반도아고산지대내기후변화취약식물종의식물계절성변화연구 - 덕유산정상지역을중심으로 - 김혁진, 홍정기, 김상철, 오승환 1, 김주환 * 경원대학교생명과학과, 1 국립수목원 Plant Phenology of Threatened species for Climate change

More information

11.hwp

11.hwp 23(3): 281 291, 2000 Korean J. Ecol. 금강송림의식생구조에관한정량적분석 윤충원 홍성천 적요 :,,,. 1) CCA,,,.,.,,. 2),,,,,.,. 3) 0.6622, 0.7,. 4), 0.6. 5).,. 검색어 :,, CCA,,,, 서론 1950 (classification) (ordination) (GreigSmith 1983),.

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012 년전국자연환경조사 - 식물 - 이두범 - 경주 목명과명출현종경주 (359014) 도엽특이사항영문한글영문한글학명국명 E7 Selaginellales 부처손목 Selaginellaceae 부처손과 Selaginella tamariscina 부처손 Equisetales 속새목 Equisetaceae 속새과 Equisetum arvense

More information

< C1A4C8EFB6F42E687770>

< C1A4C8EFB6F42E687770> J. Ecol. Field Biol. 29 (3): 265 275, 2006 대구인접지역삼림식생의진행천이와잠재자연식생 정흥락 * 전영문 1 이호준 1, 1 Progressive Succession and Potential Natural Vegetation on the Forest Vegetation in and surrounding Daegu, Korea Choung,

More information

7(3)-03.fm

7(3)-03.fm w» wz, 7«3y(2005) Korean Journal of Agricultural and Forest Meteorology, Vol. 7, No. 3, (2005), pp. 201~210 ½ 1 Á v 2 Á 2 Á 1 Á Ÿ 1 Á½ y 2 1 w ù, 2 w w (2005 2 15 ; 2005 8 19 ) The Vegetation Structure

More information

2011국립공원표지-수정

2011국립공원표지-수정 KOREA NATIONAL PARK SERVICE For the nature as it is, for the future generations Tel : 02-3279-2700, 02-3279-2701 Fax: 02-3278-2785~6 E-mail: webmaster@knps.or.kr www.knps.or.kr About This Reports Contents

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012년전국자연환경조사 - 식물 - 손현덕 - 완도 목명과명출현종완도 (346114) 도엽특이사항영문한글영문한글학명국명 E2 Ophioglossales 고사리삼목 Ophioglossaceae 고사리삼과 Botrychium ternatum 고사리삼 Filicales 고사리목 Osmundaceae 고비과 Osmunda japonica

More information

2_11_24 김준수.hwp

2_11_24 김준수.hwp 농업생명과학연구 45(3) pp.9-18 Journal of Agriculture & Life Science 45(3) pp.9-18 비룡산 신갈나무림의 식물 다양성 김준수 1 홍진기 1 김경수 1 조용찬 2 배관호 3* 1 경북대학교 과학기술대학원 산림환경자원학과, 2 국립수목원, 3 경북대학교 생태환경시스템학부 접수일(2011년 03월 04일), 수정일(2011년

More information

03-서연옥.hwp

03-서연옥.hwp 농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥

More information

< C2F7C6EDC1FD BDC3C7E8BFACB1B8BAB8B0EDBCAD2E687770>

< C2F7C6EDC1FD BDC3C7E8BFACB1B8BAB8B0EDBCAD2E687770> 어젠다코드 4-16 - 56 구 분 과제완결 기술분야코드 V2 기술유형코드 P01 작목구분코드 LP-02-4130 과제종류 공동연구 세세부사업 국책기술개발 연구과제및세부과제 수행기간 과제책임자및세부책임자 설사방지및항원충성항생제대체물질개발 10~ 12 국립축산과학원 김동운 2) 항생제대체물질개발을위한식물자원탐색및공급체계확립 10~ 12 인삼약초연구소이광재 색인용어

More information

386-390.hwp

386-390.hwp 386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon

More information

03이경미(237~248)ok

03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information

untitled

untitled 11-1400119-000205-01 THE FOREST EDUCATION PROGRAM THE FOREST EDUCATION PROGRAM 93520 9 788997 450602 ISBN 978-89-97450-60-2 THE FOREST EDUCATION PROGRAM 20149 031-540-2000 415 aplan Tomorrow FOUR SEASONS

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012년전국자연환경조사 - 식물 - 안진갑 - 진도 목명과명출현종진도 (346101) 도엽특이사항영문한글영문한글학명국명 E2 Selaginellales 부처손목 Selaginellaceae 부처손과 Selaginella tamariscina 부처손 Ophioglossales 고사리삼목 Ophioglossaceae 고사리삼과 Botrychium

More information

목차 ⅰ ⅱ ⅱ ⅳ i

목차 ⅰ ⅱ ⅱ ⅳ i 11-1480523-000900-01 온난화환경에서의생태계영향연구 (II) 환경자원연구부자연평가연구팀, 대기환경연구과 1), 건국대학교 2) 서울대학교 3) 제주대학교 4), 충북대학교 5), 국립공원연구원 6) 2011 목차 ⅰ ⅱ ⅱ ⅳ i 목차 ii 목차 iii Abstract iv Ⅰ. 서론 Ⅰ 2 2 1 Ⅱ. 연구내용및방법 Ⅱ.

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 목명과명출현종추자 (336021) 도엽특이사항영문한글영문한글학명국명 E1 E2 E5 E6 Selaginellales 부처손목 Selaginellaceae 부처손과 Selaginella involvens 바위손 Ophioglossales 고사리삼목 Ophioglossaceae 고사리삼과 Botrychium virginianum 늦고사리삼 식물구계학적등급 (Ⅰ)

More information

433대지05박창용

433대지05박창용 Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This

More information

박선주.fm

박선주.fm 자연보존 173 : 22-33 ; 2016 년 5 월 운문산생태 경관보전지역의특정식물및귀화식물연구 1) 박선주 송임근 2) 영남대학교생명과학과 서론 운문산은가지산 (1,240 m), 천황산 (1,189 m), 재약산 (1,108 m) 등과더불어해발 1,000 m 이상의고봉에둘러싸여있고, 영남의 7산중의하나이며, 경상남 북도의경계를이루는성현산맥 ( 省峴山脈 )

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

358051_마상_식물상_종목록.xlsx

358051_마상_식물상_종목록.xlsx 2014년전국자연환경조사-식물-고성철과명출현종영문한글학명국명 특이사항 도엽명 SOLANACEAE 가지과 Solanum nigrum var. nigrum L. 까마중 마상 (358051) RHAMNACEAE 갈매나무과 Rhamnus yoshinoi Makino 짝자래나무 마상 (358051) EBENACEAE 감나무과 Diospyros lotus L. 고욤나무

More information

이웅빈 A Flora of Mt. Umyeon Department of Biological Science, Yongin University Mt. Umyeon is located between Seocho-gu in Seoul and Gwacheon-si in Gyeo

이웅빈 A Flora of Mt. Umyeon Department of Biological Science, Yongin University Mt. Umyeon is located between Seocho-gu in Seoul and Gwacheon-si in Gyeo 이웅빈 A Flora of Mt. Umyeon Department of Biological Science, Yongin University Mt. Umyeon is located between Seocho-gu in Seoul and Gwacheon-si in Gyeonggi-do. The investigated vascular plants consist of

More information

R hwp

R hwp 목적기초연구 1 * Anticomplement Activities of Korean Indigeneous Plants No. Plant name Srientific name Family Activity(IC50) 98112 해변싸리 Lespedeza martrima 콩과 12.2 96019 지리산오갈피 Acanthopamax chiisanensis

More information

101.fm

101.fm Journal of Korean Nature Vol. 3, No. 1 1-10, 2010 Dispersion of Vascular Plant in Mt. Huiyangsan, Korea Hyun-Tak Shin 1, Sung-Tae Yoo 2, Byung-Do Kim 2, and Myung-Hoon YI 3 * 1 Gyeongsangnam-do Forest

More information

조경식재학 - 식재재료(2) -

조경식재학 - 식재재료(2) - 조경식재설계 2 - 조경식물 ( 목본 )- 1. 자작나무 음양성 : 양수 건습성 : 건조 자작나무 Betula platyphylla var. japonica 번식 : 실생, 삽목 성상 : 낙엽활엽교목 수형 : 원추형 백색의수피, 황색단풍 강조, 유도, 차폐, 녹음식재 2. 서어나무 음양성 : 음수 생장속도 : 중간 건습성 : 건조 서어나무 Carpinus laxiflora

More information

17(2)-08.fm

17(2)-08.fm ª Ÿ (Korean J. Medicinal Crop Sci.) 17(2) : 125 132 (2009) ù k p ¼ÁÁÁkÁÁÁ½y w ww Ecological Characteristics of the Asparagus cochinchinensis (Lour.) Merr. Population in South Korea Byung Kil Choo, Yunui

More information

도엽별출현종 _ 통계 년전국자연환경조사 - 식물 - 박재홍 - 남원 목명과명출현종남원 (357102) 도엽특이사항영문한글영문한글학명국명 E2 SELAGINELLALES 부처손목 SELAGINELLACEAE 부처손과 Selaginella involvens 바

도엽별출현종 _ 통계 년전국자연환경조사 - 식물 - 박재홍 - 남원 목명과명출현종남원 (357102) 도엽특이사항영문한글영문한글학명국명 E2 SELAGINELLALES 부처손목 SELAGINELLACEAE 부처손과 Selaginella involvens 바 도엽별출현종 _ 통계 - 2013 년전국자연환경조사 - 식물 - 박재홍 - 남원 목명과명출현종남원 (357102) 도엽특이사항영문한글영문한글학명국명 E2 SELAGINELLALES 부처손목 SELAGINELLACEAE 부처손과 Selaginella involvens 바위손 식물구계학적등급 (Ⅲ) OPHIOGLOSSALES 고사리삼목 OPHIOGLOSSACEAE

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012 년전국자연환경조사 - 식물 - 유기억 - 영월 목명과명출현종영월 (378142) 도엽특이사항영문한글영문한글학명국명 E6 Equisetales 속새목 Equisetaceae 속새과 Equisetum arvense 쇠뜨기 Filicales 고사리목 Dennstaedtiaceae 잔고사리과 Dennstaedtia wilfordii

More information

02À±¼ø¿Á

02À±¼ø¿Á Geomorphic Development of Marine Terraces at Jeongdongjin-Daejin area on the East Coast, Central Part of Korean Peninsula Soon-Ock Yoon*, Sang-Ill Hwang** and Hak-Kyun Ban*** Abstract : In this paper we

More information

Method Country Vegetation type Reference AA Japan Quercus-mixed Kirita(1971) Japan Quercus-mixed Nakane(1975) CC China glassland Jia et al.(2006) Japan deciduous forest Hirano e tal.(2003) USA hardwood

More information

< D FBDC3C7E8BFACB1B8BAB8B0EDBCAD E687770>

< D FBDC3C7E8BFACB1B8BAB8B0EDBCAD E687770> 어젠다코드 1-7 - 22 구 분 세부완결 기술분야코드 V1 기술유형코드 S04 작목구분코드 PG-03-PG31 과제종류 기관고유 세세부사업 - 연구과제및세부과제 수행기간 과제책임자및세부책임자 자생식물자원화기반구축 09~ 13 농식품연구소 김희연 식물기원추출물은행및생리활성 library 작성 09~ 13 농식품연구소 김희연 색인용어 자원식물, 추출물 ABSTRACT

More information

102(1)-00(74).fm

102(1)-00(74).fm Jour. Korean For. Soc. Vol. 102, No. 1, pp. 1~21 (2013) JOURNAL OF KOREAN FOREST SOCIETY w p š 1 Á¼ 1 Á½ { 2 Á 1 1 w w w w, 2 s w w w A Reconsideration of the List of National Endemic Plants (appendix

More information

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

조경식물학 - 활엽수 계열(3) -

조경식물학 - 활엽수 계열(3) - 조경식물학 - 활엽수계열 (2) - 1. 서부해당화 음양성 : 양수 서부해당화 Malus prunifolia 성상 : 낙엽활엽소교목 수형 : 구형 번식 : 실생 / 접목 적색의꽃, 적색열매가아름다움 기조, 강조식재 2. 마가목 음양성 : 음수 마가목 Sorbus commixta 수형 : 타원형 이식 : 어려움 전정 : 보통 번식 : 실생 / 접목 / 취목 흰색꽃과적색열매가아름다움

More information

58 Journal of Agriculture & Life Science 46(4) Ⅰ. 서론곰솔 (Pinus thunbergii Parl.) 은바닷가와해풍의 영향이미치는곳에서자생하고있으며, 분포범위는북위 에서 까지분포하고있다 (Kim & Kil,

58 Journal of Agriculture & Life Science 46(4) Ⅰ. 서론곰솔 (Pinus thunbergii Parl.) 은바닷가와해풍의 영향이미치는곳에서자생하고있으며, 분포범위는북위 에서 까지분포하고있다 (Kim & Kil, 농업생명과학연구 46(4) pp.57-68 Journal of Agriculture & Life Science 46(4) pp.57-68 경상북도동해안곰솔림의군집구조 천광일 1 정성철 1* 윤호중 1 변준기 2 주성현 3 1 국립산림과학원산림보전부, 2 국립수목원, 3 경북대학교임학과 접수일 년 월 일 수정일 년 월 일 게재확정일 년 월 일 Community

More information

09-감마선(dh)

09-감마선(dh) Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected

More information

???춍??숏

???춍??숏 Suseong gu Council Daegu Metropolitan City www.suseongcouncil.daegu.kr Contents SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY 10 www.suseongcouncil.daegu.kr 11 SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY

More information

<C3D6C1BEBAB8B0EDBCAD5FC7A5C1F62E687770>

<C3D6C1BEBAB8B0EDBCAD5FC7A5C1F62E687770> 훼손된 자연생태계 복원기술 Restoration Technology of Damaged Ecosystem 도시녹지공간의 생태 corridor 설계기법 Development of Design Technology for the Eco-corridor in Urban Area 고려대학교 환 경 부 보고서 초록 연구과제명 코드번호 (국문) 도시녹지공간의 생태 corridor

More information

인문사회과학기술융합학회

인문사회과학기술융합학회 Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement

More information

Programs The 201 EABCN symposium will be held on 13 October and two-day field trips will be arranged at October. A side event is also planned to

Programs The 201 EABCN symposium will be held on 13 October and two-day field trips will be arranged at October. A side event is also planned to THE 201 EABCN SYMPOSIUM Program Book 9-1 October 201 Republic of Korea East Asia Biodiversity Conservation Network Published by Korea National Arboretum Programs The 201 EABCN symposium will be held on

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

조경식물학 - 활엽수 계열(2) -

조경식물학 - 활엽수 계열(2) - 조경식물학 - 상록활엽수외 - 1. 녹나무 내한성 : 약함 음양성 : 중용수 녹나무 Cinnamomum camphora 성상 : 상록활엽교목 수형 : 타원형 분포 : 난온대지역 이식 : 어려움 번식 : 실생 / 삽목 대기정화능력우수, 환경정화수 기조, 녹음, 가로수, 방풍, 방화식재 2. 생달나무 내한성 : 약함 음양성 : 음수 생달나무 Cinnamomum

More information

7(4)-10.fm

7(4)-10.fm w» wz, 7«4y(2005) Korean Journal of Agricultural and Forest Meteorology, Vol. 7, No. 4, (2005), pp. 303~310 y 1 Á z 2 Á½ 1 1 w y w, 2 w w (2005 11 29 ; 2005 12 7 ) Vegetation Composition and Structure

More information

untitled

untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information

04_이근원_21~27.hwp

04_이근원_21~27.hwp 1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일

More information

옥천 일대의 지형

옥천  일대의  지형 1 덕곡일대의식물 덕곡 (358014) 일대의식물 - 문수봉 - 김휘 곽지훈 국립목포대학교 요약 1 덕곡면문수봉조사지역에자생하는관속식물은 66 과 155 속 192 분류군으로나타났다 2 덕곡면문수봉에서는환경부지정멸종위기종은확인할수없었다. 특정식물종 5 급은확인되지않았다. 식물구계학적 3 환경부식물구계학적특정식물종 4급으로는선포아풀이있었고 3등급으로는물박달나무다수개체가확인되었다.

More information

untitled

untitled 1 2 3 4 5 006 009 020 024 028 032 036 040 044 050 056 064 070 086 090 188 192 195 199 202 205 209 212 214 219 102 110 224 6 7 6 008 9 8 9 9 10 10 11 11 12 12 13 13 14 14 15 15 16 16 17 17 18 19 파주 20 1)

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words

More information

<342EB1E8BCBAB9CE2D2E666D>

<342EB1E8BCBAB9CE2D2E666D> 韓藥作誌 (Korean J. Medicinal Crop Sci.) 2(4) : 268 275 (203) ISSN(Print) 225-9306 ISSN(Online) 2288-086 http://www.medicinalcrop.org http://dx.doi.org/0.7783/kjmcs.203.2.4.268 봉화군청옥산에분포하는대한민국약전수재약용식물의분포특성

More information

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770> Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*

More information

변화근 Fish Fauna of Mt. Juheul Department of Biology Education, Seowon University, Cheongju , Korea To clarify the structures and functions of ec

변화근 Fish Fauna of Mt. Juheul Department of Biology Education, Seowon University, Cheongju , Korea To clarify the structures and functions of ec 변화근 Fish Fauna of Mt. Juheul Department of Biology Education, Seowon University, Cheongju 361-742, Korea To clarify the structures and functions of ecosystem and to establish the methods for the conservation

More information

04김호걸(39~50)ok

04김호걸(39~50)ok Journal of Environmental Impact Assessment, Vol. 22, No. 1(2013) pp.39~50 Prediction of Landslides Occurrence Probability under Climate Change using MaxEnt Model Kim, Hogul* Lee, Dong-Kun** Mo, Yongwon*

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Dec.; 27(12), 1036 1043. http://dx.doi.org/10.5515/kjkiees.2016.27.12.1036 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)

More information

Analysis of teacher s perception and organization on physical education elective courses Chang-Wan Yu* Korea Institute of curriculum and evaluation [Purpose] [Methods] [Results] [Conclusions] Key words:

More information

1. KT 올레스퀘어 미디어파사드 콘텐츠 개발.hwp

1. KT 올레스퀘어 미디어파사드 콘텐츠 개발.hwp Journal of Next-generation Convergence Information Services Technology Vol.4, No.1, June (2015), pp. 1-8 차세대컨버전스정보서비스기술논문지 KT 올레스퀘어 미디어파사드 콘텐츠 개발 Media Fasade Contents Development of KT Olleh Square 김동조

More information

12 Korean Journal of Agricultural and Forest Meteorology, Vol. 16, No. 1 다 (Kim et al., 2012). 여러가지생물종이어우러져구성된생물군집은종간상호작용이다양할것이므로종다양성이높은군집은구조적으로복잡할것이다

12 Korean Journal of Agricultural and Forest Meteorology, Vol. 16, No. 1 다 (Kim et al., 2012). 여러가지생물종이어우러져구성된생물군집은종간상호작용이다양할것이므로종다양성이높은군집은구조적으로복잡할것이다 한국농림기상학회지, 제 16 권제 1 호 (2014) (pissn 1229-5671, eissn 2288-1859) Korean Journal of Agricultural and Forest Meteorology, Vol. 16, No. 1, (2014), pp. 11~21 DOI: 10.5532/KJAFM.2014.16.1.11 c Author(s) 2014.

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI:   3 * The Effect of H Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales

More information

Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ

Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]

More information

401.fm

401.fm Journal of Korean Nature Vol. 3, No. 4 199-211, 2010 Classification Type of Vascular Plants in Yeohangsan, Muhaksan and Palyongsan, Masan Hyun-Kyung Oh 1 *, Hyun-Mi Kang 2 and Song-Hyun Choi 2 1 Department

More information

Korean J. Plant Res. 29(2): (2016) Print ISSN Online ISSN Original Research Art

Korean J. Plant Res. 29(2): (2016)   Print ISSN Online ISSN Original Research Art Korean J. Plant Res. 29(2):241-263(2016) http://dx.doi.org/10.7732/kjpr.2016.29.2.241 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article 석회암지대석병산일대의관속식물상 송재모 1, 손호준 2, 김영설 3, 김세창 3, 이다현

More information

?

? http://kfaexpo.kr/ The 40th Korea Franchise Business Expo 2017 JUNE - Vol.23 2017 JUNE - Vol.23 2017 in Busan COVER STORY SPEACIAL REPORT GUIDE POST PEOPLE & STORY ASSOCIATION NEWS Ҷ

More information

담양군 도래수마을의 식물상 조사 분석

담양군 도래수마을의 식물상 조사 분석 담양군도래수마을의식물상조사분석 박미정 1, 최진아 1* 2 1, 이상화, 김은자, 전보배, 유준완 1 1 1. 국립농업과학원 2. 녹색마당 Vegetation Survey and Analysis in Damyang-gun Doraesoo Village Park Meejeong 1, Choi Jin-a 1*, Lee Sanghwa 2, Kim Eunja 1,

More information

BMYIHXZUOVDO.xls

BMYIHXZUOVDO.xls 1 좌사일대의식물 좌사일대의식물 - 154.5고지 - 도재화 국립환경과학원 김용현 경원대학교 요약 1 조사지역내에자생하는관속식물은 34목 63 과, 142 속, 139 종, 24 변종, 1 품종, 1잡 종의총 168 분류군으로나타났다. 2 식물구계학적특정식물종 IV등급종은비진도콩 1 분류군, III등급종까마귀쪽나무등 6 분류군, II등급종층꽃나무등 1 분류군,

More information

정규영 서정수 * 박명순 이선희 최하나 정수영 Flora of Vascular Plants on Mt. Kookmang(Chungju, Chungbuk) School of Bioresource Science, Andong National University *The K

정규영 서정수 * 박명순 이선희 최하나 정수영 Flora of Vascular Plants on Mt. Kookmang(Chungju, Chungbuk) School of Bioresource Science, Andong National University *The K 정규영 서정수 * 박명순 이선희 최하나 정수영 Flora of Vascular Plants on Mt. Kookmang(Chungju, Chungbuk) School of Bioresource Science, Andong National University *The Korean Association for Conservation of Nature This survey

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4) THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method

More information

01À̽ÂÈ£A9-832š

01À̽ÂÈ£A9-832š A Variation of Summer Rainfall in Korea* Seungho Lee** and Won Tae Kwon*** Abstract : Daily rainfall data from 14 stations during 1941 to 2000 were analyzed in order to examine the characteristics of the

More information

untitled

untitled 대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran

More information

<BFACB1B8C0DAB7E C8A328C8F1B1CDC0AFC0FCC0DABFF8292DB3BBC1F6C6ED2E687770>

<BFACB1B8C0DAB7E C8A328C8F1B1CDC0AFC0FCC0DABFF8292DB3BBC1F6C6ED2E687770> KOREA FOREST RESEARCH INSTITUTE 발간사 산림은물, 공기, 휴양등으로인류에간접적인크나큰혜택을주고있으며, 산업사회가발전할수록기후변화와더불어산림자원의존재가치와중요성이더욱더높아지고있습니다. 그중에서도고급용재수, 약용수등의산림유전자원은직접적인활용가치가높은생물자원입니다. 아울러생물산업발달과더불어산림유전자원은다양성이요구되는미래사회의중요한생명자원으로서그역할은이루말할수없을것입니다.

More information

09È«¼®¿µ 5~152s

09È«¼®¿µ5~152s Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,

More information

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling

More information

<31362DB1E8C7FDBFF82DC0FABFB9BBEA20B5B6B8B3BFB5C8ADC0C720B1B8C0FC20B8B6C4C9C6C32E687770>

<31362DB1E8C7FDBFF82DC0FABFB9BBEA20B5B6B8B3BFB5C8ADC0C720B1B8C0FC20B8B6C4C9C6C32E687770> Journal of the Korea Academia-Industrial cooperation Society Vol. 13, No. 4 pp. 1525-1531, 2012 http://dx.doi.org/10.5762/kais.2012.13.4.1525 저예산 독립영화의 구전 마케팅을 위한 스마트폰 모바일 애플리케이션 모델 개발 연구 김혜원 1* 1 청운대학교

More information

μ μ μ matk_193f trnk_670f matk_520r matk_1246r rbcl accd matk matk trnk (5 ) trnk (3 ) trnk_670f CTGTATCGCACTATGTATC matk_193f GTTATTCGAATGTATCAACAG matk_520r CTCATGCTTGCATTTATTACG matk_1246r CTTTCTCATTATTACAGCGG

More information

fm

fm Korean J. Pl. Taxon. 47(3): 264 288 (2017) https://doi.org/10.11110/kjpt.2017.47.3.264 pissn 1225-8318 eissn 2466-1546 Korean Journal of Plant Taxonomy A checklist of endemic plants on the Korean Peninsula

More information

한실정이며, 초화류생육및식재후관리에관한연구또한옥상녹화, 실내조경등인공토양환경에서의연구가주를이루고있다. 외부공간에서의초화류생육에관한연구로는아파트단지내식재된지피식물의생육환경및관리현황 (Lee, 2006) 과상록성지피식물의이용확대를위한환경조건에따른생육비교 (Kim, 2010

한실정이며, 초화류생육및식재후관리에관한연구또한옥상녹화, 실내조경등인공토양환경에서의연구가주를이루고있다. 외부공간에서의초화류생육에관한연구로는아파트단지내식재된지피식물의생육환경및관리현황 (Lee, 2006) 과상록성지피식물의이용확대를위한환경조건에따른생육비교 (Kim, 2010 J. Korean Soc. People Plants Environ. Vol. 18 No. 4: 257-263, August 2015 http://dx.doi.org/10.11628/ksppe.2015.18.4.257 ISSN 1226-9778(Print) ISSN 2287-8238(Online) 박은희 정명일 한승원 정나라 김재순 * 국립원예특작과학원원예작물부도시농업연구팀

More information

fm

fm Floristic study of Jogyesan Mt. 339 Appendix 1. List of vascular plants distributed in Jogyesan Mt. Lycopodiaceae 석송과 Huperzia serrata (Thunb.) Trevis. 뱀톱 P 150635 Equisetaceae 속새과 Equisetum arvense L.

More information

옥천 일대의 지형

옥천  일대의  지형 1 진상일대의식물 진상 (357154) 일대의식물상 - 억불봉 - 김휘 박유철 국립목포대학교 요약 1 진상면 (357154) 지역의억불봉 (1,008m) 일대에대한식물상조사에서총 100과 137 속 332분류군으로나타났다. 2 진상면억불봉에서는환경부지정멸종위기종II급인나도승마 (Kirengeshoma koreana Nakai) 를확인할수있었다. 3 환경부식물구계학적특정식물종

More information

102.fm

102.fm Journal of Asia-Pacific Biodiversity Vol. 6, No. 1 31-81, 2013 http://dx.doi.org/10.7229/jkn.2013.6.1.031 The Vascular Plant Species in the Korean Demilitarized zone (DMZ) Chang Hyeon Lee 1, Hyun Tak Shin

More information

DMZ 의식물 155 마일

DMZ 의식물 155 마일 DMZ의식물 155마일 을엮은우리의노력이식물을앞세워현실의휴전선을지워나가는길이되었으면합니다. 남과북의경계없이피고지는비무장지대의식물처럼말입니다. DMZ 의식물 155 마일 DMZ의식물 155마일 을엮은우리의노력이식물을앞세워현실의휴전선을지워나가는길이되었으면합니다. 남과북의경계없이피고지는비무장지대의식물처럼말입니다. 발행일 2016년 10월 15일발행처 국립수목원발행자

More information

untitled

untitled Original Article Experiences of Unwed Mothers Choi, Yang-Ja 1) Kim, Kwuy-Bun 2) 1) Professor, Redcross College of Nursing, 2) Professor, Kyung Hee University, College of Nursing Science 1) 2) 1) 2) Purpose:

More information

서론 34 2

서론 34 2 34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of

More information

264 축되어 있으나, 과거의 경우 결측치가 있거나 폐기물 발생 량 집계방법이 용적기준에서 중량기준으로 변경되어 자료 를 활용하는데 제한이 있었다. 또한 1995년부터 쓰레기 종 량제가 도입되어 생활폐기물 발생량이 이를 기점으로 크 게 줄어들었다. 그러므로 1996년부

264 축되어 있으나, 과거의 경우 결측치가 있거나 폐기물 발생 량 집계방법이 용적기준에서 중량기준으로 변경되어 자료 를 활용하는데 제한이 있었다. 또한 1995년부터 쓰레기 종 량제가 도입되어 생활폐기물 발생량이 이를 기점으로 크 게 줄어들었다. 그러므로 1996년부 大 韓 環 境 工 學 會 誌 特 輯 - Special Feature - 263~268. 2008. 인구구조변화에 따른 생활폐기물 발생량 현황 및 전망 서울대학교 보건대학원 Status and Forecast of the Municipal Solid Waste Generation by the Change of Population Structure Sa-rah

More information

. 45 1,258 ( 601, 657; 1,111, 147). Cronbach α=.67.95, 95.1%, Kappa.95.,,,,,,.,...,.,,,,.,,,,,.. :,, ( )

. 45 1,258 ( 601, 657; 1,111, 147). Cronbach α=.67.95, 95.1%, Kappa.95.,,,,,,.,...,.,,,,.,,,,,.. :,, ( ) . 45 1,258 ( 601, 657; 1,111, 147). Cronbach α=.67.95, 95.1%, Kappa.95.,,,,,,.,...,.,,,,.,,,,,.. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ,. (, 2011),, 1980 5 49.9%, 4 (20.3%). 1985, 5 (39.0%), 4 (25.3%).

More information

14.531~539(08-037).fm

14.531~539(08-037).fm G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked

More information

2 佛敎學報 第 48 輯 서도 이 목적을 준수하였다. 즉 석문의범 에는 승가의 일상의례 보다는 각종의 재 의식에 역점을 두었다. 재의식은 승가와 재가가 함께 호흡하는 공동의 場이므로 포 교와 대중화에 무엇보다 중요한 역할을 수행할 수 있다는 믿음을 지니고 있었다. 둘째

2 佛敎學報 第 48 輯 서도 이 목적을 준수하였다. 즉 석문의범 에는 승가의 일상의례 보다는 각종의 재 의식에 역점을 두었다. 재의식은 승가와 재가가 함께 호흡하는 공동의 場이므로 포 교와 대중화에 무엇보다 중요한 역할을 수행할 수 있다는 믿음을 지니고 있었다. 둘째 한국 근대불교의 대중화와 석문의범* 29)韓 相 吉 ** 차 례 Ⅰ. 머리말 1. 불자필람 의 구성 Ⅱ. 석문의범의 간행 배경 2. 석문의범 의 구성과 내용 1. 조선후기 의례집의 성행 Ⅳ. 근대불교 대중화와 석문의범 2. 근대불교 개혁론과 의례 Ⅲ. 석문의범의 체재와 내용 간행의 의미 Ⅴ. 맺음말 한글요약 釋門儀範 은 조선시대에 편찬된 각종 의례서와 의식집을

More information

10(3)-10.fm

10(3)-10.fm w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction

More information

<353420B1C7B9CCB6F52DC1F5B0ADC7F6BDC7C0BB20C0CCBFEBC7D120BEC6B5BFB1B3C0B0C7C1B7CEB1D7B7A52E687770>

<353420B1C7B9CCB6F52DC1F5B0ADC7F6BDC7C0BB20C0CCBFEBC7D120BEC6B5BFB1B3C0B0C7C1B7CEB1D7B7A52E687770> Journal of the Korea Academia-Industrial cooperation Society Vol. 13, No. 2 pp. 866-871, 2012 http://dx.doi.org/10.5762/kais.2012.13.2.866 증강현실을 이용한 아동교육프로그램 모델제안 권미란 1*, 김정일 2 1 나사렛대학교 아동학과, 2 한세대학교 e-비즈니스학과

More information

04.hwp

04.hwp 24(5): 281 288, 2001 Korean J. Ecol. 한라산구상나무 (Abies koreana W.) 의연륜연대학적연구 기후변화에따른생장변동분석 구경아 박원규 공우석 *, * 적요 :,. 1912 1999, 1982, 1988, 1996. ( ) 4 11, 12 1.. - 1, 2, 3 11 (SOI). (frost damage), 1964, 1965,

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although

More information

2(2): 87~97, JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN Flora around Gudeok Campsite, Busan Metropolitan City, Korea Yo

2(2): 87~97, JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN Flora around Gudeok Campsite, Busan Metropolitan City, Korea Yo 2(2): 87~97, 2016. 12. JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN 2465-8146 Flora around Gudeok Campsite, Busan Metropolitan City, Korea You, Ju-Han ABSTRACT 국문초록 Corresponding author: You,

More information

................-......

................-...... International Workshop on Biodiversity Conservation and Sustainable Development in North-East Asia with emphasis on the Role of Gangwon Province 2014. 6. 18-20 International Workshop on Biodiveristy Conservation

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social

More information

산촌마을내지_합.pdf

산촌마을내지_합.pdf 11-1400377-000560-01 57 2012 90 46% 59% 1995 2011 270 2010 240 30 2012 12 Part 01 01 8 02 14 03 20 04 26 Part 02 05 36 06 42 07 48 08 54 09 60 10 66 Part 03 11 74 12 80 13 86 14 92 Part 04 15 100 16 108

More information