대한진단검사의학회지 : 제 24 권제 5 호 2004 Korean J Lab Med 2004; 24: 진단유전학 실시간중합효소연쇄반응을이용한상대정량에서표준곡선의영향 이미경 김태형 1 중앙대학교의과대학진단검사의학교실, 비뇨기과학교실 1 Influence of
|
|
- 준엽 순
- 5 years ago
- Views:
Transcription
1 대한진단검사의학회지 : 제 24 권제 5 호 2004 Korean J Lab Med 2004; 24: 진단유전학 실시간중합효소연쇄반응을이용한상대정량에서표준곡선의영향 이미경 김태형 1 중앙대학교의과대학진단검사의학교실, 비뇨기과학교실 1 Influence of Standard Curves on Relative Quantification using Real-time PCR Mi Kyung Lee, M.D. and Tae Hyoung Kim, M.D. 1 Departments of Laboratory Medicine and Urology 1, Chung-Ang University College of Medicine, Seoul, Korea Background : Although relative quantification by real-time PCR may be easier to perform than absolute quantification, there is a risk of errors associated with standard curve construction. The aim of this study was to evaluate the effects of standard curves on relative quantification using real-time PCR in Candida albicans. Methods : The reproducibility of real-time PCR-based standard curves for target genes and a reference gene generated from PCR amplicons (10-fold serial dilution, 10-4 to 10-9 ) was evaluated. In addition, the effects on standard curves were evaluated by running the same cdna samples. Results : The within-run variation (CV) by crossing point (Cp) was % for ERG11 and ACT1, whereas the between-run CV was % for ERG11, CDR1, MDR1 (target gene) and ACT1 (reference gene). The differences in PCR efficiency between targets and reference may be attributable to variations in relative quantification. Conclusions : To achieve reliable relative quantification of mrna in real-time PCR, a feasible guideline and standardization are of major importance. (Korean J Lab Med 2004; 24: ) Key Words : Real-time PCR, Relative quantification, Standard curve 서 질병의연구에있어서질병의분자생물학적기전이해, 질병의진단, 신약개발을위한표적유전자연구및임상적치료효과를평가하는데필요한결정적인과정들중에서유전자발현 (Gene expression) 연구는매우중요한역할을담당하고있다 [1]. 유전자발현은최종산물인단백질이나중간생성물인 mrna를정량함으로평가할수있으나, 일부단백질과 mrna 표현사이에낮은상관관계를보인다는사실과 [2, 3] 단백질분석은인산화 (phosphorylation), 당화 (glycosylation) 및단백분해과정과같은접수 : 2004년 7월 5일접수번호 :KJLM1769 수정본접수 : 2004년 9월 20일교신저자 : 이미경우 서울시중구필동 2가 82-1 중앙의대부속필동병원진단검사의학과전화 : , Fax: cpworld@cau.ac.kr 론 해독후 (post-translation) 변형의영향도평가할수있다는점에서최종산물인단백질을측정하는것이바람직하다고알려져있다 [1]. 물론단백질과 mrna를동시에측정하는것이가장이상적이지만, 현재가능한단백질분석기술은일반적으로처리량이낮고기술적인개선이필요하며일반검사실에서쉽게적용할수없다는제한이있어, 일반검사실에서측정이가능하며다양하고정량적인정보를얻을수있는 mrna 측정에의한유전자표현연구가많이시도되고있다. 전사량을알기위한 mrna 측정에는일반적으로 Northern blotting과 in situ hybridization[4], RNase protection assay[5], cdna microarray[1] 및역전사중합효소연쇄반응 (reverse transcription-polymerase chain reaction, RT-PCR) 등의 5가지방법이사용되고있다. 이중 RT-PCR은세포수가적은검체나유전자표현이낮은경우에도측정이가능하여가장예민하고다양하게적용할수있는방법으로평가되고있다 [6, 7]. 특히최근에 327
2 328 이미경 김태형 실시간 PCR (real-time PCR) 의도입으로기존 RT-PCR에서 PCR 후의복잡한검사과정을줄이고폐쇄관분석 (closed-tube system) 하에서실시간으로증폭산물을분석하게됨으로, 다른방법에비하여신속하고간편하면서정확하고재현성높은결과를내는것으로보고되고있다 [6, 8, 9]. Real-time PCR의기본원리는 DNA polymerase와형광공명에너지이동 (fluorescence resonance energy transfer, FRET) 의원리에 [10] 의해 PCR의매주기마다실시간으로시행되는형광의검출과정량에있으며, PCR시매주기의진행상황을감시하여 exponential phase 범위내에서실시간으로증폭산물을측정하는방법이다. 이때중요한개념은 threshold cycle (C T ) 또는 crossing point (Cp) 라는수치로, 형광의양이기본값 (baseline level) 을넘어서감지될수있을정도로두드러지게증가하는시점의주기수이며, 이는초기주형량을정확하게반영하는것으로알려져있다 [11]. Real-time PCR에서증폭산물의양을측정하는방법에는절대정량 (absolute quantification) 과상대정량 (relative quantification) 이있다. 절대정량은농도를알고있는표준물질을사용하여표준곡선을만들고이를이용하여측정하고자하는대상유전자의농도를산출해내는방법으로대상유전자와표준물질의 PCR 효율이동일하다는가정하에서시행되며, 보다정확한정량을위해서대상유전자와농도를알고있는내부대조물질을동시에증폭시켜정량하게된다 [6]. 한편특정대상유전자표현의변화를확인하기위한 mrna 정량에는기준유전자 (reference gene) 와대상유전자를사용하여각각의표준곡선 (standard curve) 을만들고이를이용하여이들의증폭정도를농도로산출한후, PCR 간의변이를보상하기위하여기준유전자에대한대상유전자의비율 ( 대상유전자의농도 / 기준유전자의농도 ) 을계산하는상대정량이이용된다 [6, 9]. 상대정량이절대정량에비하여좀더쉽고경제적이며신뢰성있는방법으로생각되지만, 여전히표준곡선의조제와보관등에따른오류의위험을내포하고있다 [12]. Table 1. Primers and probes used in this study 이에본연구에서는유전자표현을위한상대정량에서대상유전자와기준유전자정량을위한표준곡선의영향을평가하기위하여, Candida albicans에서대상유전자로 ERG11, CDR1, MDR1 을, 기준유전자로 ACT1을사용하여각유전자정량을위한표 준곡선의농도별정밀도와효율을분석하고표준곡선이대상유전 자의상대정량에미치는영향을평가하여보고자하였다. 1. 대상 대상및방법 임상검체에서분리된 C. albicans와표준곡선제조를위하여 fluconazole에감수성인 C. albicans ATCC 균주를사용하였으며, 균주는 -80 에보관하면서검사시35 에서 Sabouraud dextrose agar (SAB) 평판 (BBL, Cockeysville, MD, USA) 에계대배양하였다. 2. 방법 1) 표준곡선의평가표준곡선을위한주형 DNA는 35 의진탕배양상태로 SAB (Difco, Detroit, Michigan, USA) 액체배지에서하룻밤배양된 C. albicans ATCC 균주로부터 QIAGEN Genomic-tip 20/G kit (QIAGEN, Valencia, CA, USA) 를사용하여추출하였으며, 각유전자에대한시발체 (Table 1) 를사용하여 PCR로증폭하였다. 각각의증폭산물은 QIAquick PCR purification kit (QIAGEN) 로정제한후 DNA 농도를측정하였고, 보관과냉, 해 동에따른오차를줄이기위하여정제된 PCR 산물을 4 L 씩분 주하여 -80 에보관하다가 real-time PCR 시 10 배씩연속적으로 희석하여표준곡선을위한주형으로사용하였다. Primer/Probe GenBank assession no. Sequences (5-3 ) ERG11 Forward primer X13296 TGGAGACGTGATGCTG AGTATGTTGACCACCCATAA AATCTCTGCTACTTATATGAAAGAAATTAAACTGAG GAGAACGTGGTGATATTGATCCAAAT CDR1 Forward primer X77589 AAGAGAACCATTACCAGG AGGAATCGACGGATCAC CAAGACCAGCATCTCCATATACTGTAT ATTCTTTATGCAAGTGAGGTATGGTG MDR1 Forward primer X53823 GGAGTTTAGGTGCTGT CGGTGATGGCTCTCAA GCCAGTTGGAGATGGACT TTGGTTCATGTGTATCATTTCTGG ACT1 Forward primer X16377 CCAGCTTTCTACGTTTCC CTGTAACCACGTTCAGAC CGGTATTGTTTTGGATTCTGGTG TGTGTTTACTCACGTTGTTCC
3 실시간중합효소연쇄반응을이용한상대정량에서표준곡선의영향 329 표준곡선의정밀도평가를위하여정제된 PCR 산물을 10배씩연속적으로희석하여 ( ) 검사중 (within-run) 변이계수 (coefficient of variation, CV) 와검사간 (between-run) 변이계수를측정하였다. 검사중변이계수는한번의 real-time PCR동안각농도의연속희석한 ERG11과 ACT1 PCR 산물을각각 3개로나누어반복측정하였고, 검사간변이계수는 3개월동안 ERG11 과 ACT1 (20회), CDR1 또는 MDR1과 ACT1 ( 각각 10회씩 ) 에대한 real-time PCR 측정을통하여분석하였다. 표준곡선은 Light- Cycler (Roche Diagnostic Corp., Indianapolis, IN, USA) 자체에서연속희석된초기주형농도의 log 값 (y축 ) 에대한 Cp값 (x축 ) 을표시하여그려지게되고, 이때기울기 (slope) 와 error값이주어지며기울기를이용하여 PCR의효율 (efficiency, E= 10-1/slope ) 을계산하였다 [9](Fig. 1). 2) RNA 추출 35 의진탕배양상태로 SAB (Difco) 액체배지에서하룻밤 배양된균주를새로운 SAB 액체배지에 1:100 으로희석하여 midlogarithmic phase (OD 600 =1-1.2) 가될때까지진탕배양한후, 원심분리하여세포를모으고멸균증류수로세척하였다. 총 RNA 는 RNAqueous TM -4PCR kit (Ambion, Austin, TX, USA) 를사용하여제조사에서제시한방법을일부변형하여추출하였다. 추출된 RNA 용액에남아있을 DNA 제거를위하여 DNase I (2 units/ L) 과완충액을가하여 37 에서 1시간동안반응시키고, DNase inactivation reagent를첨가하여실온에 2분간방치한후 13,000 rpm에서 1분간원심분리하고상층을새튜브로옮겨 Fluorescence (F2/F1) Cycle number Cycle Number Linear Regression 22 Crossing Points Slope= Intercept= Error= r= Log Concentration (pg/ L) Fig. 1. Amplification curve and regression curve (standard curve) for relative quantification. A regression curve is calculated with four values ranging from to ng/ L ACT1 PCR product and serves for the quantification of other samples. cdna 합성에사용하였다. 3) cdna 합성 cdna 합성을위한역전사는 1st Strand cdna Synthesis Kit for RT-PCR (Roche Diagnostic Corp., Indianapolis, IN, USA) 을사용하여시행하였으며, 총 RNA 8 L와 10 reaction buffer (100 mm Tris, 500 mm KCl, ph 8.3) 4 L, 25 mm MgCl 2 8 L, dntp mix (datp, dctp, dttp, dgtp, 10 mm each) 4 L, random primer p (dn) 6 4 L, RNase inhibitor 2 L, AMV reverse transcriptase 1.6 L에 DEPC-처리멸균증류수를첨가하여총 40 L로만들었다. 역전사반응은 25 에서 10분, 50 에서 60분간반응시키고역전사효소의불활성화를위해 99 에서 5분간반응시켰다. 합성된 cdna는 QIAquick PCR purification kit (Qiagen) 를사용하여정제한후, 260 nm 와 280 nm에서흡광도를측정하여정제한 cdna의양과순도를확인하였다. 4) LightCycler를이용한정량적 real-time PCR Real-time LightCycler TM (Roche) PCR은 FastStart DNA Master Hybridization Probe PCR mix (Roche) 를사용하였다. PCR 반응액은 25 mm MgCl L, 시발체각각 0.4 M, hybridization probe 각각 0.2 M, LightCycler DNA FastStart Hybridization mix 2 L에멸균증류수를가하여 18 L를만들어잘혼합한후유리 capillary로옮기고, cdna ( 정량을위한검체 ) 나연속희석한 PCR 산물 ( 표준곡선 ) 2 L를분주하였다. PCR 반응은 95 에서 10분간전변성시킨후 40에서 50 주기 (cycle) 로시행하였으며, 반응조건은 ERG11과 CDR1은 95 에서 10초, 62 에서 15초, 72 에서 10분으로하였으며, MDR1의경우결합반응 (annealing) 의온도를 54 로시행하였다. 각유전자 (ERG11, CDR1, MDR1, ACT1) 의농도는각각의표준곡선으로부터얻어지며, 이들유전자의상대정량치는기준유전자인 housekeeping 유전자 (ACT1) 에대한대상유전자 (ERG11, CDR 1, MDR1) 의비로산출하였다. 유전자표현의확인을위한모든검체의상대정량은동일한 cdna를사용하여각각 3회씩의독립된 real-time PCR로부터얻은결과의평균으로평가하였다. 5) Real-time PCR을이용한상대정량에서표준곡선의영향분석동일한 cdna를사용하여독립된 real-time PCR로부터얻은 3회의상대정량결과에서검사간변이계수가 10% 미만인검체 2개와 50% 이상인검체 3개를선택하여각각 2회의독립된 realtime PCR을추가로시행하였다. 유전자표현을위한상대정량에서표준곡선의영향을평가하기위하여각각의표준곡선효율과대상유전자와기준유전자간효율의차를분석하였다. 이때상대정량값을대상으로검사간변이계수가 50% 이상인검체는대 상유전자와기준유전자의표준곡선효율이모두제조사가제시하는최저효율인 1.75 이상이면서대상유전자와기준유전자간
4 330 이미경 김태형 효율의차가가장작은결과값을기준으로하여평가하였다. 결 1. 표준곡선의정밀도평가 과 표준곡선의 Cp 값을이용한 ERG11 과 ACT1 에대한검사중변 이계수는각각 % 와 % 였고, 평균표준편차 (SD) 는 0.09 주기였다 (Table 2). ERG11, CDR1, MDR1 및 ACT1에대한검사간변이계수는각각 %, %, %, % 였고, 평균표준편차는 0.97 주기였다. 각유전자에대한 PCR 효율은 1.80 (Range, ), 1.78 (Range, ), 1.85 (Range, ), 1.82 (Range, ) 를보여분석한유전자들간에는유의한차이를보이지않았다 (Table 3). 2. Real-time PCR 을이용한상대정량에서표준곡선의영향 상대정량에서검사간변이계수가 50% 이상인 3 개의검체중, Table 2. Within-run variation of LightCycler real-time PCR for standard curve 검체 1에서는표준곡선을위한대상유전자와기준유전자의효율이각각 1.88로같은효율을보인 4번째반응의결과값을기준으로분석하였으며, 검체 2에서는 5번째반응의결과값을, 그리고검체 3에서는 3번째반응의결과값을기준으로분석하였다 (Table 4). 기준이되는상대정량값에서 10% 이상의변이계수를보인 10 번의반응결과 ( 검체 1의 run 1, 2, 3, 검체 2의 run 1, 3, 4, 검체 3의 run 1, 2, 4, 5) 와검사간변이계수가 10% 미만인 10번의반응결과를비교하여보았다 (Table 5). 첫째, 기준유전자또는대상유전자표준곡선의효율이 1.75 미만이면서기준유전자와대상유전자표준곡선의효율차가 5% 미만인경우가반응결과의변이계수가 10% 이상에서 1예, 10% 미만에서 3예가관찰되었고, 둘째, 표준곡선의효율이모두 1.75 이상이면서표준곡선의효율차가 5% 이상인경우가변이계수가 10% 이상에서 1예, 10% 미만에서 2예있었으며, 셋째, 기준유전자또는대상유전자표준곡선의효율이 1.75 미만이면서표준곡선의효율차가 5% 이상인경우가변이계수가 10% 이상에서는 3예관찰되었으나, 10% 미만에서는없었다. 넷째, 기준유전자와대상유전자표준곡선의효율차 (CV) 는반응결과의변이계수가 10% 이상인경우 (mean± SD, 5.3±3.1; range, %) 가 10% 미만인경우 (mean± SD, 2.8±2.8; range, 0-8.6%) 에비해유의하게높았다 (P<0.05). Concentration (ng/ L) Cp (Mean±SD) CV (%) 고 찰 ERG11 DNA ± (n=3) ± ± ± ACT1 DNA ± (n=3) ± ± ± 유전자발현의변화를보기위한 mrna 분석은인간유전체사업과 DNA microarray, real-time PCR 및 laser capture microdissection[13] 과같은새로운기술의발달로매우빠르게발전하고있다. 그러나유전자발현의분석은예민하고정확하며재현성있는특정 mrna 측정이필수적으로요구되며, 특히 RT-PCR 에의한정량은 mrna의작은변화까지검출할수있어유용한 Table 3. Between-run variation of LightCycler real-time PCR for standard curve Concentration (ng/ L) Cp (Mean±SD) CV (%) Efficiency (Mean±SD) ERG11 DNA ± ±0.13 (n=20) ± (Range, ) ± ± CDR1 DNA ± ±0.07 (n=10) ± (Range, ) ± ± MDR1 DNA ± ±0.10 (n=10) ± (Range, ) ± ± ACT1 DNA ± ±0.07 (n=40) ± (Range, ) ± ±
5 실시간중합효소연쇄반응을이용한상대정량에서표준곡선의영향 331 Table 4. Relative quantification data (CV>50%) from five replicate real-time PCR runs in three samples* Sample Standard curve Target Reference Normalized expression Target Efficiency Reference Efficiency Sample 1 (ERG11) Run E E Run E E Run E E Run E E Run E E Sample 2 (CDR1) Run E E Run E E Run E E Run E E Run E E Sample 3 (MDR1) Run E E Run E E Run E E Run E E Run E E *Relative gene expression was expressed as a ratio of target gene (ERG11, CDR1, and MDR1) concentration to reference gene (ACT1) concentration. Relative quantification data was compared to an underlined data with suitable PCR efficiency. Table 5. Effect of the PCR efficiency of standard curve on relative quantification PCR efficiency of reference or target gene < Difference in PCR efficiency Difference in PCR efficiency 5% <5% 5% <5% A (n=10) B (n=10) A: More than 10% of CV in relative quantification data; B: Less than 10% of CV in relative quantification data. 방법이지만재현성이낮은것이문제로알려져있어, 검체처리와 RNA 추출, 역전사반응그리고정량적 PCR 등각단계별엄격한정도관리가요구되고있다 [14]. 최근유전자발현의분석에도입되어신속하고간편하면서비교적정확하게재현성높은결과를내는것으로보고되고있는 [6, 8, 9] real-time PCR을이용한상대정량은, 기준유전자와대상유전자를사용하여각각의표준곡선을만들고이를이용하여이들의증폭정도를농도로산출한후, 기준유전자에대한대상유전자의비율을계산하여상대적인정량을하게된다. 이때기준유전자로는정확한정량을위하여 glyceraldehyde-3-phosphate dehydrogenase (GAPDH), albumin, -actin, tubulins, cyclophilin, 18S-rRNA 또는 28S rrna와같은조절이되지않는유전자나세포의생존에필수적이어서모든유핵세포에존재하는 housekeeping 유전자를사용하고있다 [6, 9]. 본연구에서는 real-time PCR에서표준곡선의영향을평가하기위하여, 상대정량시결과에영향을줄수있는검체처리와 RNA 추출및역전사반응등의 PCR 이전과정과검사자에의한차이를없애고자동일검사자가동일 cdna를사용하여분석하였다. Cp값을이용한표준곡선의정밀도평가에서유전자 ERG11과 ACT1에대한검사중변이계수는대부분 1% 이하로매우낮은결과를보여기존의다른보고들과 [15-17] 유사하게나타났다. 그러나 ERG11, CDR1, MDR1 및 ACT1에대한검사간변이계수는 % 로검사중변이계수에비하여높은변이를보이고있고 5% 이상의변이를보이는경우도있어, 표준곡선의검사간변이가결과의재현성에영향을줄수있을것으로사료되었다. 한편 PCR 효율은각반응에따라다양하고희석성분이나 GC 양과같은여러억제요소들로인해최대효율 ( 효율 =2) 을나타내기는어려우며 [14], 두개의동일한양의검체에서 PCR 효율이 5% 만차이가나도 PCR 26주기이후에증폭산물이 2배정도의차이를보일수있어 [18], PCR 효율의작은차이도증폭산물의양에큰영향을줄수있을것으로생각되고있다. 본연구에서는상대정량에서표준곡선의영향을평가하기위하여대상유전자와기준유전자각각의표준곡선효율과대상및기준유전자간효율의차를분석하여보았는데, 기준유전자또는대상유전자표준곡선의효율이낮고동시에표준곡선의효율차가 5% 이상인경우는상대정량값에영향을줄수있을것으로판단되었다. 그러나상대정량값에서 10% 이상의변이계수를보인 10 번의반응결과중 50% 에서는대상과기준유전자의표준곡선효
6 332 이미경 김태형 율이 1.75 이상이면서효율의차도 5% 미만으로나타나표준곡선이외에각반응의검사간결과에변동을줄수있는다른요인들의영향을시사하였다. 따라서동일검사자가동일 cdna를가지고실험을하였지만, 주형이되는 cdna의양이 2 L로매우소량이므로분주시발생할수있는주형량의변이, real-time PCR 기기인 LightCycler는장비내공기의온도를조절하여가열과냉각을반복하고있으므로각유리 capillary의온도가일정하지않았을가능성, DNA 오염등을고려해볼수있겠다. 최근유전자발현에관한연구가증가하면서 RT-PCR에의한 mrna 정량시검체처리와 RNA 추출, 역전사반응그리고정량적 PCR 등각단계에서발생할수있는변이를줄이기위하여각단계별반응을모니터할수있는정도관리물질이나소프트웨어등의개발및검사방법에관한연구들이많이보고되고있다 [8, 9, 15, 19-22]. 본연구에서도연구결과와연구과정의경험을통하여 mrna의상대정량시 real-time PCR 과정의변이를줄이기위한몇가지지침을제시하고자한다. 첫째, 동일검사자가검사를수행할경우검사중변이는매우낮으므로, 동일반응에서검체를중복검사하는것보다는검사간변이를줄이기위하여최소 3번이상의독립된반응에서얻은결과를분석하여변이가큰결과가있을경우한두번의반응을추가하여유사한값의평균을사용한다. 둘째, 기준유전자또는대상유전자표준곡선의효율이낮고동시에표준곡선의효율차가 5% 이상인경우는추가반응을시행하여확인한다. 셋째, RNA 추출과정에서완전히제거되지않은 DNA 에의한오염을확인하기위하여 real-time PCR 시음성대조로 NTC (No template control) 뿐아니라 RNA 대조도추가하여시행한다. 넷째, PCR 주기가증가할수록변이의폭도커질위험이있으므로반응조건을잘조절하여 PCR 주기를 40회이내로시행한다. 그러나타당하고적절한지침이라하더라도실험실에서모두적용하기에는여러가지어려움이있을것으로생각되므로, 각검사실에서실현가능한지침을만들어표준화하는것이중요하다고사료되었다. 요약배경 : Real-time PCR을이용한상대정량은절대정량에비하여좀더쉽고신뢰성있는방법으로생각되지만, 여전히표준곡선의조제와보관등에따른오류의위험을내포하고있다. 이에본연구에서는유전자표현을위한상대정량에서대상유전자와기준유전자정량을위한표준곡선의영향을평가하기위하여, Candida albicans의유전자정량시표준곡선의농도별정밀도와효율을분석하고표준곡선이대상유전자의상대정량에미치는영향을평가하여보고자하였다. 방법 : 표준곡선의정밀도는대상또는기준유전자에대한정제된 PCR 산물을 10배씩연속적으로희석하여 ( ) 검사중변이계수 (coefficient of variation, CV) 와검사간변이계수를 측정하여평가하였다. 표준곡선의영향을평가하기위하여동일한 cdna를사용하여독립된 real-time PCR로부터얻은상대정량결과에서 10% 이상의변이계수를보인 10번의반응결과와변이계수가 10% 미만인 10번의반응결과를비교하여보았다. 결과 : Crossing point (Cp) 값을이용한 ERG11과 ACT1에대한검사중변이계수는각각 % 로대부분 1% 이하로매우낮은결과를보였고, ERG11, CDR1, MDR1 및 ACT1에대한검사간변이계수는 % 로대부분 5% 이하의결과를보였지만, 검사중변이계수에비하여높은변이를보였다. 또한기준유전자또는대상유전자표준곡선의효율이낮고동시에표준곡선의효율차가 5% 이상인경우는상대정량값에영향을줄수있을것으로판단되었다. 결론 : mrna의상대정량시 real-time PCR 과정의변이를줄이기위하여각검사실에서실현가능한지침을만들어표준화하는것이중요하다고사료되었다. 참고문헌 1. Clarke PA, te Poele R, Wooster R, Workman P. Gene expression microarray analysis in cancer biology, pharmacology, and drug development: progress and potential. Biochem Pharmacol 2001; 62: Anderson L and Seilhamer J. A comparison of selected mrna and protein abundances in human liver. Electrophoresis 1997; 18: Gygi SP, Rochon Y, Franza BR, Aebersold R. Correlation between protein and mrna abundance in yeast. Mol Cell Biol 1999; 19: Parker RM and Barnes NM. mrna: detection by in situ and northern hybridization. Methods Mol Biol 1999; 106: Hod Y. A simplified ribonuclease protection assay. Biotechniques 1992; 13: Bustin SA. Absolute quantification of mrna using real-time reverse transcription polymerase chain reaction assays. J Mol Endocrinol 2000; 25: Wang T and Brown MJ. mrna quantification by real time TaqMan polymerase chain reaction: validation and comparison with RNase protection. Anal Biochem 1999; 269: Bustin SA. Quantification of mrna using real-time reverse transcription PCR (RT-PCR): trends and problems. J Mol Endocrinol 2002; 29: Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2001; 29: Clegg RM. Fluorescence resonance energy transfer and nucleic acids. Methods Enzymol 1992; 211: Higuchi R, Fockler C, Dollinger G, Watson R. Kinetic PCR analysis:
7 실시간중합효소연쇄반응을이용한상대정량에서표준곡선의영향 333 real-time monitoring of DNA amplification reactions. Biotechnology 1993; 11: Lehmann U and Kreipe H. Real-time PCR analysis of DNA and RNA extracted from formalin-fixed and paraffin-embedded biopsies. Methods 2001; 25: Luzzi V, Holtschlag V, Watson MA. Expression profiling of ductal carcinoma in situ by laser capture microdissection and high-density oligonucleotide arrays. Am J Pathol 2001; 158: Ovstebo R, Haug KB, Lande K, Kierulf P. PCR-based calibration curves for studies of quantitative gene expression in human monocytes: development and evaluation. Clin Chem 2003; 49: Winer J, Jung CK, Shackel I, Williams PM. Development and validation of real-time quantitative reverse transcriptase-polymerase chain reaction for monitoring gene expression in cardiac myocytes in vitro. Anal Biochem 1999; 270: Kuhne BS and Oschmann P. Quantitative real-time RT-PCR using hybridization probes and imported standard curves for cytokine gene expression analysis. Biotechniques 2002; 33: Ruelle J, Mukadi BK, Schutten M, Goubau P. Quantitative real-time PCR on Lightcycler for the detection of human immunodeficiency virus type 2 (HIV-2). J Virol Methods 2004; 117: Freeman WM, Walker SJ, Vrana KE. Quantitative RT-PCR: pitfalls and potential. Biotechniques 1999; 26: Fronhoffs S, Totzke G, Stier S, Wernert N, Rothe M, Bruning T, et al. A method for the rapid construction of crna standard curves in quantitative real-time reverse transcription polymerase chain reaction. Mol Cell Probes 2002; 16: Peirson SN, Butler JN, Foster RG. Experimental validation of novel and conventional approaches to quantitative real-time PCR data analysis. Nucleic Acids Res 2003; 31: e Stahlberg A, Hakansson J, Xian X, Semb H, Kubista M. Properties of the reverse transcription reaction in mrna quantification. Clin Chem 2004; 50: Burggraf S and Olgemoller B. Simple technique for internal control of real-time amplification assays. Clin Chem 2004; 50:
대한진단검사의학회지제 26 권제 3 호 2006 Korean J Lab Med 2006;26: 원저 진단분자유전학 실시간중합효소연쇄반응검사와아가로오스겔전기영동에의한중합효소연쇄반응물의정량검사비교 이미경 김혜련 중앙대학교의과대학진단검사의학교실 Comparison
대한진단검사의학회지제 26 권제 3 호 2006 Korean J Lab Med 2006;26:217-22 원저 진단분자유전학 실시간중합효소연쇄반응검사와아가로오스겔전기영동에의한중합효소연쇄반응물의정량검사비교 이미경 김혜련 중앙대학교의과대학진단검사의학교실 Comparison between Real-Time PCR and Agarose Gel Electrophoresis
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More information슬라이드 1
Real Time PCR 목차 1. PCR 및 Real Rime PCR 원리 2. Real Time PCR 검출방법 3. Real Time PCR 정량방법 4. Takara Real Time PCR 시약 5. 금일실험내용 Polymerase Chain Reaction Taq DNA Polymerase - Thermostable DNA polymease from
More informationcdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR
RT-PCR 법 II. 역전사효소반응 ( 주 ) 다인바이오연구소 현재분자생물학분야에서 RNA 수준의 gene expression ( 유전자발현 ) 과 cdna (complementary DNA) cloning에널리이용되고있는 RT-PCR (Reverse transcription ploymerase chain reaction) 은생명정보가 DNA에서 RNA로전달된다는분자생물학분야의
More informationSlide 1
PrimeScript 1st strand cdna Synthesis Kit 1 Central Dogma replication transcription 0 processing translation 오늘의내용은? 조직추출 RNAiso Plus 5 mrna 우리가관심있는 mrna가차지하는비율이극히일부이기때문에관심있는 mrna를증폭해서그것을눈으로확인할정도로만들어주는것이다.
More informationCrt114( ).hwp
cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More informationmau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
More information실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양
실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양의시료를대량으로증폭할수있다는장점과그과정이간단하여 Cloning, Sequencing 등의기본기술로응용되었다.
More informationSMARTer 시리즈
SMARTer 시리즈 SMARTer Solutions 2014.12.17 다카라코리아바이오메디칼 SMART 하게실험하고 SMARTer 한결과를얻는방법 Clontech SMARTer 시리즈 Contents 1. Introduction 1. 역전사반응이란? 2. 기존역전사반응의한계 2. SMARTer 시리즈 1. SMARTer 란? 2. SMARTer 시리즈와적용
More information고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn
TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna
More informationKbcs002.hwp
Does Real-time Compound Imaging Improve Evaluation of reast Cancer Compared to Conventional Sonography? o Kyoung Seo, M.D., Yu Whan Oh, M.D., Kyu Ran Cho, M.D., Young Hen Lee, M.D., Hyung Joon Noh, M.D.,
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More informationSelection chart of Bioneer s cdna synthesis products Categories Application Product cdna Synthesis Kits One step RT-PCR Kits One step RT-qPCR Kits RTa
Selection chart of Bioneer s cdna synthesis products Categories Application Product cdna Synthesis Kits One step RT-PCR Kits One step RT-qPCR Kits RTase 표준 cdna 합성 높은효율의 cdna 합성 복잡한 2 차구조 RNA 의 cdna 합성
More informationTOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme
PCR Enzyme 부터 qpcr 까지! PCR 실험은 TOYOBO 로해결하세요! 행사기간 : 7 월 15 일 ~ 9 월 13 일까지 TOYOBO Reagent PCR Enzyme High Quality PCR Enzyme cdna Synthesis Kit qpcr One-step RT Kit Immunoreaction Enhancer Solution 추가
More information< D C8ABBFB5C1D828B1E8B9CEB1E2292E687770>
임상검사와정도관리 : 제 3 권제 2 호 2009 J Lab Med Qual Assur 2009; 3:275-9 275 SLAN real-time PCR 장비를이용한 Artus HBV LC PCR kit 의평가 김민기 이동영 장윤환 이진경 홍석일 홍영준 원자력병원진단검사의학과 Evaluation of Artus HBV LC PCR kit using SLAN
More information슬라이드 1
TAKARA 1. PCR 2. qpcr 2014. 02. 13. 최유미 DNA? DNA 생물체 > 기관 > 세포 >DNA DNA (Deoxyribonucleic acid) 세포내에서생물의유젂정보를보관하는물질 구성 : Adenine, Thymine, Cytosine, Guanine 종특이적, 개체특이적 PCR (Polymerase Chain Reaction)
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More information878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More informationITEM 1 PCR Enzyme 20% DNA Polymerase Enzyme Quick Selection Guide for Effective PCR DNA Polymerase General PCR / Colony PCR Long PCR (Max. 23 kb) Hot
2017 Summer BIG SALE 2017.7.3 ~ 9.8 ITEM 1 P C R Enzyme cpcr Enzyme 20% High Quality Enzyme ITEM 2 cdna Synthesis cdna Synthesis Kit 최대 33 % off ITEM 3 q P C R Enzyme Two-Step / One-Step Kit NGS Library
More informationAutomated high multiplex qPCR platform for simultaneous detection and quantification of multiple nucleic acid targets
PCR FlashGel System 2013. 04. 24 PCR 2013. 04. 24 순서 1. PCR 이란 2. PCR 실험의기본조건 3. PCR 효소선택가이드 4. Hot Start PCR의원리 5. PCR 실험시 Troubleshooting 6. PCR 장비 _TP350 소개 PCR(Polymerase Chain Reaction) PCR 이란? -
More informationVer.4 (KR) All about RT (cdna Synthesis) 8-11 Munpyeongseo-ro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea) (Internatio
20170619 Ver.4 (KR) All about RT (cdna Synthesis) 8-11 Munpyeongseo-ro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea)1588-9788 (International) +82-42 - 930-8777 Email: sales@bioneer.com Selection
More information(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re
EMF Health Effect 2003 10 20 21-29 2-10 - - ( ) area spot measurement - - 1 (Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern
More information슬라이드 1
EVENT 퀴아젠인기상품연말특별가전 200203 Top Taq DNA Polymerase (250U) 90,000 72,000 200205 Top Taq DNA Polymerase (1000U) 331,000 281,350 200403 Top Taq Master Mix Kit(250U) 104,000 83,200 201203 Taq DNA Polymerase
More information27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
More informationEZ-Cloning kit
EZ TM 5 /3 RACE PCR Kit Instruction Manual Korean Ver. Kit for 10 reactions Cat.# EZ025 EZ TM 5 /3 RACE PCR Kit Table of Contents I. 제품설명... 3 II. 원리... 4 III. 제품구성... 7 IV. 염기서열정보... 8 V. 주의사항... 8 VI.
More information서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소
2012 년도기초과학연구소 대학중점연구소심포지엄 마이크로파센서를이용한 혈당측정연구 일시 : 2012 년 3 월 20 일 ( 화 ) 14:00~17:30 장소 : 서강대학교과학관 1010 호 주최 : 서강대학교기초과학연구소 Contents Program of Symposium 2 Non-invasive in vitro sensing of D-glucose in
More information01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
More informationDBPIA-NURIMEDIA
Printed in the Republic of Korea "/"-:5*$"- 4$*&/$& 5&$)/0-0(: Vol. 18, No. 5, 425-430, 2005» 677*4 Ÿ w sƒ ½»x Á Á½ k w y w, w y œw Some considerations for the analytical approaches to measure atmospheric
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More informationProduct Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot
EZ-LDH Cell Cytotoxicity Assay Kit Cat. No. DG-LDH500 DG-LDH1000 FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. 1 ( 주 ) 대일랩서비스부설두젠생명공학연구소 Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는
More information달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
More informationDBPIA-NURIMEDIA
Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun
More informationDNA/RNA Amplification Overview AccuPower PreMix series 는세계적으로기술력을인정받은특허기술로보다경제적인가격과편리한방법으로실험할수있는제품입니다. Conventional PCR, Real-Time PCR 수행을위한 DNA ampli
DNA Amplification RNA Amplification Real-Time PCR Customized PCR DNA/RNA Amplification Phone: 1588-9788 (ext.4->2) Email: accupower-support @bioneer.co.kr DNA/RNA Amplification Overview AccuPower PreMix
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More information환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
More informationJkbcs016(92-97).hwp
Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More information김범수
Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis
More information54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3
27 2, 53-70, 2009. (Nursing Home) * ** (Nursing Home). 5 50 5 2 1,,,,, SPSS t.,,,,,,,. :,, : 2009/08/27 : 2009/09/24 : 2009/09/30 * ** (: hjkim@daelim.ac.kr) 54 한국교육문제연구제 27 권 2 호, 2009. I. 1.,,,,,,, (,
More information( )Kjhps043.hwp
Difference of Fistula Maturation Degree and Physical Property by the Types of Tube Material: An Experimental Study Sang Koo Kang, M.D. 1, Hee Chul Yu, M.D. 1,4, Woo Sung Moon, M.D. 2,4, Ju Hyoung Lee,
More informationPCR DNA Polymerase 선택가이드 일반적인 PCR 실험 Blend Taq / Blend Taq -Plus- Repairing 일반 DNA polymerase와 proofreading 기능의효소가섞인제품 Taq polymerase 보다 3~4 배낮은 error
TOYOBO HOT SUMMER BIG SALE 행사기간ㅣ 2015 년 6 월 22 일 ~ 8 월 28 일까지 2+1 PCR DNA Polymerase cdna Synthesis Kit ㅣ KOD Series ㅣ Blend Taq Series ㅣ Quick Taq HS DyeMix ㅣ ReverTra Ace Series 플러스혜택 Set 구매시, 최대 45%
More information미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
More information유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012
11-1480523-001163-01 유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012 목 차 ⅰ ⅲ ⅳ Abstract ⅵ Ⅰ Ⅱ Ⅲ i 목 차 Ⅳ ii 목 차 iii 목 차 iv 목 차 v Abstract vi Abstract σ ε vii Abstract viii Ⅰ. 서론 Ⅰ. 1 Ⅰ. 서론.
More information뉴스레터6호F?2??訝
February 2009 No.06 Roche Diagnostics Korea Co., Ltd. Focus Tech EDITORIAL February 2009 No.06 Contents Editorial 03 Focus 04 Product 10 Talk 12 Tech 14 Activity 19 Style 22 February 2009 No.06 02 03 FOCUS
More informationSpring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No ) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터
Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No. 50004) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터 (학술/제품문의) 02-2081 - 2510 www.takara.co.kr support@takara.co.kr
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.
2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.8.1. OIE 2012 ver. - EU ASF reference lab CISA-INIA(Spain)
More informationCloning
Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군
More informationReverTra Ace cdna Synthesis Kit d ReverTra Ace M-MLV RTase의 RNase H domain 부위에유전자조작을시켜, Rnase H activity를낮추어 mrna의 degradation을방지하여 cdna 합성효율을높임 Long
2016 TOYOBO SUMMER SALE 2016.7.4 ~ 9.9 cdna Synthesis Kit qpcr Master Mix KOD Polymerase Enzyme DNA Polymerase Enzyme Immuno Enhancer ReverTra Ace cdna Synthesis Kit d ReverTra Ace M-MLV RTase의 RNase H
More informationSMARTer Sequencing Kits for Next Generation Sequencing
Simple, Fast, Powerful SMARTer Solution for NGS 다카라코리아바이오메디칼 1 페이지 표지분석 NGS Library 제작시의어려움을, SMARTer 기술로극복! FFPE Sample 과같은 Low input, degraded RNA 로부터 Sequencing 을가능하게! Single Cell sample 로부터 Library
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More informationA 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
More informationDBPIA-NURIMEDIA
Original Article Journal of Apiculture 32(2) : 119~131 (217) DOI: 1.17519/apiculture.217.6.32.2.119 Development of Rapid Detection System for Small Hive Beetle (Aethina tumida) by using Ultra-Rapid PCR
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More information#Ȳ¿ë¼®
http://www.kbc.go.kr/ A B yk u δ = 2u k 1 = yk u = 0. 659 2nu k = 1 k k 1 n yk k Abstract Web Repertoire and Concentration Rate : Analysing Web Traffic Data Yong - Suk Hwang (Research
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More informationChapter 6. Nucleotides and Nucleic Acids 세포대사에서뉴클레오타이드 (nucleotide) 의기능은무엇인가? Objective 유전체학 (genomics) 과단백체학 (proteomics) 기본개념이해 재조합 DNA 기술 (recombin
Chapter 6. Nucleotides and Nucleic Acids 세포대사에서뉴클레오타이드 (nucleotide) 의기능은무엇인가? Objective 유전체학 (genomics) 과단백체학 (proteomics) 기본개념이해 재조합 DNA 기술 (recombinant DNA technology) 란? - 효소의보조인자, 대사중간산물구성성분, 유전정보함유등
More information조사연구 권 호 연구논문 한국노동패널조사자료의분석을위한패널가중치산출및사용방안사례연구 A Case Study on Construction and Use of Longitudinal Weights for Korea Labor Income Panel Survey 2)3) a
조사연구 권 호 연구논문 한국노동패널조사자료의분석을위한패널가중치산출및사용방안사례연구 A Case Study on Construction and Use of Longitudinal Weights for Korea Labor Income Panel Survey 2)3) a) b) 조사연구 주제어 패널조사 횡단면가중치 종단면가중치 선형혼합모형 일반화선형혼 합모형
More informationMicrosoft Word - Genolution RNAi Manual.doc
1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000
More informationDBPIA-NURIMEDIA
e- 비즈니스연구 (The e-business Studies) Volume 17, Number 1, February, 28, 2016:pp. 293~316 ISSN 1229-9936 (Print), ISSN 2466-1716 (Online) 원고접수일심사 ( 수정 ) 게재확정일 2015. 12. 04 2015. 12. 24 2016. 02. 25 ABSTRACT
More informationmethods.hwp
1. 교과목 개요 심리학 연구에 기저하는 기본 원리들을 이해하고, 다양한 심리학 연구설계(실험 및 비실험 설계)를 학습하여, 독립된 연구자로서의 기본적인 연구 설계 및 통계 분석능력을 함양한다. 2. 강의 목표 심리학 연구자로서 갖추어야 할 기본적인 지식들을 익힘을 목적으로 한다. 3. 강의 방법 강의, 토론, 조별 발표 4. 평가방법 중간고사 35%, 기말고사
More informationThermal Cycler Dice Real Time System II
Real Time System II www.takara.co.kr 높은정량성과재현성및신속성을기반으로하는 Real Time PCR은유전자발현해석및유전자검사에최적인방법입니다. 다파장모델 (Multi-Channel) 다카라바이오에서는 Real Time PCR용시약이나프라이머 (Perfect Real Time Support System) 와함께 96 well plate
More information저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
More informationChapter 11
Chapter 15 RNA Polymerase II: Basal Transcription 1 Eukaryotic and bacterial RNA polymerases differ in some aspects 1. eukaryotes have three RNA polymerases, with one each specifically dedicated to rrna,
More information뉴스지14호-칼라
2 3 4 5 6 TaKaRa Taq TM / TaKaRa Ex Taq TM / TaKaRa LA Taq TM / Pyrobest TM DNA Polymerase/ TaKaRa Z -Taq TM TaKaRa Taq TM TaKaRa Ex Taq TM TaKaRa LA Taq TM TaKaRa Z-Taq TM Pyrobest TM DNA Polymerase 7
More informationFlowers
Intermediate M. tuberculosis PCR 검사결과의임상적의의와결과보고 짂단검사의학과 미생물파트 김태라 차례 1. 결핵이란? 2. 결핵의미생물학적검사법소개 3. PCR ( 중합효소연쇄반응 ) 결핵짂단의문제점 4. 결론 결핵이란? 결핵은 Mycobacterium tuberculosis complex 이라는세균에의해발생하는감염병 결핵은인류역사상가장맋은생명을앗아간전염병으로기원전
More information( )Kju225.hwp
비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More information2019 TOYOBO BIG SALE 기간 : 2019년 7월 1일 ~ 9월 11일까지 최대 33% SALE qpcr Enzyme PCR Enzyme 20% 2+1 cpcr Enzyme cdna Synthesis 2+1 cdna Synthesis kit High Qua
2019 TOYOBO BIG SALE 기간 : 2019년 7월 1일 ~ 9월 11일까지 최대 33% SALE qpcr Enzyme PCR Enzyme cpcr Enzyme cdna Synthesis cdna Synthesis kit High Quality Enzyme Immuno Enhancer Cloning One-Step kit Can Get Signal
More information한약재품질표준화연구사업단 작약 ( 芍藥 ) Paeoniae Radix 생약연구과
한약재품질표준화연구사업단 작약 ( 芍藥 ) Paeoniae Radix 생약연구과 - 2 - KP 11 CP 2015 JP 16 Paeoniae Radix Paeoniae Radix Alba Paeoniae Radix Rubra Paeoniae Radix Paeonia lactiflora Pallas paeoniflorin, albiflorin 2.3% Paeonia
More informationDNA Polymerase Enzyme Quick Selection Guide for Effective PCR DNA Polymerase High Quality Polymerase General PCR / Colony PCR High Fidelity PCR (80-fo
2018 TOYOBO BIG SALE 기간 : 2018년 7월 16일 ~ 9월 21일까지 TOYOBO 전제품 최대 33% SALE PCR Enzyme cpcr Enzyme cdna Synthesis cdna Synthesis Kit qpcr Enzyme One-Step / Two-Step Kit Immuno Enhancer High Quality Enzyme
More information대한진단검사의학회지제 26 권제 1 호 2006 Korean J Lab Med 2006;26:9-13 원저 임상미생물학 뇌척수액에서실시간 - 이중 - 역전사중합효소연쇄반응을이용한장바이러스의검출 허세란 1 진선경 1 장호은 1 박경운 1,2 송정한 1,2 김의종 2 분당
대한진단검사의학회지제 26 권제 1 호 2006 Korean J Lab Med 2006;26:9-13 원저 임상미생물학 뇌척수액에서실시간 - 이중 - 역전사중합효소연쇄반응을이용한장바이러스의검출 허세란 1 진선경 1 장호은 1 박경운 1,2 송정한 1,2 김의종 2 분당서울대학교병원진단검사의학과 1, 서울대학교의과대학검사의학교실 2 Detection of Enterovirus
More informationSlide 1
2013 년대리점집체교육 Exiqon 2013 년 2 월 21 일 ( 목 ) 1 Agenda 1. mirna 란무엇인가? 2. LNA 기술의장점 3. Exiqon 제품 RNA 샘플추출 cdna 합성 qpcr Array Northern blot/in situ Hybridization Inhibitor 4. 주문방법 2 이것만은꼭기억해주세요! 1. mirna 가무엇이고어디에쓰이는지안다
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More information歯5-2-13(전미희외).PDF
The Korean Journal of Counseling 2004, Vol. 5, No. 2, 423-434,. 4 5 18 9, 9.,,,,,.,,, t-.. :,,, (,, 1996),.,,. (, 2001),... 88 98 2000, 88 12.5%(250 )98 35.6%(712 )2.8 (,,, 2001) (Corresponding Author)
More information한약재품질표준화연구사업단 금은화 ( 金銀花 ) Lonicerae Flos 생약연구과
한약재품질표준화연구사업단 금은화 ( 金銀花 ) Lonicerae Flos 생약연구과 - 2 - KP 11 Lonicerae Flos Lonicera japonica Thunberg - CP 2015 JP 16 Lonicerae Japonicae Flos Lonicerae Folium Cum Caulis Lonicera japonica Thunberg - Lonicera
More informationKinematic analysis of success strategy of YANG Hak Seon technique Joo-Ho Song 1, Jong-Hoon Park 2, & Jin-Sun Kim 3 * 1 Korea Institute of Sport Scienc
Kinematic analysis of success strategy of technique JooHo Song 1, JongHoon Park 2, & JinSun Kim 3 * 1 Korea Institute of Sport Science, 2 Catholic Kwandong University, 3 Yonsei University [Purpose] [Methods]
More information목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i
11-1480523-000748-01 배경지역 ( 백령도 ) 에서의 대기오염물질특성연구 (Ⅲ) 기후대기연구부대기환경연구과,,,,,,, Ⅲ 2010 목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i 목차 Ⅳ ii 목차 iii 목차 iv 목차 μg m3 μg m3 v 목차 vi Ⅰ. 서론 Ⅰ μm μg m3 1 Ⅰ. 서론 μg m3 μg m3 μg m3 μm 2
More informationChapter 26
11 주 RNA 합성 11.1 DNA-dependent synthesis of RNA: Bacteria에서의 transcription l RNA polymerase (5 subunits로구성 : 2α, β, β, σ) l 효소에의한 RNA 합성의특징 - Complementary sequence to template DNA - RNA chain의합성방향 : 5
More information08김현휘_ok.hwp
(Regular Paper) 21 3, 2016 5 (JBE Vol. 21, No. 3, May 2016) http://dx.doi.org/10.5909/jbe.2016.21.3.369 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a), a) An Audio Coding Technique Employing the Inter-channel
More information3월 온라인 교육
2013 년 2 분기대리점집체교육 - Protein - Takara Korea Biomedical Protein Workflow Chapter 1: 샘플준비 Chapter 2: Electrophoresis -Precast gel (Lonza/NuSep) -ProSieve EX running buffer -Protein marker Chapter 3: Staining
More informationMicroarray 기초 및 응용
Microarray 기초및분석 이바이오젠 목 차 마이크로어레이기초 정의 / 분류 / 제작기술 / 원리 Gene Expression 실험분석 시료준비 RNA QC 실험분석과정 데이터분석 -2- 바이오칩 & 마이크로어레이 - 정의 1. 유리, 실리콘, 플라스틱등의매체위에생체 분자를집적하여만든것 2. 현재 DNA, 단백질, 화학물질, 유기물질등바 이오소재를집적하여만든
More informationSheu HM, et al., British J Dermatol 1997; 136: Kao JS, et al., J Invest Dermatol 2003; 120:
Sheu HM, et al., British J Dermatol 1997; 136:884-890 Kao JS, et al., J Invest Dermatol 03; 1:446-464 1 10 0 3 Day Normal MLE Lotion Lotion MLE Cream Cream 80 7 70 6 3 Day Normal MLE Lotion Lotion MLE
More information???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
More information05052유식안101.hwp
제 출 문 식품의약품안전청장 귀 하 이 보고서를 유전자재조합식품 모니터링(부산광역시보건환경연구원/정구영) 과제의 연구 결과보고서로 제출합니다. 2005. 11. 30 주관연구기관명 : 부산광역시보건환경연구원 주관연구책임자 : 정구영 목 차 Ⅰ. 연구개발결과 요약문----------------------------------- 1 (한글)------------------------------------------
More information???? 1
The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More information<313630313032C6AFC1FD28B1C7C7F5C1DF292E687770>
양성자가속기연구센터 양성자가속기 개발 및 운영현황 DOI: 10.3938/PhiT.25.001 권혁중 김한성 Development and Operational Status of the Proton Linear Accelerator at the KOMAC Hyeok-Jung KWON and Han-Sung KIM A 100-MeV proton linear accelerator
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More information저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
More information<31372DB9DABAB4C8A32E687770>
김경환 박병호 충북대학교 도시공학과 (2010. 5. 27. 접수 / 2011. 11. 23. 채택) Developing the Traffic Severity by Type Kyung-Hwan Kim Byung Ho Park Department of Urban Engineering, Chungbuk National University (Received May
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More informationEffects of baseball expertise and stimulus speeds on coincidence-anticipation timing accuracy of batting Jong-Hwa Lee, Seok-Jin Kim, & Seon-Jin Kim* Seoul National University [Purpose] [Methods] [Results]
More information