대한치주과학회지 28; 38: 314 정은경, 이종철, 서정윤, 김성윤, 김완수, 윤우혁, 김윤상, 피성희, 유형근, 신형식 * 1) 원광대학교치과대학치주과학교실 Inhibitory effects of Enterococcus faecium isolated from Korean infants on oral pathogens Jeong EunGyeong, Lee JongCheol, Seo JungYoon, Kim SeongYoon, Kim WanSu,Yun WooHyuk, Kim YunSang, Pi SungHee,You HyungKeun, Shin HyungShik epartment of Periodontology, School of entistry, Wonkwang University ABSTRACT Purpose: The probiotic effects of lactic acid bacteria have widely been researched in diverse human pathogens, but only a few effects are reported against oral pathogens. The antimicrobial effects of the Enterococcus faecium 7413 isolated from Korean infants on the 9 pathogen including 6 oral streptococci were investigated the clinical use of the antimicrobial peptide for oral microflora control. Materials and Methods: E. faecium 7413 was identified by morphological, biochemical tests and 16S rna sequence analysis. Inhibitory effects of culture supernatants were determined for their ability to grow on agar plate containing pathogenic bacteria. Result: The culture supernatant of Enterococcus faecium 7413 showed inhibitory effects on oral pathogens, namely Streptococcus pyogenes KCTC 3556, S. pneumoniae KCTC 58, S. mutans ATCC 25175, S. anginosus ATCC 33397, S. constellatus KCTC 3268, S. intermedius ATCC 27823 and Shigella flexneri KCTC 28. Whereas it did not affect the multiplication of E. coli strains, KCTC 141 and ATCC 43894. Conclusion: The data obtained in this study could be useful for future development of effective probiotics allowing prevention for oral pathogens. (J Korean Acad Periodontol 28;38:314) KEY WRS: Enterococcus faecium; infant; oral pathogens. 서론 사람의구강내에존재하는많은종류의세균들은대부분정상세균총으로서병원성세균이발육을억제할뿐만아니라숙주의면역계의형성과선천면역반응을유도하는데중요한역할을한다. 그러나이러한정상세균도구강환경의생태적인변화가일어나거나숙주의방어기전이약해지면급속히증식하여치아우식증과치주질환을비롯한치수및치근단감염, 구강 Correspondence: r. Shin HyungShik epartment of Periodontology, School of entistry, Wonkwang University, 3442 Sinyongong, Iksan City, Jeollabukdo, South Korea, 43535 Email: periohs@wonkwang.ac.kr, Tel:82638592967, Fax: 82638576364 * 본연구는 27 년도원광대학교의교비지원에의한연구임. 접수일 : 28 년 1 월 16 일 ; 채택일 : 28 년 2 월 29 일 안면조직또는악골감염등구강내질환을일으킨다. 최근에는이들구강미생물들의심혈관질환과당뇨병과같은전신질환에대한밀접한연관성에대한보고가증가하고있다 12). 유산균 (lactic acid bacteria) 은자연계에널리존재하며탄수화물을이용하여유산을생산하는미생물들의총칭이다. 발효식품등을통하여섭취된유산균은장내로유입된후장내상피세포에착생하게되어병원성미생물의저해및길항작용, 면역활성의증진, 암발생률의감소, 그리고아토피피부염의감소등인체에많은도움을준다. 따라서유산균은동서양을막론하고유제품, 육제품, 침채류및각종젓갈류의가공에유용한보조수단뿐만아니라생균제 (probiotics) 로도이용되고있다 35). 생균제는 or life 를의미하는그리스어에서유래하였으 31
정은경, 이종철, 서정윤, 김성윤 대한치주과학회지 28 년 38 권 1 호 며, 항생제 (antibiotics) 의 against life 와는반대의미를가진다. 198 년발효된유제품을먹는불가리아농부들의수명이긴것을관찰한러시아과학자 Metchnikoff에의하여처음으로그개념이도입되었다. Stillwell과 Lilly는생균제란용어를처음사용하였으며, Parker는생균제의개념을 숙주장내세균의억제를통하여숙주에게유익한영향을주는물질 이라고정의하였다 6). 가장대표적인생균제는유산균으로 Lactobacillus 와 Streptococcus 가가장많이이용된다. Lactobacillus 종으로는 L. acidophillus, L. bulgaricus, L. plantarum, L. casei, Streptococcus 종으로는 S. faecium, S. thermophilus, S. diacetilactus 가주요균종으로, 최근에 Streptococcus 에속하는유산균은 Enterococcus 라고명명되었다 7). 생균제의병원균에대한항균작용과관련된연구는 Salmonella typhimurium, Salmonella enterititis, Listeria monocytogenes. Pseudomonas aeruginosa, Clostridium difficile, 그리고 Helicobacter pylori 등과같은세균들을대상으로하여수행되었다. 여러구강미생물중 S. mutans 는세포의다당류를생성하는 glucosyltransferase 에의해비수용성 glucan 을형성하여균체가치아표면에부착하도록하고치태형성및치아우식증을유발한다. S. anginosus, S. constellatus 및 S. intermedius 는유전학적으로동일군에속하며호흡기감염증과세균성심내막염의주요원인체이다 8). 이균들은현재에는두경부암과의밀접한연관성때문에임상적중요성이크게증가하고있다 9,1). S. pyogenes는인두염, 성홍열, 피부깊숙이감염되어발생하는연쇄구균성화농증및대중매체에서 살파먹는박테리아감염증 으로알려진괴사성근막염등과속발질환으로류머티즘열과사구체신염 등매우다양한질병을일으킨다. S. pneumoniae 는호흡기를통하거나맥관계통에의해서확산되며신체의다른부위로이동하여폐렴, 이하선염, 결막염, 복막염, 중이염, 심내막염및패혈증등과증상을일으킨다 11). 구강내병원균으로는 S. mutans 12) 와 S. salivarius1 3) 를대상으로수행된바있으나전신질환을일으키는다양한구강병원균을대상으로수행된연구는국내 외적으로찾아보기어렵다. 미생물의동정에는주로배양법, 효소면역법및생화학적검사등의방법으로수행되어왔으나, 현재에는환경적요인에의해서거의영향을받지않는데이터를제공하고또한신속한동정이가능하며유전형질의진화적개념을도입한 16S rna 분석법이널리사용되고있다 14). 이연구에서는한국영아로부터분리한유산균을대상으로구강내병원균과아울러설사를일으키는장내병원균에대한항균효과를조사하여생균제로의이용가능성을조사하고자하였다. 재료및방법 1. 유산균의분리건강한영아의분변 1 g씩을채취하여멸균 Phosphate buffered saline(pbs) 로 1 6 ~1 7 cfu/ ml수준까지십진희석하고 MRS 평판배지 (ifco, etroit, MI, U.S.A.) 에.1 ml씩을도말한후 37 5% C 2 배양기에서 36 시간동안배양하였다. 유산균과유사한집락은 BCP 평판배지 (ifco) 에다시계대배양하여순수집락들을선발하였다. 배양배지의조성은 Table 1과같다. Table 1. Primers Used in PCR Amplification and Sequencing of 16S rna Primer Sequences (5' 3') Size Binding site Usage 5' 3' PCR Seq. 27f AGAGTTTGATCMTGGCTCAAG 2 8 27 MG2f GAACGGGTGAGTAACACGT 19 17 125 MG3f CTACGGGRSGCAGCAG 16 342 357 MG4f AATTCCTGGTGTAGCGGT 18 675 692 MG5f AAACTCAAAGGAATTGACGG 2 97 926 MG6f GAACGTCAAGTCATCATGCC 19 119 128 1525r AAGGAGGTGWTCCARCC 17 1544 1525 32
J Korean Acad Periodontol 28; 38(1) 2. 분리균의생리화학적검사분리한유산균들의기초동정을목적으로성상검사와생리화학적검사를실시하였다. 균체를그람염색한후 API 5 CHL Carbohydrate test kit(biomerieux Co., France) 를이용하여생리화학적실험을수행하였다. MRS 평판배지에서성장한균체를 5 ml의용해배지에용해하여 Mcfarland standard 2로균수를맞춘후 API 5 CHL medium 에접종하였다. 접종후 strip에 mineral oil로채운후 37 에서 48시간배양한후 API LAB plus software(biomerieux) 로판정하였다. 3. 16S rna 분석을이용한분리균의동정분리한유산균주들의최종동정을목적으로 16S rna 분석을실시하였다. (1) Genomic NA 분리 Genomic NA 의분리는 Ausubel 등의방법에준하여실시하였다. 3 ml의 nutrient broth(ifco) 에서배양한분리균주를 1.5 ml tube 로옮기고 15, rpm 에서 2분간원침하여균체를침전시켰다. 침전된균체는 1 μl의 TE buffer(ph 8.) 를가하여잘용해하고 2 μl의 1% sodium dodecyl sulfate 와 1 μl의 proteinase K(1 mg/ ml ) 을가하여 5 에서 1시간반응시켰다. 반응균체는 2 μl의 1% cetyltrimethylammonium bromide/.7 M NaCl 용액을가하여잘혼합한후다시 65 에서 1 분간반응하고여기에동량의 chloroform/isoamylalcohol(24:1) 용액을가하여 5분간진탕한다음 4 에서 5분간원침한후상층액만새로운 tube 로옮겼다. 여기에 1/1 배의 3 M sodium acetate와 2배의 1% ethanol 을가하여 genomic NA 를침전시켰다. 침전된 genomic NA 는 7% ethanol로세척한다음, 5 μl의 TE 완충액에용해하고 RNase를최종농도가 2 μg / ml되도록가하고 42 에서 3 분간반응하여 RNA를제거하였다. 정제한 NA 는 spectrophotometer(model MBA 2, PerkinElmer, Norwalk, CN, USA) 를사용하여 26 nm 에서정량하고 2 에보존하면서실험에사용하였다. (2) Primers 분리유산균주들의 16S rna 증폭및염기서열결정을 위한 primer 들은 Lane의 E. coli 16S rna 에대한보고를기초로하여제작하였다. 염기서열은 Table 1과같다. 각 primers 들은 ( 주 ) 제노텍에주문하여 2 pm scale 로합성하였다. 합성한 primer 는멸균증류수로 PCR 용은 29 μm, sequencing 용은 1.6 pm μl 1 으로희석하고 2 에보관하면서실험에사용하였다. (3) 16S rna 증폭추출한 genomic NA 1 μl (5~1 ng) 에 1X Taq buffer 1 μl, 2.5 mm dntps 8 μl, 1.25 mm MgCl 2 1 μl,.w. 59 μl, 1 μm 27f primer 1 μl, 1 μm 1525r primer 1 μl및 Taq polymerase(roches) 를.5 μl를가하여 NA thermal cycler(model 48, Perkin Elmer, Norwalk, CT, USA) 에서 94 2분, 55 1분, 72 2분간의반응을 3 회반복한후 72 에서 1 분간반응하여 16S rna 를증폭하였다. 증폭한 16S rna 는 1.% LE agarose gel(fmc Bioproducts, Rockland, ME, USA) 에서 1X TAE buffer(45 mm Trisacetate, ph 8.3, 1. mm ETA), 1 V로 2 분간전기영동한후 ethidium bromide(1 mg/ml) 로 1 분간염색하고 Gel oc 2 system(biorad, Hercules, CA, USA) 을이용하여증폭유무와크기를관찰하였다. (4) 염기서열분석분리유산균들로부터증폭된 16S rna 는 Bigye Terminatior Cycle Sequencing Kit(Applied Biosystems, Foster City, CA, USA) 와 ABI PRISM 31 Genetic Analyzer(Applied Biosystems) 를이용하여염기서열을분석하였다. 분석한 16S rna 염기서열은미국 National Center for Biotechnology Information의 BLAST server(http:// www.ncbi.nlm.nih.gov/blast/) 를이용하여검색한후 GenBank 에등재된근연세균들의 16S rna 유전자염기서열들과 Clustal_X (1.7) 프로그램을이용하여다중정렬하고유사성행렬을구하였다 15). 계통도 (phylognetic trees) 의작성은 PHYLIP package 를이용하였으며 neighbourjoining 알고리즘을이용하여추론하였다. 진화적거리는 Jukes와 Cantor 의 neighbourjoining 방법을이용하여계산하였으며 unrooted tree 위상은 PHYLIP package 의 SEQBT 와 CNSENSE 프로그램을이용하여 1, 회 resampling 으로 bootstrap 분석을수행하였다. 33
정은경, 이종철, 서정윤, 김성윤 대한치주과학회지 28 년 38 권 1 호 Table 2. The List of Pathogens Used in This Study No. Indicator organism Related disease 1 2 3 4 5 6 7 8 9 S. pyogenes KCTC 3556 S. pneumoniae KCTC 58 S. mutans ATCC 25175 S. anginosus ATCC 33397 S. constellatus KCTC 3268 S. intermedius ATCC 27823 E. coli KCTC 141 E. coli 157 H7 ATCC 43894 Shigella flexneri KCTC 28 pharyngitis, pyogenic disease pneumonia dental caries periodontitis, endocarditis periodontitis, endocarditis periodontitis, endocarditis diarrhea bleeding diarrhea dysentery * KCTC: Korean Collection for Type Cultures (Taejon, Korea), ATCC: American Type Culture Collection (Manassas, VA, U.S.A.). ** BHI (Brain Heart Infusion), LB (Luria Bertani Broth). 4. 병원균에대한항균활성시험분리한여러유산균중 7413 균주의배양액으로부터주요구강및장내병원성세균들에대한항균활성을측정하였다. 사용균주로는국내유전자은행인 KCTC 와미국의 ATCC 로부터분양받은 S. pyogenes KCTC 3556, S. pneumoniae KCTC 58, S. mutans ATCC 25175, S. anginosus ATCC 33397, S. constellatus KCTC 3268, S. intermidius ATCC 27823, E. coli KCTC 141, E. coli 157 H7 ATCC 43894 및 Shigella flexneri KCTC 28 등다양한구강질환을일으키는연쇄구균들과설사를주증상으로하는장내병원성세균들을사용하였다 (Table 2). S. pyogenes KCTC 3556, S. pneumoniae KCTC 58, S. mutans ATCC 25175, S. anginosus ATCC 33397, S. constellatus KCTC 3268 및 S. intermedius ATCC 27823의경우 Brain Heart Infusion (BHI, ifco) 배지, E. coli KCTC 141, E. coli 157 H7 ATCC 43894 및 Shigella flexneri KCTC 28 의경우 Luria Bertani Broth(LB, ifco) 를사용하여배양하였다. 시험방법으로는먼저시험균주의단일집락을 1 ml의 MRS 액체배지 (ifco) 가들어있는 2 ml플라스크에접종하여 37 에서교반하면서배양하였다. 시료는 1일에서 4일까지 24시간단위로채취하였으며 12xg 에서 1 분간원침한후상청액은배양액으로, 균체추출물은원침균체를 1 ml PBS에희석한후 sonication 하여사용하였다. 실험방법은 agar diffusion assay 를이용하여억제활성을측정하였다 17). 각병원균배양액을 1 ml의영양배지가들어있는 2 ml플라스크에초기.. =.1로접종하여 7시간동안배양하여총균수가 2 1 8 이되도록조절한다음 6 의굳지않은 nutrient agar(ifco) 13 ml와함께 1 mm Petri dish 에부은후잘굳혔다. 그다음 56 배양기에서 24시간동안건조시켜완전히습기를제거한 1 mm 페이퍼디스크 (Toyo Roshi Kaisha, Ltd, Japan) 를 plate 위에올려놓은다음각각의디스크에시료 1 μl씩을주입하였다. Plate 는 37 배양기와 5% C 2 배양기에서 12 시간동안호기또는혐기배양한다음생성된세균의생육저지대즉, 투명환 (clear zone) 을확인하고 vernier calipers 를사용하여직경을측정하였다. 결과 1. 유산균 7413 의생리생화학적특성한국영아분변으로부터분리한여러유산균주중 7413으로명명한균주를선택하여생리생화학적특성을조사한결과 Table 3과같은성적을얻었다. 검사결과양성으로나타낸검사는 VP 반응,.4% NaN 3 에의저항성, Arginine hydrolysis, LArabinose 이었으며 Yellow pigment 생성, Methylaglucosid, Raffinose 시험은음성이었다. 반면 Gluconate, Mannitol, Melibiose, Sucrose, Xylose 시험은의양성으로유산균이지니는일반적인특성을지니고있었다. 34
J Korean Acad Periodontol 28; 38(1) Table 3. Characteristics of Bacteria 7413 Isolated from Infant Feces; Characteristics Are Scored as:, Positive;, Intermediate Characteristics Yellow pigment VP reaction Resistance to.4% NaN 3 Arginine hydrolysis Acid from: LArabinose Gluconate Mannitol Melibiose Methylaglucoside Raffinose Sucrose Xylose 2. 유산균 7413 의 16S rna 분석 Results 유산균 7413 의 16S rna 염기서열을미국 NCBI의 BLAST 를통해검색한결과분리균주 7413 은 Enterococcus 에속함을알수있었다. 따라서분리균주 7413의 16S rna 서열을 GenBank 에등재된 Enterococcus 종들의 16S rna 염기서열들과다중정렬하여유사성행렬을구하고계통도를작성한결과 16S rna 상동성의범위는 92.6~99.8% 로나타났다 (Fig. 1). 유산균 7413은 E. faecium 과 99.8% 의가장높은상동성을보여 E. faecium 으로최종동정하였다. 가장낮은상동성은 E. solitarius과의 92.6% 이었다. 3. 유산균 7413 의병원균에대한항균효과 실험결과유산균 7413은구강내치주염을일으키는균주인 S. pyogenes KCTC 3556, S. pneumoniae KCTC 58, S. mutans ATCC 25175, S. anginosus ATCC 33397, S. constellatus KCTC 3268 및 S. intermedius ATCC 27823 에있어서항균효과가있음을확인할수있었다. 특히, 유산균주 7413 배양액의항균효과는치주염원인균인 S. anginosus ATCC 33397, S. constellatus KCTC 3268, S. intermedius ATCC 27823 에대해탁월한것으로나타났으며, 그다음으로는치아우식균인 S. mutans ATCC 25175 에대해항균활성이 높게나타났다. 인두염균인 S. pyogenes KCTC 3556과폐렴균인 S. pneumoniae KCTC 58 에서는미약한활성을보였다. 장내세균에서는분리균주 7413 배양액의항균활성은이질균인 Shigella flexneri KCTC 28 에서는비교적높게나타난반면 2종의대장균주인 E. coli KCTC 141 과 E. coli 157 H7 ATCC 43894에대해서는항균활성이없는것으로나타났다 (Table 4). Table 4. Antibacterial Effects of Lactic Acid Bacteria 7413 Supernatant against Pathogenic Bacteria No Indicator organism Results 1 2 3 4 5 6 7 8 9 S. pyogenes KCTC 3556 S. pneumoniae KCTC 58 S. mutans ATCC 25175 S. anginosus ATCC 33397 S. constellatus KCTC 3268 S. intermedius ATCC 27823 E. coli KCTC 141 E. coli 157 H7 ATCC 43894 Shigella flexneri KCTC 28 * Characteristics are scored as:, strong positive (> 4 mm of inhibitory zone);, intermediate (25 to 4 of inhibitory zone);. weak positive (< 25 of inhibitory zone);, negative (no inhibitory zone). 4. 배양시간에따른유산균 7413 의병원균에대한항균활성 유산균 7413 을 1일부터 4일까지배양하면서 24 시간마다배양액을취하여병원균에대한억제활성을측정하였다. 실험결과시험균주모두에서경시적인억제효과의별차이는관찰되지않았다 (Fig. 2). 분리균주 7413 배양액은구강내치주염을유발하는균주인 S. anginosus ATCC 33397, S. constellatus KCTC 3268 및 S. intermedius ATCC 27823에대해서는 4일동안모두상당한억제활성을보였으며평균억제부위는 S. anginosus ATCC 33397는 42.45±.17 mm, S. constellatus KCTC 3268는 42.5±.39 mm, S. intermedius ATCC 27823는 42.25±.91 mm로나타났다. 그다음으로는 S. mutans ATCC 25175 의 2.8±2.45 mm이었는데 1~3 일배양액들은 2 mm 내외의활성을보였으나 4일배양액에서 26.3 mm 으로활성이증가하였다. S. pyo 35
정은경, 이종철, 서정윤, 김성윤 대한치주과학회지 28 년 38 권 1 호 Lactic acid bacteria 7413 98 E. fa e c iu m (AJ276355) 99.8% 84 E. hirae (AF6111) 99.5% 98 E. m undtii (AF6113) 99.% E. villorum (AJ271329) 99.% E. g ilv u s (AY33814) 98.4% 94 E. m a lo d o ra tu s (AF6112) 98.4% 75 76 E. avium (Y18274) 98.5% E. pseudoavium (AF612) 98.5% 83 E. p a lle n s (AY33815) 97.4% E. flavescensn (AJ31832) 97.7% 82 8 E. asini (Y11621) 97.2% E. dispar (AF617) 97.7% 82 1 E. colum bae (X56422) 94.3% E. cecorum (AF619) 94.4% 99 E. m oraviensis (AF286831) 96.4% 1 E. haem operoxidus (AF286832) 96.1% E. fa e c a lis (AB12212) 96.1% 82 91 E. sulfureus (AF611) 96.1% E.saccharolyticus (A F 6 1 4 ) 9 6.8 %.1 E. s o lita riu s (AF611) 92.6% Figure 1. Phylogenetic tree based on 16S rna sequences of lactic acid bacteria 7413 and validly described strains of the genus Enterococcus. The tree was constructed by using the neighborjoining method. Scale bar represent 1 nucleotide substitution per 1 nucleotide. Figure 2. Inhibitory zone of lactic acid bacteria 7413 daily collected supernatant against pathogenic bacteria. 1: day 1, 2: day 2, 3: day 3, 4: day 4. 36
J Korean Acad Periodontol 28; 38(1) Table 5. Clear Zone of Lactic Acid Bacteria 7413 Supernatants against Pathogenic Bacteria No. Indicator organism iameter of inhibitory zone (mm) ay 1 ay 2 ay 3 ay 4 1 2 3 4 5 6 7 8 9 S. pyogenes KCTC 3556 S. pneumoniae KCTC 58 S. mutans ATCC 25175 S. anginosus ATCC 33397 S. constellatus KCTC 3268 S. intermedius ATCC 27823 E. coli KCTC 141 E. coli 157 H7 ATCC 43894 S. flexneri KCTC 28 21.3 2.8 19. 42.2 42.8 41.2 21.3 2.8 2.4 19.2 42.5 42.6 41.8 21. 2.8 2.6 2.8 42.6 42.6 43.2 21.5 2.6 2.2 24.3 42.5 41.9 42.8 21.4 genes KCTC 3556, S. pneumoniae KCTC 58 및 S. flexneri KCTC 28 은각각 2.9±.3 mm, 2.5±.26 mm, 21.3±.22 mm의활성을나타냈다 (Table 5). 고찰 생균제는 in vitro 또는 in vivo 에서많은병원균과부패균의성장을억제한다. 생균제미생물이병원균의성장을억제하는기전은장관내에서의한정된영양물질에대한경쟁, 생성된저급지방산, 항생물질및 H 2 2 등의작용등이다 16). 유산균은박테리오신 (bacteriocin) 이라는생리활성물질을생산하여여러부패성미생물및병원성미생물에대한생육억제작용을한다. 박테리오신은여러종의미생물이생산하는천연의항균성단백질또는단백질계의물질로서박테리오신을생산하는균주는면역에관계되는단백질을합성하여그것에의해사멸되지않지만형태와계통학적으로유사한균종에대하여살균기작을갖는물질을지칭한다 17). 항생제의경우사람에게투여시부작용이있다는단점이있으나박테리오신은단백질로이루어져있어인체에섭취되는즉시소화기관의단백질가수분해효소에의해분해됨으로써인체에무독성이고잔류성이없다는장점이있다. 박테리오신을생산하는미생물들은 Lactobacillus spp., Bifidobacterium spp. Streptococcus salivarius subsp. thermophilus, Lactococcus lactis subsp., lactis and cremoris, Enterococcus faecium, Pediococcus acidilactici, Leuconostoc mesenteroides subsp. dextranicum, Propionibacterium freudenreichii, Escherchia coli 그리고 Saccharomyces boulardii 등이있다 18). 구강내병원균의억제는치태, 치아우식, 구내염등의구강질환뿐아니라심혈관질환, 당뇨병과같은전신질환의예방및치료에매우중요하다. 구강내병원균억제후보물질개발은식물추출물, bakuchiol, propolis, 마늘등의천연물을대상으로연구들이수행되어항균물질의개발및효과등이보고되고있다. 항균물질의경우대부분이 terpenoid 계와페놀성화합물로알려져있으며, 이들은당또는단백질과결합할수있기때문에병원균에대한방어화합물로작용할수있다 19). 그러나생균제미생물을대상으로는극소수의연구만이수행되었다 2,21). 본연구에서는구강내병원균을억제하는생균제의개발을위하여당을분해하여유산을생산하는 Lactobacillus 를비롯한다양한유산균을분리하였다. 그러나진행성치아우식증의경우구강내에서 L. salivarius 등 Lactobacillus의수가증가하며 22), 이균은 S. sanguis, S. mutans 및 Actinomyces viscosus 등과공통항원을보유하고있으므로 23), 구강내병원균억제용생균제로서는 Lactobacillus 는적합지않다고판단하여 Enterococcus 로동정된분리균주 7413을구강내병원균을억제하는생균제후보균주로선정하였다. Stackbrandt와 Goebel 은세균의종에대하여 16S rna 상동성이 97% 이상이며 NANA reassociation values 가 7% 이상인균주의집단이라고정의 하였으며현재까지세균종의결정에있어서지표가되고있다 14). 본연구에서는영아로부터분리균주 7413 의생리화학적검사를실시한결과이균이유산균에속함을알수있었으며 BCP 평판배지에서노란색집락을형성하지않았으므로 Lactobacillus 가아닌것으로판 37
정은경, 이종철, 서정윤, 김성윤 대한치주과학회지 28 년 38 권 1 호 정하였다. 분리균주 7413 은 16S rna 염기서열을분석으로 E. faecium 으로최종동정하였다. Enterococcus 는사람과동물의장내에서식하는세균으로그람양성세균으로탄수화물을이용하여유산을생산한다. 특히 E. faecium 은유해세균의생장을억제하고장점막부착성이좋은것으로알려져있어사람과동물의설사예방제나정장제로사용되고있다 24,25). 본연구에서도분리균주 7413은구강내질환을유발하는 S. pyogenes KCTC 3556, S. pneumoniae KCTC 58, S. mutans ATCC 25175, S. anginosus ATCC 33397, S. constellatus KCTC 3268 및 S. intermedius ATCC 27823에있어서탁월한항균효과가있음을확인할수있었다. 장내세균에서는분리균주 7413 배양액의항균활성은이질균인 Shigella flexneri KCTC 28 에서는비교적높게나타난반면 2종의대장균주인 E. coli KCTC 141 와 E. coli 157 H7 ATCC 43894에대해서는항균활성이없어이균주가장관용보다구강용생균제로유용하게사용될수있음을시사하였다. 또한배양시간에따른억제활성에서 S. mutans ATCC 25175 를제외한다른균주들에서는대수성장기부터사멸기까지큰차이를보이지않았다. 박테리오신은성장기이후정체기에그활력이감소하는데이것은균체가성장하면서생산하는단백질분해효소때문으로생각되나박테리오신이성장기전반에걸쳐서생성된다는보고도있다 26). 따라서본연구에서사용한분리균주 7413은단백질분해효소를생산하지않거나박테리오신이대수성장기부터일정하게생산되는것으로생각된다. E. faecium 은보편적으로안전한미생물로인식되고있으나최근에는 vancomycinresistant Enterococcus faecium (VREF) 의출현에대한보고도있어주목되고있다 27,28). 따라서앞으로이균주에대한 vancomycin 등항생제내성에대한추가연구와실제구강환경에서생균제로의기능에대한 in vivo 항균활성에대한연구가수행되어야한다고생각된다. 결론적으로, 이연구에서는구강생균제의개발을목적으로한국영아로부터유산균주를분리동정하여구강내병원균과장내병원균에대한항균효과를조사하였다. 1. 한국영아분변으로부터분리한유산균 7413 의생리생화학적특성은 VP 반응,.4% NaN 3 에의저항성, Arginine hydrolysis, LArabinose 은양성, Yellow pigment 생성, Methylaglucosid, Raffinose는음성이었다. 반면 Gluconate, Mannitol, Melibiose, Sucrose, Xylose 는의양성이었다. 2. 유산균 7413 은생리생화학적검사와 16S rna 분석으로 Enterococcus faecium로동정되었다. 3. 유산균 7413은구강병원균인 S. pyogenes KCTC 3984 T, S. pneumoniae KCTC 58, S. mutans ATCC 25175, S. anginosus ATCC 33397, S. constellatus KCTC 3268 및 S. intermedius ATCC 27823 에는탁월한억제활성이있었다. 장내병원균인 Shigella flexneri KCTC 28 에대해서는억제활성이비교적높게나타난반면, 대장균 E. coli KCTC 141 과 E. coli 157 H7 ATCC 43894에대해서는억제활성이없었다. 4. 배양시간에따른항균활성시험결과유산균 7413 은 S. mutans ATCC 25175 에대해서는 1일째배양액보다 4일째배양액에서억제활성이증가하였으나다른구강및장내병원균에대해서는차이를보이지않았다. 이상으로유산균 7413 은구강용생균제개발을위한후보균주로유용하게사용될수있을것으로생각되었다. 참고문헌 1. Williams RC, ffenbacher S. Periodontal medicine: the emergence of a new branch of periodontology. Periodontol 2;23:912. 2. Beck J, ffenbacher S. The association between periodontal diseases and cardiovascular diseases: a stateofthe science review. Ann Periodontol 21;6:915. 3. Guandalini S. Probiotics for children: use in diarrhea. J Clin Gastroenterol 26;4:244248. 4. Madsen K. Probiotics and the immune response. J Clin Gastroenterol 26;4:232234. 5. Shaw L. Effects of probiotics on atopic dermatitis. Arch is Child 26;91:373. 6. Parker RB. Probiotics, the other half of the antibiotic story. Ani Nutr Health 1974;29:48. 7. Ruoff KL. Recent taxonomic changes in the genus Enterococcus. Eur J Clin Microbiol Infect is 199;9(2): 7579. 8. Shinzato T, Saito, A. The Streptococcus milleri group as a cause of pulmonary infections. Clin Infect is 1995;21: 238243. 38
J Korean Acad Periodontol 28; 38(1) 9. Shiga K, Tateda M, Saijo S et al. Takasaka T, Miyagi T. Presence of Streptococcus infection in extraoropharyngeal head and neck squamous cell carcinoma and its implication in carcinogenesis. ncol Rep 21;8:245248. 1. Tateda M, Shiga K, Saijo S et al. Streptococcus anginosus in head and neck squamous cell carcinoma: implication in carcinogenesis. Int J Mol Med 2;6:69973. 11. Whatmore AM, Efstratiou A, Pickerill AP et al. Genetic relationships between clinical isolates of Streptococcus pneumoniae, Streptococcus oralis, and Streptococcus mitis: characterization of Atypical pneumococci and organisms allied to S. mitis harboring S. pneumoniae virulence factorencoding genes. Infect Immun 2;68(3):13741382. 12. Caglar E, Sandalli N, Twetman S, et al. Effect of yogurt with Bifidobacterium N173 1 on salivary mutans streptococci and lactobacilli in young adults. Acta dontol Scand 25;633176332. 13. Zhou JS, Rutherfurd KJ, Gill HS. Inability of probiotic bacterial strains Lactobacillus rhamnosus HN1 and Bifidobacterium lactis HN19 to induce human platelet aggregation in vitro. J Food Prot 25; 68:24592464. 14. Stackebrandt E, Goebel BM. A place for NANA reassociation and 16S rrna sequence analysis in the present species definition in bacteriology. Int J Syst Bacteriol 1994;44:846849. 15. Thompson J, Gibson TJ, Plewniak F et al. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tool. Nucleic Acid Res 1997;24:48764882. 16. Schillinger U, Lucke FK. Antibacterial activity of Lactobacillus sake isolated from meat. Appl Environ Microbiol 1989;55:191196. 17. Konisky J. Colicins and other bacteriocins with established modes of action. Annu Rev Microbiol 1982;36:125144. 18. Tagg JR, ajani AS, Wannamaker LW. Bacteriocins of grampositive bacteria. Bacteriol Rev 1976;4:722756. 19. Lee H, Lee KH, Park NK et al. Antibacterial Effects of Sophora flavescens on Streptococcus mutans. The Korean Journal of Food And Nutrition 2;13:539546. 2. Chung J, Ha ES, Park HR, Kim S. Isolation and characterization of Lactobacillus species inhibiting the formation of Streptococcus mutans biofilm. ral Microbiol Immunol 24;19:214216. 21. Meurman JH. Probiotics: do they have a role in oral medicine and dentistry? Eur J ral Sci 25;113:188196. 22. Kohler B, Bjarnason S. Mutans streptococci, lactobacilli and caries prevalence in 11 and 12yearold Icelandic children. Community ent ral Epidemiol 1987;15:332 335. 23. Aguilera Galaviz LA, Premoli G, Gonzalez A, Rodriguez RA. Caries risk in children: determined by levels of mutans streptococci and Lactobacillus. J Clin Pediatr ent 25; 29:329333. 24. Audisio MC, liver G, Apella MC. Effect of different complex carbon sources on growth and bacteriocin synthesis of Enterococcus faecium. Int J Food Microbiol 21;63:235241. 25. Benyacoub J, Perez PF, Rochat F et al. Enterococcus faecium SF68 enhances the immune response to Giardia intestinalis in mice. J Nutr 25;135:11711176. 26. Joerger MC, Klaenhammer TR. Characterization and purification of helveticin J and evidence for a chromosomally determined bacteriocin produced by Lactobacillus helveticus 481. J Bacteriol 1986;167:439446. 27. Lund B, Edlund C, Barkholt L et al. Impact on human intestinal microflora of an Enterococcus faecium probiotic and vancomycin. Scand J Infect is 2;32:627632. 28. Lund B, Adamsson I, Edlund C. Gastrointestinal transit survival of an Enterococcus faecium probiotic strain administered with or without vancomycin. Int J Food Microbiol 22;77:19115. 39