대한진단검사의학회지제 26 권제 3 호 2006 Korean J Lab Med 2006;26: 원저 진단분자유전학 실시간중합효소연쇄반응검사와아가로오스겔전기영동에의한중합효소연쇄반응물의정량검사비교 이미경 김혜련 중앙대학교의과대학진단검사의학교실 Comparison

Size: px
Start display at page:

Download "대한진단검사의학회지제 26 권제 3 호 2006 Korean J Lab Med 2006;26: 원저 진단분자유전학 실시간중합효소연쇄반응검사와아가로오스겔전기영동에의한중합효소연쇄반응물의정량검사비교 이미경 김혜련 중앙대학교의과대학진단검사의학교실 Comparison"

Transcription

1 대한진단검사의학회지제 26 권제 3 호 2006 Korean J Lab Med 2006;26: 원저 진단분자유전학 실시간중합효소연쇄반응검사와아가로오스겔전기영동에의한중합효소연쇄반응물의정량검사비교 이미경 김혜련 중앙대학교의과대학진단검사의학교실 Comparison between Real-Time PCR and Agarose Gel Electrophoresis for DNA Quantification Mi-Kyung Lee, M.D. and Hye-Ryoun Kim, M.D. Department of Laboratory Medicine, College of Medicine, Chung-Ang University, Seoul, Korea Background : Real-time polymerase chain reaction (PCR) is generally regarded as a very accurate and time-saving method, but it is expensive to run. We evaluated the reliability of an inexpensive and a researcher-friendly gel electrophoresis-based PCR method for the quantification of mrna, and the results were compared with those obtained by real-time PCR. Methods : We compared the results of relative quantification for measured by real-time PCR and by ethidium bromide stained-agarose gel electrophoresis after end-point PCR. Results : There was significant but very weak correlation between real-time PCR and end-point PCR for relative quantification of (r=0.16, P<0.01). Conclusions : Our results suggest that the use of the gel electrophoresis-based end-point PCR is inappropriate for quantifying mrna. Therefore, in order to confirm the result of relative quantification by end-point PCR, the newly established real-time PCR method or northern hybridization should be applied. (Korean J Lab Med 2006;26:217-22) Key Words : mrna quantification, Real-time PCR, End-point PCR, Agarose gel electrophoresis 서 중합효소연쇄반응 (polymerase chain reaction, PCR) 은주형 DNA를 10 6 에서 10 7 배로증폭시켜민감하게검출할수있는방법으로, 1984년 Mullis와 Faloona에의해개발되어의학을포함한생명과학전분야와식품, 환경등의다양한분야에서널리활용되고있으며 [1], 역전사 (reverse transcription, RT) 반응과함께활용함으로유전자발현 (gene expression) 연구에도많이시도되 접 수 : 2005년 11월 22일 접수번호 : KJLM1907 수정본접수 : 2006년 3월 20일 게재승인일 : 2006년 4월 18일 교신저자 : 이미경 우 서울시용산구한강로 3가 중앙대학교용산병원진단검사의학과 전화 : , Fax: cpworld@cau.ac.kr 론 * 본논문은 2005 학년도중앙대학교학술연구비지원에의한것임. 고있다. 즉, 전사량을알기위한 mrna 측정에는일반적으로노던블로팅 (Northern blotting) 과인시튜잡종형성 (in situ hybridization)[2], RNase protection assay[3], cdna microarray[4] 및 RT-PCR 등의 5가지방법이사용되고있으며, 이중 RT-PCR 은세포수가적은검체나유전자발현이낮은경우에도측정이가능하여가장예민하고다양하게적용할수있는방법으로평가되고있다 [5, 6]. 따라서 PCR 산물의정확한정량과보다신속하고간편한결과확인에대한요구가증가하고있으나, PCR 반응의끝점 (end-point) 산물을검출하는기존의 PCR은정량시예민도가떨어지거나 PCR 후에많은시간과추가과정이요구되기도하며, 이로인한오염의가능성등으로인해제한이있었다 [7]. 최근 PCR의매주기마다실시간으로시행되는형광의검출과정량을통해 PCR시지수기 (exponential phase) 범위내에서증폭산물을측정하는실시간 (real-time) PCR 방법이도입되어, 기존 RT-PCR에서 PCR 후의복잡한검사과정을줄이고폐쇄관 217

2 218 이미경 김혜련 분석하에서실시간으로증폭산물을정확하게분석하게되었다 [5, 8]. 그러나아직까지는실시간중합효소연쇄반응검사의도입과검사수행시사용하여야하는전용시약과소모품의구입에많은비용이필요하므로, 실시간중합효소연쇄반응검사장비가없는실험실에서의사용이제한적이다. 이에본연구에서는실시간중합효소연쇄반응검사장비가없는실험실이나보유하고있더라도고가의전용시약사용에제한이있는경우, 기존 PCR을사용하여 PCR 후전기영동과브롬화에티듐 (ethidium bromide, EtBr) 염색만으로측정한유전자발현반정량결과를어느정도신뢰할수있는지를평가하고자하였다. 이를위하여 matrix metalloproteinase-1 () 유전자의 glyceraldehyde-3-phosphate dehydrogenase () 유전자에대한상대정량을실시간중합효소연쇄반응을시행하여얻은결과와실시간중합효소연쇄반응후의끝점 (end-point) PCR 산물을아가로오스겔 (agarose gel) 에전기영동한후농도계측 (densitometry) 의원리에의하여반정량하여얻은결과를비교분석하였다. 대상및방법 1. 시발체합성과표준곡선 (standard curve) 준비 성숙흰쥐 (rat) 의 과 유전자를증폭할수있는시발체는 Primer Express 2.0 (Applied Biosystems, Foster City, CA, USA) 프로그램을이용하여고안하였다 (Table 1). 표준곡선에필요한 genomic DNA는 Wizard Genomic DNA Purification Kit (Promega, Madison, WI, USA) 를사용하여추출한후, 각각의유전자들을 PCR로증폭하였다. 이때의 PCR 반응액은시발체각각 0.5 M, dntp 250 M, Tris-HCl (ph 8.3) 10 mm, KCl 50 mm, MgCl mm, Taq DNA polymerase (Roche Diagnostic Corp., Indianapolis, IN, USA), 0.5 unit, DNA 주형 (template) 4 L에멸균증류수를첨가하여총 20 L로만들었다. PCR 은자동온도조절기 (GeneAmp PCR system 9700, Perkin Elmer, Foster City, CA, USA) 를이용하여 94 에서 5분간전변성시킨후, 94 에서 30초, 55 에서 30초및 72 에서 30초씩 35회증폭하고마지막으로 72 에서 10분동안연장반응시켰다. 각각의증폭산물은 2% 아가로오스겔에서전기영동한후 EtBr로염색하여자외선하에서증폭산물을확인하였 Table 1. Primers used for PCR Primers Oligonucleotide sequence (5-3 ) Forward TGGGATTTCCAAAAGAGGTG Reverse ACGTGGTTCCCTGAGAAGA Forward AATGTATCCGTTGTGGATCTGA Reverse AGCCCAGGATGCCCTTTA Abbreviations: See text. Product size (bp) 으며, QIAquick PCR purification kit (Qiagen, Valencia, CA, USA) 로정제한후 4 L씩분주하여 -75 에보관하다가 realtime PCR시 10배씩연속적으로희석하여 (; , ; ) 표준곡선을위한주형으로사용하였다. 2. 총 RNA 분리총 RNA는 30마리의성숙흰쥐의대퇴골골절부가골부위로부터 RNAqueous TM -4PCR (Ambion, Austin, TX, USA) 을사용하여추출하였으며, 추출된 RNA 용액에남아있을 DNA 제거를위하여 DNase I (2 units/ L) 과완충액을가하여 37 에서 1시간동안반응시켰다. 3. cdna 합성 cdna 합성을위한역전사는 1st Strand cdna Synthesis Kit for RT-PCR (Roche Diagnostic Corp.) 을사용하여시행하였으며, 총 RNA 10 L와 10 반응완충액 (100 mm Tris, 500 mm KCl, ph 8.3) 5 L, 25 mm MgCl 2 10 L, dntp mix (datp, dctp, dttp, dgtp, 각각 10 mm) 5 L, random primer p(dn) 6 5 L, RNase inhibitor 2.5 L, AMV reverse transcriptase 2 L에 DEPC-처리멸균증류수를첨가하여총 50 L로만들었다. 역전사반응은자동온도조절기 (GeneAmp PCR system 9700) 에서 25 에서 10분, 50 에서 60분간반응시키고역전사효소의불활성화를위해 99 에서 5분간반응시켰다. 4. 실시간중합효소연쇄반응검사실시간중합효소연쇄반응검사는 ABI PRISM 7000 (Applied Biosystems) 을사용하여시행하였다. PCR 반응액은 2 SYBR Green PCR Master Mix (Applied Biosystems) 12.5 L, 시발체각각 320 nm, DNA 주형 2 L를넣고멸균증류수를첨가하여총 25 L가되게하였고, 50 에서 2분, 95 에서 10분간반응시킨후 95 에서 15초, 60 에서 1분씩 40회반응시키는조건으로증폭하였다. 이때 SYBR Green I은 PCR로합성된이중나선 DNA에결합하여형광을나타내게되므로, 반응이진행됨에따라발생하는형광신호를각주기마다감지하여유전자증폭양상을실시간으로분석함으로증폭산물의생성량을측정하게된다. 즉증폭의초기에는형광의증가가감지되지않으나일정주기가지나면축적된형광량이비로소기기에감지되기시작하는데, 이렇게형광량이감지될수있을정도로두드러지게증가하는시점의주기수를역치주기 (C T, threshold cycle) 로명명하고있다. 그러므로분석하고자하는검체에서대상유전자의 C T 값을측정하면, 농도를알고있는대상유전자의증폭산물을단계적으로희석하여 PCR 을시행한검체로부터그려진표준곡선을이용하여대

3 실시간중합효소연쇄반응검사와아가로오스겔전기영동에의한중합효소연쇄반응물의정량검사비교 Rn a b c d Ct Cycle Number A Log Co B Fig. 1. (A) Generation of an external standard curve for real-time PCR (a: , b: , c: , d: ng/ L). The graph shows the interrelationship between log F (fluorescence) and the amplification cycle; background levels are indicated by the horizontal line. The cycle at which the sample fluorescence crosses the background line is set as the threshold cycle (C T ). (B) Standard curve of for real-time PCR. The graph shows the regression curve resulting from threshold determinations for the serially diluted PCR products. a b c d NTC 한결과로부터그려진표준곡선을이용하여 PCR 증폭산물을정량검사하였다 (Fig. 2). 6. 유전자의상대정량실시간중합효소연쇄반응과아가로오스겔전기영동에의한대상유전자발현은 PCR 간의변이를보상하기위하여기준유전자 () 에대한대상유전자 () 의비율을계산하여상대정량하였다. Fig. 2. Quantification of mrna by RT-PCR and ethidium bromide-stained agarose gel electrophoresis. Quantification of and was accomplished using densitometry of the dye binding intensity of UV-irradiated PCR products. A standard curve was calculated with four values (a, b, c, d) ranging from to ng/ L () or to ng/ L () PCR product and serves for the quantification of other samples. Expression of was normalized to that of expression in the same sample. Abbreviation: NTC, no template control. 상유전자의 PCR 증폭산물의양을산출할수있었다 (Fig. 1). 또한증폭이끝난 PCR 산물의해리곡선 (dissociation curve) 분석을시행하여증폭산물의융해온도를확인함으로써유전자증폭시단일산물이증폭됨을확인하였다. 5. 아가로오스겔전기영동에서끝점 PCR 산물의정량 증폭이끝난 PCR 산물을 2% 아가로오스겔에전기영동한후 1 g/ml EtBr로염색하고, Image system (ChemiDoc XRS system, Bio-Rad Laboratories, Hercules, CA, USA) 의 Quantity One 프로그램을사용하여자외선 (UV) 투시하에서방출되는형광강도를측정하였다. 이때농도를알고있는각유전자의증폭산물을 10배씩연속적으로희석하여 ( ) PCR을시행 결과 과 정량을위한표준곡선의직선식은 realtime PCR에서는 y=-3.55x+28.36, r 2 =1.00 () 와 y= -3.27x+25.87, r 2 =0.99 () 이었고, end-point PCR에서는 y=0.129x-178, r 2 =0.86 () 과 y=0.239x-620, r 2 =0.89 () 이었다. 실시간중합효소연쇄반응과끝점 PCR 산물의아가로오스겔전기영동에의한 과 유전자에대한정량값은상관계수가각각 r=0.33과 r=0.35로낮은상관관계를보였다. 기준유전자로이용한 유전자에대한대상유전자의비율을계산하여얻은 유전자의상대정량값의두가지정량방법간의상관계수가 r=0.16으로매우낮은 (P<0.01) 상관관계를나타내었다 (Table 2, Fig. 3). 고찰 mrna 정량을통한유전자발현연구에서 RT-PCR에의한유전자정량은 mrna의작은변화까지검출할수있어유용한방

4 220 이미경 김혜련 Relative quantification of 1, , , , , r=0.35 (P<0.01) r=0.33 (P<0.01) 1, r=0.16 (P<0.01) ,000 1,500 2, ,000 1,500 2,000 2, Real-time PCR A Real-time PCR B Real-time PCR C Fig. 3. Comparison between real-time PCR and end-point PCR in (A) mrna (B) mrna (C) relative quantification of ( mrna/ mrna). End-point PCR End-point PCR End-point PCR Table 2. Comparison between real-time PCR and end-point PCR for relative quantification of mrna Relative quantification Sample No. Realtime Endpoint Realtime Endpoint Realtime Endpoint , , , , , , , , , , , , , , , , , , , , , , , , , , , Abbreviations: See text. 법이지만재현성이낮은것이문제로알려져있어, 검체처리와 RNA 추출, cdna 합성을위한역전사반응, PCR 및 PCR 산물의정량등각단계별엄격한정도관리가요구되고있다 [9]. 본연구에서는 PCR 산물의정량시실시간중합효소연쇄반응검사 와끝점 PCR 후전기영동에의한유전자정량결과를비교하기위하여, 검체처리에서 PCR까지동일한검체로시행한후결과를비교하여보았다. 대상유전자인 과기준유전자인 GA- PDH 유전자에대한정량값이두방법간에모두낮은상관관계를보여, 이들유전자의정량값을이용한 유전자의상대정량값역시두방법간에매우낮은상관관계를보였다. 유전자상대정량시본연구결과에서얻은실시간중합효소연쇄반응과끝점 PCR 후전기영동에의한유전자정량값이차이를보일수있는가능성에대하여검토하여보았다. 첫째, PCR은대상유전자의증폭효율에따라반응단계를크게세부분으로나눌수있다. 즉, PCR의매주기마다정확하게 PCR 산물이배가되는반응초기로 100% 의반응효율을보여매우특이적이고정확한반응단계인지수기혹은로그기와반응성분들이소모되어반응이느려지거나일부증폭산물이분해되기시작하여반응의효율도가검체마다매우다양하게나타날수있는선형기 (linear phase), 그리고반응성분들의소모가진행되고반응부산물에의한합성반응의저해등으로반응의효율이감소하여증폭반응이중단되거나증폭산물의분해가나타날수있는편평기 (plateau phase) 또는끝점기 (end-point phase) 가있다 [10, 11]. 따라서끝점 PCR의경우편평기에서측정을하게됨으로 PCR 반응의효율이감소되어증폭반응이중단되거나증폭산물의분해가나타나 PCR 증폭산물이정확하게초기의주형량을반영하지않았을가능성이있다. 둘째, mrna 정량시검사내정밀도가기존의 RT- PCR에서끝점 PCR 산물을전기영동하여 EtBr로염색하고농도계측의원리로정량한경우 (CV=44.9%) 가 SYBR green I을사용하여실시간중합효소연쇄반응에의해얻은정량값 (CV=14.2%) 보다낮았다는보고도있어 [12], 끝점 PCR에의한정량이실시간중합효소연쇄반응에비해변이가크다는점이가능한원인으로생각된다. 셋째, DNA 정량시측정가능한동적범위 (dynamic range) 의차이를생각수있다. 일반적으로기존의끝점 PCR 후 EtBr로염색하여정량하는방법에비해실시간중합효소연쇄반응에의한정량방법이동적범위가크다고알려져있다 [12]. EtBr은두가닥 DNA의인접한염기쌍사이에삽입할수있는방향성의평면구조를가지고있고 [13], DNA 염기구성의차이에영향을받지않으면서 DNA에결합하면형광이증가되는능력이있어,

5 실시간중합효소연쇄반응검사와아가로오스겔전기영동에의한중합효소연쇄반응물의정량검사비교 221 DNA를확인하는방법으로많이사용되고있다. 그러나아가로오스겔에서의해상도는약 10배이상의차이가있어야감별이가능한정도이다. 끝점 PCR에의한증폭산물을측정하는방법에는 EtBr 이나 SYBR green과같은 DNA 삽입형광색소를사용하거나결합된방사능측정 [14], 써던블롯과같은보합반응을이용한방법, 형광이나발광을내는효소에결합시킨고체상을이용하는방법 [15, 16], 그리고고성능액체크로마토그래피 (HPLC)[17] 나모세관전기영동 [18] 등이있다. 이들방법중 PCR 후아가로오스겔에전기영동하여 EtBr로염색하는것은기존검사실에서친숙한방법으로간편하고경제적이어서 [19, 20], 현재 PCR 산물의정량을위한방법중가장신뢰할수있는방법으로생각되고있는실시간중합효소연쇄반응검사결과와상관성이좋으면실시간중합효소연쇄반응검사장비가없는검사실에서도이방법을이용하여어느정도신뢰성있는예비실험결과를얻을수있으므로 PCR 산물의정량을통한유전자발현연구에쉽게접근할수있을것으로기대되어본연구를시도하였다. 그러나본연구에서끝점 PCR 결과가초기주형량을정확하게반영하는것으로알려져있으며노던블롯법과도우수한상관을보인다고보고된 [21] 실시간중합효소연쇄반응검사정량값과매우낮은상관관계를보여, 끝점 PCR 후전기영동과 EtBr 염색을통한 mrna 정량은정확한결과를얻기어려울것으로생각되므로기존의끝점 PCR에의한유전자정량결과는실시간중합효소연쇄반응검사나노던블롯법으로검증하는과정이필요할것으로사료되었다. 또한유전자발현연구시 mrna의작은변화까지도검출할수있다고알려진 RT- PCR에서실시간중합효소연쇄반응검사결과의신뢰도를높이기위하여 PCR 효율이나표준곡선의제조등각단계별정도관리와실시간중합효소연쇄반응검사에의한상대정량값의통계학적인차이가유전자발현에미치는기능적차이를확인하는연구가지속적으로이루어져야할것으로사료되었다. 요약배경 : 최근 PCR의매주기마다증폭산물을측정하는실시간 (real-time) PCR 방법이도입되어, 증폭산물을정확하게분석하게되었다. 그러나실시간중합효소연쇄반응검사도입과검사수행시사용하여야하는전용시약과소모품의구입에많은비용이필요하므로, 실시간중합효소연쇄반응검사장비가없는실험실에서의사용이제한적이다. 이에본연구에서는기존의끝점 PCR을사용하여전기영동과브롬화에티듐 (EtBr) 염색만으로신뢰할수있는유전자발현연구를수행할수있는지를실시간중합효소연쇄반응검사법과의비교분석을통하여평가하고자하였다. 방법 : 실시간중합효소연쇄반응검사를시행하여얻은정량값과실시간중합효소연쇄반응검사후의끝점 PCR 산물을아가로오스겔에전기영동한후브롬화에티듐으로염색하고자외선투시 하에서방출되는형광강도를측정하여정량한결과로각각 MMP- 1 유전자의상대정량을시행하여비교하였다. 결과 : 실시간중합효소연쇄반응검사와끝점 PCR 산물의아가로오스겔전기영동에의한 유전자의상대정량값은상관계수가 r=0.16 (P<0.01) 으로매우낮은상관관계를나타내었다. 결론 : 끝점 PCR 후전기영동과브롬화에티듐염색을통한 mrna 정량은정확한결과를얻기어려울것으로생각되므로, 기존의끝점 PCR에의한유전자정량결과는실시간중합효소연쇄반응검사나노던블롯법으로검증하는과정이필요할것으로사료되었다. 참고문헌 1. Mullis KB and Faloona FA. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol 1987;155: Parker RM and Barnes NM. mrna: detection by in situ and northern hybridization. Methods Mol Biol 1999;106: Hod Y. A simplified ribonuclease protection assay. Biotechniques 1992;13: Clarke PA, te Poele R, Wooster R, Workman P. Gene expression microarray analysis in cancer biology, pharmacology, and drug development: progress and potential. Biochem Pharmacol 2001;62: Bustin SA. Absolute quantification of mrna using real-time reverse transcription polymerase chain reaction assays. J Mol Endocrinol 2000;25: Wang T and Brown MJ. mrna quantification by real time TaqMan polymerase chain reaction: validation and comparison with RNase protection. Anal Biochem 1999;269: Holland PM, Abramson RD, Watson R, Gelfand DH. Detection of specific polymerase chain reaction product by utilizing the 5 3 exonuclease activity of Thermus aquaticus DNA polymerase. Proc Natl Acad Sci USA 1991;88: Higuchi R, Fockler C, Dollinger G, Watson R. Kinetic PCR analysis: real-time monitoring of DNA amplification reactions. Biotechnology 1993;11: Ovstebo R, Haug KB, Lande K, Kierulf P. PCR-based calibration curves for studies of quantitative gene expression in human monocytes: development and evaluation. Clin Chem 2003;49: Heid CA, Stevens J, Livak KJ, Williams PM. Real time quantitative PCR. Genome Res 1996;6: Wittwer CT, Herrmann MG, Moss AA, Rasmussen RP. Continuous fluorescence monitoring of rapid cycle DNA amplification. Biotechniques 1997;22:130-1, Schmittgen TD, Zakrajsek BA, Mills AG, Gorn V, Singer MJ, Reed

6 222 이미경 김혜련 MW. Quantitative reverse transcription-polymerase chain reaction to study mrna decay: comparison of endpoint and real-time methods. Anal Biochem 2000;285: Heath PJ, Clendenning JB, Fujimoto BS, Schurr JM. Effect of bending strain on the torsion elastic constant of DNA. J Mol Biol 1996;260: Schneeberger C, Speiser P, Kury F, Zeillinger R. Quantitative detection of reverse transcriptase-pcr products by means of a novel and sensitive DNA stain. PCR Method Appl 1995;4: Hall LL, Bicknell GR, Primrose L, Pringle JH, Shaw JA, Furness PN. Reproducibility in the quantification of mrna levels by RT-PCR- ELISA and RT competitive-pcr-elisa. BioTechniques 1998;24: Siddiqi AM, Jennings VM, Kidd MR, Actor JK, Hunter RL. Evaluation of electrochemiluminescence- and bioluminescence-based assays for quantitating specific DNA. J Clin Lab Anal 1996;10: Hayward-Lester A, Oefner PJ, Sabatini S, Doris PA. Accurate and absolute quantitative measurement of gene expression by single-tube RT-PCR and HPLC. Genome Res 1995;5: Borson ND, Strausbauch MA, Wettstein PJ, Oda RP, Johnston SL, Landers JP. Direct quantitation of RNA transcripts by competitive single-tube RT-PCR and capillary electrophoresis. Biotechniques 1998;25: Huber R, Kunisch E, Gluck B, Egerer R, Sickinger S, Kinne RW. Comparison of conventional and real-time RT-PCR for the quantitation of jun protooncogene mrna and analysis of junb mrna expression in synovial membranes and isolated synovial fibroblasts from rheumatoid arthritis patients. Z Rheumatol 2003;62: Bradford WD, Cahoon L, Freel SR, Hoopes LL, Eckdahl TT. An inexpensive gel electrophoresis-based polymerase chain reaction method for quantifying mrna levels. Cell Biol Educ 2005;4: Frade JP, Warnock DW, Arthington-Skaggs BA. Rapid quantification of drug resistance gene expression in Candida albicans by reverse transcriptase LightCycler PCR and fluorescent probe hybridization. J Clin Microbiol 2004;42:

대한진단검사의학회지 : 제 24 권제 5 호 2004 Korean J Lab Med 2004; 24: 진단유전학 실시간중합효소연쇄반응을이용한상대정량에서표준곡선의영향 이미경 김태형 1 중앙대학교의과대학진단검사의학교실, 비뇨기과학교실 1 Influence of

대한진단검사의학회지 : 제 24 권제 5 호 2004 Korean J Lab Med 2004; 24: 진단유전학 실시간중합효소연쇄반응을이용한상대정량에서표준곡선의영향 이미경 김태형 1 중앙대학교의과대학진단검사의학교실, 비뇨기과학교실 1 Influence of 대한진단검사의학회지 : 제 24 권제 5 호 2004 Korean J Lab Med 2004; 24: 327-33 진단유전학 실시간중합효소연쇄반응을이용한상대정량에서표준곡선의영향 이미경 김태형 1 중앙대학교의과대학진단검사의학교실, 비뇨기과학교실 1 Influence of Standard Curves on Relative Quantification using Real-time

More information

슬라이드 1

슬라이드 1 Real Time PCR 목차 1. PCR 및 Real Rime PCR 원리 2. Real Time PCR 검출방법 3. Real Time PCR 정량방법 4. Takara Real Time PCR 시약 5. 금일실험내용 Polymerase Chain Reaction Taq DNA Polymerase - Thermostable DNA polymease from

More information

cdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR

cdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR RT-PCR 법 II. 역전사효소반응 ( 주 ) 다인바이오연구소 현재분자생물학분야에서 RNA 수준의 gene expression ( 유전자발현 ) 과 cdna (complementary DNA) cloning에널리이용되고있는 RT-PCR (Reverse transcription ploymerase chain reaction) 은생명정보가 DNA에서 RNA로전달된다는분자생물학분야의

More information

Slide 1

Slide 1 PrimeScript 1st strand cdna Synthesis Kit 1 Central Dogma replication transcription 0 processing translation 오늘의내용은? 조직추출 RNAiso Plus 5 mrna 우리가관심있는 mrna가차지하는비율이극히일부이기때문에관심있는 mrna를증폭해서그것을눈으로확인할정도로만들어주는것이다.

More information

실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양

실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양 실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양의시료를대량으로증폭할수있다는장점과그과정이간단하여 Cloning, Sequencing 등의기본기술로응용되었다.

More information

슬라이드 1

슬라이드 1 TAKARA 1. PCR 2. qpcr 2014. 02. 13. 최유미 DNA? DNA 생물체 > 기관 > 세포 >DNA DNA (Deoxyribonucleic acid) 세포내에서생물의유젂정보를보관하는물질 구성 : Adenine, Thymine, Cytosine, Guanine 종특이적, 개체특이적 PCR (Polymerase Chain Reaction)

More information

TOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme

TOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme PCR Enzyme 부터 qpcr 까지! PCR 실험은 TOYOBO 로해결하세요! 행사기간 : 7 월 15 일 ~ 9 월 13 일까지 TOYOBO Reagent PCR Enzyme High Quality PCR Enzyme cdna Synthesis Kit qpcr One-step RT Kit Immunoreaction Enhancer Solution 추가

More information

Automated high multiplex qPCR platform for simultaneous detection and quantification of multiple nucleic acid targets

Automated high multiplex qPCR platform for simultaneous detection and quantification of multiple nucleic acid targets PCR FlashGel System 2013. 04. 24 PCR 2013. 04. 24 순서 1. PCR 이란 2. PCR 실험의기본조건 3. PCR 효소선택가이드 4. Hot Start PCR의원리 5. PCR 실험시 Troubleshooting 6. PCR 장비 _TP350 소개 PCR(Polymerase Chain Reaction) PCR 이란? -

More information

고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn

고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna

More information

α α α α α

α α α α α α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를

More information

Crt114( ).hwp

Crt114( ).hwp cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

Selection chart of Bioneer s cdna synthesis products Categories Application Product cdna Synthesis Kits One step RT-PCR Kits One step RT-qPCR Kits RTa

Selection chart of Bioneer s cdna synthesis products Categories Application Product cdna Synthesis Kits One step RT-PCR Kits One step RT-qPCR Kits RTa Selection chart of Bioneer s cdna synthesis products Categories Application Product cdna Synthesis Kits One step RT-PCR Kits One step RT-qPCR Kits RTase 표준 cdna 합성 높은효율의 cdna 합성 복잡한 2 차구조 RNA 의 cdna 합성

More information

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를 Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는

More information

mau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions

More information

Cloning

Cloning Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,

More information

Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No ) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터

Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No ) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터 Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No. 50004) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터 (학술/제품문의) 02-2081 - 2510 www.takara.co.kr support@takara.co.kr

More information

뉴스레터6호F?2??訝

뉴스레터6호F?2??訝 February 2009 No.06 Roche Diagnostics Korea Co., Ltd. Focus Tech EDITORIAL February 2009 No.06 Contents Editorial 03 Focus 04 Product 10 Talk 12 Tech 14 Activity 19 Style 22 February 2009 No.06 02 03 FOCUS

More information

01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6

01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview

More information

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법

More information

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770> 대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실

More information

- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol

More information

ITEM 1 PCR Enzyme 20% DNA Polymerase Enzyme Quick Selection Guide for Effective PCR DNA Polymerase General PCR / Colony PCR Long PCR (Max. 23 kb) Hot

ITEM 1 PCR Enzyme 20% DNA Polymerase Enzyme Quick Selection Guide for Effective PCR DNA Polymerase General PCR / Colony PCR Long PCR (Max. 23 kb) Hot 2017 Summer BIG SALE 2017.7.3 ~ 9.8 ITEM 1 P C R Enzyme cpcr Enzyme 20% High Quality Enzyme ITEM 2 cdna Synthesis cdna Synthesis Kit 최대 33 % off ITEM 3 q P C R Enzyme Two-Step / One-Step Kit NGS Library

More information

EZ-Cloning kit

EZ-Cloning kit EZ TM 5 /3 RACE PCR Kit Instruction Manual Korean Ver. Kit for 10 reactions Cat.# EZ025 EZ TM 5 /3 RACE PCR Kit Table of Contents I. 제품설명... 3 II. 원리... 4 III. 제품구성... 7 IV. 염기서열정보... 8 V. 주의사항... 8 VI.

More information

PCR DNA Polymerase 선택가이드 일반적인 PCR 실험 Blend Taq / Blend Taq -Plus- Repairing 일반 DNA polymerase와 proofreading 기능의효소가섞인제품 Taq polymerase 보다 3~4 배낮은 error

PCR DNA Polymerase 선택가이드 일반적인 PCR 실험 Blend Taq / Blend Taq -Plus- Repairing 일반 DNA polymerase와 proofreading 기능의효소가섞인제품 Taq polymerase 보다 3~4 배낮은 error TOYOBO HOT SUMMER BIG SALE 행사기간ㅣ 2015 년 6 월 22 일 ~ 8 월 28 일까지 2+1 PCR DNA Polymerase cdna Synthesis Kit ㅣ KOD Series ㅣ Blend Taq Series ㅣ Quick Taq HS DyeMix ㅣ ReverTra Ace Series 플러스혜택 Set 구매시, 최대 45%

More information

DNA/RNA Amplification Overview AccuPower PreMix series 는세계적으로기술력을인정받은특허기술로보다경제적인가격과편리한방법으로실험할수있는제품입니다. Conventional PCR, Real-Time PCR 수행을위한 DNA ampli

DNA/RNA Amplification Overview AccuPower PreMix series 는세계적으로기술력을인정받은특허기술로보다경제적인가격과편리한방법으로실험할수있는제품입니다. Conventional PCR, Real-Time PCR 수행을위한 DNA ampli DNA Amplification RNA Amplification Real-Time PCR Customized PCR DNA/RNA Amplification Phone: 1588-9788 (ext.4->2) Email: accupower-support @bioneer.co.kr DNA/RNA Amplification Overview AccuPower PreMix

More information

Week01-workshop.hwp

Week01-workshop.hwp Polymerase Chain Reaction 과반응산물의정제 김상태서울대학교천연물과학연구소 adanson@plaza.snu.ac.kr A. Polymerase Chain Reaction Polymerase chain reaction (PCR) 은 genome 상의특정 DNA 염기서열을 denaturation, primer annealing, DNA polymerase에의한

More information

슬라이드 1

슬라이드 1 EVENT 퀴아젠인기상품연말특별가전 200203 Top Taq DNA Polymerase (250U) 90,000 72,000 200205 Top Taq DNA Polymerase (1000U) 331,000 281,350 200403 Top Taq Master Mix Kit(250U) 104,000 83,200 201203 Taq DNA Polymerase

More information

< D C8ABBFB5C1D828B1E8B9CEB1E2292E687770>

< D C8ABBFB5C1D828B1E8B9CEB1E2292E687770> 임상검사와정도관리 : 제 3 권제 2 호 2009 J Lab Med Qual Assur 2009; 3:275-9 275 SLAN real-time PCR 장비를이용한 Artus HBV LC PCR kit 의평가 김민기 이동영 장윤환 이진경 홍석일 홍영준 원자력병원진단검사의학과 Evaluation of Artus HBV LC PCR kit using SLAN

More information

Ver.4 (KR) All about RT (cdna Synthesis) 8-11 Munpyeongseo-ro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea) (Internatio

Ver.4 (KR) All about RT (cdna Synthesis) 8-11 Munpyeongseo-ro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea) (Internatio 20170619 Ver.4 (KR) All about RT (cdna Synthesis) 8-11 Munpyeongseo-ro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea)1588-9788 (International) +82-42 - 930-8777 Email: sales@bioneer.com Selection

More information

Chapter 11 Rate of Reaction

Chapter 11 Rate of Reaction Chapter 11 Rate of Reaction 11 11.1 ? Rate Law Kinetics : 11 11.2 CO(g) + NO 2 (g) CO 2 (g) + NO(g) E a =134 kj CO(g) + NO 2 (g) H = -226 kj CO 2 (g) + NO(g) 11 11.3 N 2 O 5 (g) 2NO 2 (g) + 1/2 O 2 (g)

More information

SMARTer 시리즈

SMARTer 시리즈 SMARTer 시리즈 SMARTer Solutions 2014.12.17 다카라코리아바이오메디칼 SMART 하게실험하고 SMARTer 한결과를얻는방법 Clontech SMARTer 시리즈 Contents 1. Introduction 1. 역전사반응이란? 2. 기존역전사반응의한계 2. SMARTer 시리즈 1. SMARTer 란? 2. SMARTer 시리즈와적용

More information

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu 한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim

More information

3월 온라인 교육

3월 온라인 교육 2013 년 2 분기대리점집체교육 - Protein - Takara Korea Biomedical Protein Workflow Chapter 1: 샘플준비 Chapter 2: Electrophoresis -Precast gel (Lonza/NuSep) -ProSieve EX running buffer -Protein marker Chapter 3: Staining

More information

ReverTra Ace cdna Synthesis Kit d ReverTra Ace M-MLV RTase의 RNase H domain 부위에유전자조작을시켜, Rnase H activity를낮추어 mrna의 degradation을방지하여 cdna 합성효율을높임 Long

ReverTra Ace cdna Synthesis Kit d ReverTra Ace M-MLV RTase의 RNase H domain 부위에유전자조작을시켜, Rnase H activity를낮추어 mrna의 degradation을방지하여 cdna 합성효율을높임 Long 2016 TOYOBO SUMMER SALE 2016.7.4 ~ 9.9 cdna Synthesis Kit qpcr Master Mix KOD Polymerase Enzyme DNA Polymerase Enzyme Immuno Enhancer ReverTra Ace cdna Synthesis Kit d ReverTra Ace M-MLV RTase의 RNase H

More information

- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -

More information

2019 TOYOBO BIG SALE 기간 : 2019년 7월 1일 ~ 9월 11일까지 최대 33% SALE qpcr Enzyme PCR Enzyme 20% 2+1 cpcr Enzyme cdna Synthesis 2+1 cdna Synthesis kit High Qua

2019 TOYOBO BIG SALE 기간 : 2019년 7월 1일 ~ 9월 11일까지 최대 33% SALE qpcr Enzyme PCR Enzyme 20% 2+1 cpcr Enzyme cdna Synthesis 2+1 cdna Synthesis kit High Qua 2019 TOYOBO BIG SALE 기간 : 2019년 7월 1일 ~ 9월 11일까지 최대 33% SALE qpcr Enzyme PCR Enzyme cpcr Enzyme cdna Synthesis cdna Synthesis kit High Quality Enzyme Immuno Enhancer Cloning One-Step kit Can Get Signal

More information

Microsoft PowerPoint - 12-전기영동.pptx

Microsoft PowerPoint - 12-전기영동.pptx 전기영동 실험목적 기본적인분자실험장비인피펫, 저울, 원심분리 기, vortex mixer 사용법숙지 전기영동과정을통해서 DNA 크기비교 여러가지피펫종류들 Basic type P2 white tip P10 white tip P20 yellow tip P100 yellow tip P200 yellow tip P1000 blue tip Multi-channel pipette

More information

±èÇ¥³â

±èÇ¥³â 533 Fig. 1. Dead zone. Nine echoes are positioned 2-10 mm below the scan surface with 1 mm distance. All nine echoes are clearly visualized. 534 Fig. 2. Vertical and horizontal measurement. 10 cm distance

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Printed in the Republic of Korea "/"-:5*$"- 4$*&/$& 5&$)/0-0(: Vol. 18, No. 5, 425-430, 2005» 677*4 Ÿ w sƒ ½»x Á Á½ k w y w, w y œw Some considerations for the analytical approaches to measure atmospheric

More information

Microsoft Word - Genolution RNAi Manual.doc

Microsoft Word - Genolution RNAi Manual.doc 1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000

More information

Ver.3(KR) All about Real-Time PCR 8-11, Munpyeongseoro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea) (International) +

Ver.3(KR) All about Real-Time PCR 8-11, Munpyeongseoro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea) (International) + 20170402 Ver.3(KR) All about Real-Time PCR 8-11, Munpyeongseoro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea) 1588-9788 (International) +82-42 - 930-8777 Email: sales@bioneer.com Real-Time

More information

DNA Polymerase Enzyme Quick Selection Guide for Effective PCR DNA Polymerase High Quality Polymerase General PCR / Colony PCR High Fidelity PCR (80-fo

DNA Polymerase Enzyme Quick Selection Guide for Effective PCR DNA Polymerase High Quality Polymerase General PCR / Colony PCR High Fidelity PCR (80-fo 2018 TOYOBO BIG SALE 기간 : 2018년 7월 16일 ~ 9월 21일까지 TOYOBO 전제품 최대 33% SALE PCR Enzyme cpcr Enzyme cdna Synthesis cdna Synthesis Kit qpcr Enzyme One-Step / Two-Step Kit Immuno Enhancer High Quality Enzyme

More information

2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.

2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2. 2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.8.1. OIE 2012 ver. - EU ASF reference lab CISA-INIA(Spain)

More information

서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소

서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소 2012 년도기초과학연구소 대학중점연구소심포지엄 마이크로파센서를이용한 혈당측정연구 일시 : 2012 년 3 월 20 일 ( 화 ) 14:00~17:30 장소 : 서강대학교과학관 1010 호 주최 : 서강대학교기초과학연구소 Contents Program of Symposium 2 Non-invasive in vitro sensing of D-glucose in

More information

09È«¼®¿µ 5~152s

09È«¼®¿µ5~152s Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,

More information

SMARTer Sequencing Kits for Next Generation Sequencing

SMARTer Sequencing Kits for Next Generation Sequencing Simple, Fast, Powerful SMARTer Solution for NGS 다카라코리아바이오메디칼 1 페이지 표지분석 NGS Library 제작시의어려움을, SMARTer 기술로극복! FFPE Sample 과같은 Low input, degraded RNA 로부터 Sequencing 을가능하게! Single Cell sample 로부터 Library

More information

A 617

A 617 Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R

More information

#Ȳ¿ë¼®

#Ȳ¿ë¼® http://www.kbc.go.kr/ A B yk u δ = 2u k 1 = yk u = 0. 659 2nu k = 1 k k 1 n yk k Abstract Web Repertoire and Concentration Rate : Analysing Web Traffic Data Yong - Suk Hwang (Research

More information

975_983 특집-한규철, 정원호

975_983 특집-한규철, 정원호 Focused Issue of This Month Gyu Cheol an, MD Department of Otolaryngology ead & Neck Surgery, Gachon University of College Medicine E - mail : han@gilhospital.com Won-o Jung, MD Department of Otolaryngology

More information

03-ÀÌÁ¦Çö

03-ÀÌÁ¦Çö 25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo

More information

( )Kju269.hwp

( )Kju269.hwp 만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun

More information

1..

1.. Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social

More information

l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related

More information

05052유식안101.hwp

05052유식안101.hwp 제 출 문 식품의약품안전청장 귀 하 이 보고서를 유전자재조합식품 모니터링(부산광역시보건환경연구원/정구영) 과제의 연구 결과보고서로 제출합니다. 2005. 11. 30 주관연구기관명 : 부산광역시보건환경연구원 주관연구책임자 : 정구영 목 차 Ⅰ. 연구개발결과 요약문----------------------------------- 1 (한글)------------------------------------------

More information

슬라이드 1

슬라이드 1 유전공학 DNA 변형과조작 유전자클로닝 제한효소 (Restriction enzyme) 와연결효소 (DNA ligase) 역전사효소, 벡터 DNA 증폭 중합효소연쇄반응 (PCR) DNA 분리및분석 젤전기영동법 (Gel electrophoresis) DNA footprinting (DNA 지문 ) DNA 염기서열분석 Sanger method DNA 재조합기술 (Recombinant

More information

Microarray 기초 및 응용

Microarray 기초 및 응용 Microarray 기초및분석 이바이오젠 목 차 마이크로어레이기초 정의 / 분류 / 제작기술 / 원리 Gene Expression 실험분석 시료준비 RNA QC 실험분석과정 데이터분석 -2- 바이오칩 & 마이크로어레이 - 정의 1. 유리, 실리콘, 플라스틱등의매체위에생체 분자를집적하여만든것 2. 현재 DNA, 단백질, 화학물질, 유기물질등바 이오소재를집적하여만든

More information

Thermal Cycler Dice Real Time System II

Thermal Cycler Dice Real Time System II Real Time System II www.takara.co.kr 높은정량성과재현성및신속성을기반으로하는 Real Time PCR은유전자발현해석및유전자검사에최적인방법입니다. 다파장모델 (Multi-Channel) 다카라바이오에서는 Real Time PCR용시약이나프라이머 (Perfect Real Time Support System) 와함께 96 well plate

More information

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract

More information

Chapter 11

Chapter 11 Chapter 15 RNA Polymerase II: Basal Transcription 1 Eukaryotic and bacterial RNA polymerases differ in some aspects 1. eukaryotes have three RNA polymerases, with one each specifically dedicated to rrna,

More information

316 Research in Plant Disease Vol. 21 No. 4, (Seo, 2009). Enzyme-Linked Immuno Sorbent Assay(ELISA) Reverse Transcription- Polymerase Chain Reaction(R

316 Research in Plant Disease Vol. 21 No. 4, (Seo, 2009). Enzyme-Linked Immuno Sorbent Assay(ELISA) Reverse Transcription- Polymerase Chain Reaction(R 식물병연구 Research Article Open Access Res. Plant Dis. 21(4) : 315-320(2015) http://dx.doi.org/10.5423/rpd.2015.21.4.315 Reverse transcription Loop-mediated isothermal amplification Soybean mosaic virus Detection

More information

Print

Print 2018-09-11 Ver.4 (KR) 8-11, Munpyeongseo-ro, Daedeok-gu, Daejeon, 34302, Republic of Korea Tel: (Korea) 1588-9788 (International) +82-42-930-8777 Email: sales@bioneer.com Real-Time PCR Reagents Selection

More information

조사연구 권 호 연구논문 한국노동패널조사자료의분석을위한패널가중치산출및사용방안사례연구 A Case Study on Construction and Use of Longitudinal Weights for Korea Labor Income Panel Survey 2)3) a

조사연구 권 호 연구논문 한국노동패널조사자료의분석을위한패널가중치산출및사용방안사례연구 A Case Study on Construction and Use of Longitudinal Weights for Korea Labor Income Panel Survey 2)3) a 조사연구 권 호 연구논문 한국노동패널조사자료의분석을위한패널가중치산출및사용방안사례연구 A Case Study on Construction and Use of Longitudinal Weights for Korea Labor Income Panel Survey 2)3) a) b) 조사연구 주제어 패널조사 횡단면가중치 종단면가중치 선형혼합모형 일반화선형혼 합모형

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although

More information

54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3

54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3 27 2, 53-70, 2009. (Nursing Home) * ** (Nursing Home). 5 50 5 2 1,,,,, SPSS t.,,,,,,,. :,, : 2009/08/27 : 2009/09/24 : 2009/09/30 * ** (: hjkim@daelim.ac.kr) 54 한국교육문제연구제 27 권 2 호, 2009. I. 1.,,,,,,, (,

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

09권오설_ok.hwp

09권오설_ok.hwp (JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction

More information

(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re

(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re EMF Health Effect 2003 10 20 21-29 2-10 - - ( ) area spot measurement - - 1 (Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern

More information

Jkbcs016(92-97).hwp

Jkbcs016(92-97).hwp Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean

More information

뉴스지14호-칼라

뉴스지14호-칼라 2 3 4 5 6 TaKaRa Taq TM / TaKaRa Ex Taq TM / TaKaRa LA Taq TM / Pyrobest TM DNA Polymerase/ TaKaRa Z -Taq TM TaKaRa Taq TM TaKaRa Ex Taq TM TaKaRa LA Taq TM TaKaRa Z-Taq TM Pyrobest TM DNA Polymerase 7

More information

untitled

untitled ª Œª Œ 27ƒ 2B Á 2007 3œ pp. 193 ~ 199 ª ƒ w d w ƒ sƒ Methodology of Drought Assessment Using National Groundwater Monitoring Network Data «x Á½ Kwon, Hyung JoongÁKim, Seong Joon Abstract The objective

More information

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있 대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준

More information

Surpass the limit of Polymerase Chain Reaction (PCR) PCR Enzyme Guide High Fidelity PCR 효소 범용적인 PCR 효소 특수목적을위한 PCR 효소 - Epigenetics - Multiplex PCR -

Surpass the limit of Polymerase Chain Reaction (PCR) PCR Enzyme Guide High Fidelity PCR 효소 범용적인 PCR 효소 특수목적을위한 PCR 효소 - Epigenetics - Multiplex PCR - Surpass the limit of Polymerase Chain Reaction (PCR) PCR Enzyme Guide High Fidelity PCR 효소 범용적인 PCR 효소 특수목적을위한 PCR 효소 - Epigenetics - Multiplex PCR - Direct PCR High Fidelity PCR 효소 - NGS targeted sequencing,

More information

Kbcs002.hwp

Kbcs002.hwp Does Real-time Compound Imaging Improve Evaluation of reast Cancer Compared to Conventional Sonography? o Kyoung Seo, M.D., Yu Whan Oh, M.D., Kyu Ran Cho, M.D., Young Hen Lee, M.D., Hyung Joon Noh, M.D.,

More information

12이문규

12이문규 Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental

More information

목차 Ⅰ. 개요 1 Ⅱ. 용어의정의 4 Ⅲ. 관련규정 13 Ⅳ. 신청서기재항목및기술문서제출자료 14 Ⅴ. 제조 수입허가신청서기재항목 15

목차 Ⅰ. 개요 1 Ⅱ. 용어의정의 4 Ⅲ. 관련규정 13 Ⅳ. 신청서기재항목및기술문서제출자료 14 Ⅴ. 제조 수입허가신청서기재항목 15 체외진단용의료기기 ( 인플루엔자바이러스및 A형간염바이러스 ) 의허가 심사가이드라인 2015. 2. 의료기기심사부체외진단기기과 - 1 - 목차 Ⅰ. 개요 1 Ⅱ. 용어의정의 4 Ⅲ. 관련규정 13 Ⅳ. 신청서기재항목및기술문서제출자료 14 Ⅴ. 제조 수입허가신청서기재항목 15 Ⅵ. 기술문서등의심사를위한제출자료 37 Ⅶ. 성능시험에대한상세사항 44 Ⅷ. 참고문헌

More information

16_이주용_155~163.hwp

16_이주용_155~163.hwp 사상체질의학회지 2008;20(2):155-163 J of Sasang Constitutional Medicine Vol. 20, No. 2, 2008:155-163 http://www.esasang.com 腦 梗 塞 으로 발생한 少 陽 人 半 身 舞 蹈 病 患 者 치험 1례 이주용 이한얼 한경수 안택원 Abstract 대전대학교 한의과대학 사상체질과 A Soyangin

More information

04-다시_고속철도61~80p

04-다시_고속철도61~80p Approach for Value Improvement to Increase High-speed Railway Speed An effective way to develop a highly competitive system is to create a new market place that can create new values. Creating tools and

More information

歯1.PDF

歯1.PDF 200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Original Article Journal of Apiculture 31(1) : 41~50 (2016) Rapid Detection of Black Queen Cell Virus from Honeybee using Reverse Transcription Real-Time Recombinase Polymerase Amplification (RT/RT RPA)

More information

ISO17025.PDF

ISO17025.PDF ISO/IEC 17025 1999-12-15 1 2 3 4 41 42 43 44, 45 / 46 47 48 49 / 410 411 412 413 414 5 51 52 53 54 / 55 56 57 58 / 59 / 510 A( ) ISO/IEC 17025 ISO 9001:1994 ISO 9002:1994 B( ) 1 11 /, / 12 / 1, 2, 3/ (

More information

14.531~539(08-037).fm

14.531~539(08-037).fm G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked

More information

- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α

More information

(

( 317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,

More information

, ( ) 1) *.. I. (batch). (production planning). (downstream stage) (stockout).... (endangered). (utilization). *

, ( ) 1) *.. I. (batch). (production planning). (downstream stage) (stockout).... (endangered). (utilization). * , 40 12 (2006 6) 1) *.. I. (batch). (production planning). (downstream stage) (stockout).... (endangered). (utilization). * 40, 40 12 (EPQ; economic production quantity). (setup cost) (setup time) Bradley

More information

대한진단검사의학회지제 26 권제 1 호 2006 Korean J Lab Med 2006;26:9-13 원저 임상미생물학 뇌척수액에서실시간 - 이중 - 역전사중합효소연쇄반응을이용한장바이러스의검출 허세란 1 진선경 1 장호은 1 박경운 1,2 송정한 1,2 김의종 2 분당

대한진단검사의학회지제 26 권제 1 호 2006 Korean J Lab Med 2006;26:9-13 원저 임상미생물학 뇌척수액에서실시간 - 이중 - 역전사중합효소연쇄반응을이용한장바이러스의검출 허세란 1 진선경 1 장호은 1 박경운 1,2 송정한 1,2 김의종 2 분당 대한진단검사의학회지제 26 권제 1 호 2006 Korean J Lab Med 2006;26:9-13 원저 임상미생물학 뇌척수액에서실시간 - 이중 - 역전사중합효소연쇄반응을이용한장바이러스의검출 허세란 1 진선경 1 장호은 1 박경운 1,2 송정한 1,2 김의종 2 분당서울대학교병원진단검사의학과 1, 서울대학교의과대학검사의학교실 2 Detection of Enterovirus

More information

???? 1

???? 1 The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial

More information

김범수

김범수 Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis

More information

Flowers

Flowers Intermediate M. tuberculosis PCR 검사결과의임상적의의와결과보고 짂단검사의학과 미생물파트 김태라 차례 1. 결핵이란? 2. 결핵의미생물학적검사법소개 3. PCR ( 중합효소연쇄반응 ) 결핵짂단의문제점 4. 결론 결핵이란? 결핵은 Mycobacterium tuberculosis complex 이라는세균에의해발생하는감염병 결핵은인류역사상가장맋은생명을앗아간전염병으로기원전

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con

Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI:   (NCS) Method of Con Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency

More information

프로메가 2018 여름이벤트 BIG SALE 행사기간 2018년 8월 06일 ~ 9월 14일 *본 행사지에 표기된 금액은 부가세 별도 금액입니다. *단가 계약 및 입찰은 행사에서 제외됩니다.

프로메가 2018 여름이벤트 BIG SALE 행사기간 2018년 8월 06일 ~ 9월 14일 *본 행사지에 표기된 금액은 부가세 별도 금액입니다. *단가 계약 및 입찰은 행사에서 제외됩니다. 프로메가 2018 여름이벤트 BIG SALE 행사기간 2018년 8월 06일 ~ 9월 14일 *본 행사지에 표기된 금액은 부가세 별도 금액입니다. *단가 계약 및 입찰은 행사에서 제외됩니다. EtBr 을아직사용하신다면? 일회용 Gel extractor 를사용해보세요! 내몸은소중하니깐 ~~~ 15ul minimum elution 이가능합니다!! 프로메가 Steady

More information

1. Korea Centers for Disease Control and Prevention. The fifth Korea National Health and Nutrition Examination Survey (KNHANES V-1) 2010. Cheongwon: Korea Centers for Disease Control and Prevention; 2012.

More information

16(1)-3(국문)(p.40-45).fm

16(1)-3(국문)(p.40-45).fm w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University

More information

Chapter 14 유전정보 (Genetic Information) A + G = C + T 일정 ( 샤가프룰 ] - Watson & Crick(1953년 ) : double helix model of DNA( 이중나선구조 ) 제시 1. 유전정보의전달경로 DNA 상의정

Chapter 14 유전정보 (Genetic Information) A + G = C + T 일정 ( 샤가프룰 ] - Watson & Crick(1953년 ) : double helix model of DNA( 이중나선구조 ) 제시 1. 유전정보의전달경로 DNA 상의정 Chapter 14 유전정보 (Genetic Information) A + G = C + T 일정 ( 샤가프룰 ] - Watson & Crick(1953년 ) : double helix model of DNA( 이중나선구조 ) 제시 1. 유전정보의전달경로 DNA 상의정보를 RNA로옮겨주는과정 ex) retrovirus 2. DNA Replication ( 유전자복제

More information

08김현휘_ok.hwp

08김현휘_ok.hwp (Regular Paper) 21 3, 2016 5 (JBE Vol. 21, No. 3, May 2016) http://dx.doi.org/10.5909/jbe.2016.21.3.369 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a), a) An Audio Coding Technique Employing the Inter-channel

More information

Microsoft PowerPoint - ch03ysk2012.ppt [호환 모드]

Microsoft PowerPoint - ch03ysk2012.ppt [호환 모드] 전자회로 Ch3 iode Models and Circuits 김영석 충북대학교전자정보대학 2012.3.1 Email: kimys@cbu.ac.kr k Ch3-1 Ch3 iode Models and Circuits 3.1 Ideal iode 3.2 PN Junction as a iode 3.4 Large Signal and Small-Signal Operation

More information