DBPIA-NURIMEDIA - PDF 무료 다운로드

Korean Society for Biotechnology and Bioengineering Journal 29(5): 361-371 (2014) http://dx.doi.org/10.7841/ksbbj.2014.29.5.361 ISSN 1225-7117 / eissn 2288-8268 연구논문 생물의약품제조공정에서마이코플라스마정량검출을위한 TaqMan Probe Real-Time PCR 이재일, 김인섭 * TaqMan Probe Real-Time PCR for Quantitative Detection of Mycoplasma during Manufacture of Biologics Lee Jae Il and In Seop Kim* 접수 : 2014 년 7 월 10 일 / 게재승인 : 2014 년 10 월 16 일 2014 The Korean Society for Biotechnology and Bioengineering Abstract: Mycoplasma is well recognized as one of the most prevalent and serious microbial contaminants of biologic manufacturing processes. Conventional methods for mycoplasma testing, direct culture method and indirect indicator cell culture method, are lengthy, costly and less sensitive to noncultivable species. In this report, we describe a new TaqMan probe-based real-time PCR method for rapid and quantitative detection of mycoplasma contamination during manufacture of biologics. Universal mycoplasma primers were used for mycoplasma PCR and mycoplasma DNA was quantified by use of a specific TaqMan probe. Specificity, sensitivity, and robustness of the real-time PCR method was validated according to the European Pharmacopoeia. The validation results met required criteria to justify its use as a replacement for the culture method. The established real-time PCR assay was successfully applied to the detection of mycoplasma from human keratinocyte and mesenchymal stem cell as well as Vero cell lines artificially infected with mycoplasma. The overall results indicated that this rapid, specific, sensitive, and robust assay can be reliably used for quantitative detection of mycoplasma contamination during manufacture of biologics. 한남대학교생명 나노과학대학생명시스템과학과 Department of Biological Sciences and Biotechnology, Hannam University, Daejeon 305-811, Korea Tel: +82-42-629-8754, Fax: +82-42-629-8751 e-mail: inskim@hnu.kr Keywords: Mycoplasma detection, TaqMan probe, Real-time PCR, Validation, Biologics 1. INTRODUCTION 마이코플라스마 (Mycoplasma) 는 0.3~0.8 µm 의지름을갖고세포벽이없는가장작고간단한원핵생물의한종류이다. 흔히마이코플라스마는몰리큐트 (Mollicutes) 강 (class) 에포함되는 Mycopasma, Acholeplasma, Spiroplasma, Anaeroplasma, Ureaplasma 속 (genera) 등에속하는모든종을통칭한다. 마이코플라스마는제한적인생합성기능을가지고있기때문에필요한많은영양분의공급을외부에의존한다. 일반세균배지에서는증식되지않으며, 영양요구성이복잡하고, 특히콜레스테롤을요구하며, 말혈청과효모추출액등이첨가된배지에서증식이가능하다. 마이코플라스마는비운동성이고, 호기성또는통성혐기성으로 CO 2 가 5~10% 존재하는상태에서잘증식한다 [1-4]. 마이코플라스마는지속적인배양을하는세포또는세포주의오염원으로잘알려져있다 [5-7]. Mycoplasma 속과 Acholeplasma 속 20 여종이세포배양의주요오염원이며, 그중 6 종의마이코플라스마 (M. arginini, M. fermentans, M. hyorhinis, M. orale, A. laidlawii) 가주요오염원으로보고되고있다. 미국 FDA 에따르면지난 30 년간조사된 20,000 여건의세포배양중 15% 에달하는 3,000 여건에서마이코플라스마오염이확인되었다 [8]. 일본에서는 80% 에육박한다는보고도있다 [9]. 국내의경우수집된 82 주의배양세포를직접배양법으로

362 Korean Society for Biotechnology and Bioengineering Journal 29(5): 361-371 (2014) 마이코플라스마오염여부를검사한결과 39% 에서검출된사례가보고된바있다 [10]. 항체를포함하는유전자재조합의약품, 백신, 세포치료제, 유전자치료제등과같은생물의약품생산을위한세포배양시마이코플라스마에오염되면, 성장속도저하, 세포내영양소결핍, 대사산물축적에의한 ph 변화, 유전자발현을포함한세포내여러반응들이변하게되어생산되는제품의양과품질이저하된다. 또한제조공정의일관성을유지하기어려워품질관리문제를일으킬수있고임상적으로적용되었을때환자에게질병을유발할수있다. 마이코플라스마에오염된 MCF-7 세포주의 RNA 발현양상의변화를조사해본선행연구의결과에의하면 22,000 여개의조사대상유전자중에서 200 개이상의유전자발현이증가또는감소하는것으로밝혀졌다 [11]. 따라서생물의약품을생산하는세포주또는세포치료제에사용되는세포의정확한특성분석및관리를위해서는마이코플라스마의오염여부를확인하여, 감염이된경우에는적절한조치를취하는것이필요하다. 마이코플라스마는세포를이용한생산공정중제조에사용되는동물조직, 배양에사용되는혈청및트립신, 작업환경또는작업자등과같은다양한경로를통해제조공정에유입될수있으며, 작업소내세포주의교차오염으로인해다른세포주로오염이확산될수있다 [2]. 현재마이코플라스마를검출하기위한시험법으로국내외의각종공정서에수재된배양시험법 ( 직접도말법, 증균배양법, 멤브레인필터법 ) 과 indicator cell culture 법이사용되고있으며그결과를최종적으로확인하는데 28 일이소요된다 [12,13]. 따라서공정서에수재된마이코플라스마부정시험법은유전자재조합의약품, 백신등대량생산되는제품의완제의약품품질검사시험법으로는적당할수있지만, 유효기간이짧고, 개인단위의소량으로생산되는세포치료제에적용하기에는현실적으로매우어렵다. 또한유전자재조합의약품과백신의안전한생산을위해세포배양, 분리정제, 완제의약품생산공정에서실시간으로마이코플라스마의신속한검출시험이필요한데, 배양시험법과 indicator cell culture 법으로는신속검출이불가능하다. 최근각국의규제기관은마이코플라스마부정시험법으로, 감염성위해인자를매우짧은시간에높은민감도를가지고특이적으로검출할수있는신속검출법을권고하고있으며, 이중대표적으로핵산증폭검사법이제시되고있다 [12]. 다양한마이코플라스마를신속하게검출하기위한중합효소연쇄반응 (polymerase chain reaction: PCR) 방법들이개발되어왔지만, 대부분일반 PCR 방법이거나 touchdown PCR 방법으로민감도가떨어지거나, PCR 산물을전기영동하는과정중에실험실오염으로인한위양성발생의문제점이있어마이코플라스마부정시험법으로사용하기에는부적합하였다 [14-16]. 최근에는일반 PCR 에비해검출시간이빠르고, 오염의위험이낮으며, 실시간 monitoring 이가능하고, 정량의정확성이매우높은 SYBR Green I 에기반한 real-time PCR 을이용한마이코플라스마신속검출법이개발되어왔다 [17-19]. SYBR Green I 에기반한 real-time PCR 은 TaqMan probe 를이용한 real-time PCR 에비해정량의정확성과특이도가떨어지는단점이있다. 본연구에서는다양한종류의마이코플라스마를신속하고, 특이적으로검출할수있는 Taq Man probe 를이용한 real-time PCR 시험법을확립하였다. 확립된시험법을 European Pharmacopoeia section 2.6.7 [12] 과식품의약품안전청의 핵산증폭검사법검증가이드라인 [20] 에따라검증하여신뢰성을확보하였다. 2. MATERIALS AND METHOD 2.1. 마이코플라스마균주와동물세포의배양 European Pharmacopoeia section 2.6.7. MYCOPLASMAS 가이드라인에따라마이코플라스마검출시험법의검증을위해 Table 1에기술한 7종의마이코플라스마균주를사용하였다 [12]. 이러한마이코플라스마종들은항생제감수성, 배양의난이도, 오염의빈도, 병원성등을고려하여선정된표준균주이다. 7종의마이코플라스마표준균주를 American Type Culture Collection (ATCC) 로부터구입하였으며, 배양을위해 ATCC product sheet에기재된배지를사용하였다. A. laidlawii, M. gallisepticum, M. fermentans, M. hyorhinis, M. orale는 ATCC #243 media에서배양하였다. M. pneumoniae는 ATCC #988 media에서배양하였으며, M. synoviae는 ATCC #486 media에서배양하였다. Table 1에기술한조건으로배양한후집락형성단위 (colony forming unit: CFU) 로계수하였다. Real-time PCR 시험의특이성검증을위해사용한 CHO (Chinese hamster ovary)-k1 세포와 CHO DG44 세포는 5% 우혈청을첨가한 Iscove's modified Dulbecco's medium (IMDM: Gibco BRL, USA) 배지에 100X Hypoxanthine-Thyminidine suppliment (HT suppliment; Gibco BRL, USA) 1% 를첨가하여배양하였다. Human keratinocyte ( 사람각질세포 ) 는 Keratinocyte Growh Medium (Gibco BRL, USA) 에배양하였다. Human mesenchymal stem cell ( 사람중간엽줄기세포 ), A9 세포 (ATCC CCL-1.4), C8166 세포 (ATCC 71218), Vero 세포 (ATCC CCL-81), MA104 세포 (ATCC CRL-2378) 는 10% 우혈청 (Gibco BRL, USA) 을첨가한 Dulbecco's Minimun Essential Medium (DMEM: Gibco BRL, USA) 배지에배양하였다. 모든동물세포는 5% CO 2, 37 o C에서배양하였다. CHO-K, CHO DG44, A9, C8166, Vero, MA104 세포는 ATCC 에서구입하였으며, human keratinocyte와 human mesenchymal stem cell은 ( 주 ) 메디컬그룹베스티안중앙연구소와 ( 주 ) 본셀바이오텍에서분양받아사용하였다. 2.2. Primer 와 TaqMan probe 선정다양한종류의마이코플라스마를동시에검출하기위한 primer 는유전자변이가거의없는것으로알려진 16S rrna 유전자를기초로하여약 450 bp 의 PCR 산물이증폭되도록고안된 universal mycoplasma primer A (forward primer, 5

마이코플라스마정량검출을위한 TaqMan Probe Real-Time PCR 363 Table 1. Mycoplasma species used in this study and their culture conditions Mycoplasma species Source Culture condition Media A. laidlawii ATCC 23206 Plates : 37 o C, 5% CO 2, Broth : Aerobic #243 media M. gallisepticum ATCC 19610 Plates : 37 o C, 5% CO 2, Broth : Aerobic #243 media M. fermentans ATCC 19989 Plates : 37 o C, Anaerobic, Broth : 37 o C, Anaerobic #243 media M. hyorhinis ATCC 17981 Plates : 37 o C, 5% CO 2, Broth : Aerobic #243 media M. orale ATCC 23714 Plates : 37 o C, Anaerobic, Broth : 37 o C, Anaerobic #243 media M. pneumoniae ATCC 15531 Plates : 37 o C, 5% CO 2, Broth : Aerobic #988 media M. synoviae ATCC 25204 Plates : 37 o C, 5% CO 2, Broth : Aerobic #486 media Table 2. Nucleotide sequence alignment of TaqMan probe used in this study (5'-3') to mycoplasma DNA sequences from the NCBI (GenBank) database GenBank Acc. No. Species FAM- Y G R C W A A C T A T G T G C C A G C A G Y C G C G -BHQ1 NC007294 M. synoviae C G G C T A A C T A T G T G C C A G C A G C C G C G myc16srr M. penetrans C G G C T A A C T A T G T G C C A G C A G C C G C G aclrgnal A. laidlawii C G G C A A A C T A T G T G C C A G C A G C C G C G mycrgda M. gallisepticum C G A C T A A C T A T G T G C C A G C A G T C G C G mycrrnaf M. fermentans C G G C T A A C T A T G T G C C A G C A G C C G C G mycrrnahyr M. hyorhinis C G G C A A A C T A T G T G C C A G C A G C C G C G mycrnaor M. orale T G G C T A A C T A T G T G C C A G C A G C C G C G mycrrnapn M. pneumniae C G A C T A A C T A T G T G C C A G C A G T C G C G mycrrnaar M. arginini T G G C T A A C T A T G T G C C A G C A G C C G C G af125583 M. salivarium T G G C T A A C T A T G T G C C A G C A G C C G C G mycrrnapi M. pirium C G A C T A A C T A T G T G C C A G C A G T C G C G Mismatches are shown in boxes GGCGAATGGGTGAGTAACACG) 와 primer B(reverse primer, 5 CGGATAACGCTTGCGACCTATG) 를사용하였다 [21]. 마이코플라스마 DNA 를실시간으로검출하기위한 TaqMan probe 는마이코플라스마 16S rrna 유전자 DNA 서열 alignment 를통해상동성이높은부분을선택하였으며, primer 보다 Tm (melting 온도 ) 값이 8~10 정도높게디자인하였다. 또한다양한종류의마이코플라스마를검출하기위해 mismatch 를가지는부분을모두포함한 mixed base 로구성하였다 (Table 2). TaqMan probe sequence 5' 말단에는 fluorescent reporter dye 인 6-carboxy-fluorescein (FAM) 을 3' 말단에는 quencher 인 Blak Hole Quencher 1 (BHQ-1) 이오도록디자인하였다. 2.3. Real-time PCR을이용한마이코플라스마 DNA 정량최적화 StepOne Plus Real-Time PCR System (Applied Biosystems, USA) 을사용하여 TaqMan probe real-time PCR을이용한마이코플라스마 DNA 정량시험법을최적화하였다. 먼저마이코플라스마 DNA 추출을최적화하기위해서로다른 5종류의 DNA 추출 kit에대한비교실험을실시하였다. 비교실험을위해 PrepSEQ nucleic acid extraction kit (Applied Biosystems, USA), Exgene blood SV mini kit (GeneALL, Korea), QIAamp DNA mini kit (QIAGEN, German), Genomic DNA prep kit (Solgent, Korea), I-genomic BYF DNA extraction min kit (INtRON, Korea) 를사용하였다. Titer가 1 10 5 CFU/mL인 M. fermentans를대상으로각제조회사의메뉴얼에따라 DNA를추출하였다. 추출된 DNA를주형으로 Realtime PCR master mix (TOYOBO, Japan) 를사용하여 TaqMan probe real-time PCR 시험을수행한후 crossing point 값을비교하였다. Crossing point (Cp) 는 PCR cycle이 exponential phase로들어가는 cycle 수를나타낸다. PCR 반응을위해 2 Realtime PCR master mix (TOYOBO, Japan) 10 µl, 10 pmol forward primer 1.5 µl, 10 pmol reverse primer 1.5 µl, 10 pmol specific probe 0.5 µl, template DNA 5 µl 혼합액에 MgCl 2 (25 mm) 0.8 µl, Nuclease-free water 0.7 µl를첨가하여최종부피를 20 µl가되게하였다. 핵산증폭은 pre-incubation은 94 o C에서 90초, denaturation은 94 o C에서 30초, annealing은 40초 (annealing 온도최적화를위해 50, 52, 54, 56, 58, 60 o C에서 real-time PCR 수행 ), extention은 72 o C에서 20초로하여 45 cycle을수행하였다. 최적 MgCl 2 농도를설정하기위해최적화된 annealing 온도 60 o C에서 MgCl 2 를 3 mm에서 6 mm까지변화시켜첨가해준마이코플라스마 DNA 농도에따른 crossing point 값을비교하였다. 7종의마이코플라스마표준균주를 10배수로연속적으로희석한후 real-time PCR 을수행하여마이코플라스마 log titer (log 10 CFU/mL; x) 에대한 Cp 값 (y) 간의표준회귀식을구하였다. 2.4. Real-time PCR 의신뢰성검증확립된마이코플라스마 real-time PCR 검출시험법의신뢰성 (reliability) 을보증하기위해확립된실험법의특이성 (Speci-

364 Korean Society for Biotechnology and Bioengineering Journal 29(5): 361-371 (2014) ficity), 검출한계 (Limit of detection), 완건성 (Robustness) 을검증하였다. Real-time PCR 검증은 European Pharmacopea section 2.6.7 가이드라인과식품의약품안전청의 핵산증폭검사법검증가이드라인 에따라실시하였다 [12,20]. 2.4.1. 특이성검증핵산증폭검사법의특이성은시험대상물에서특정핵산을정확하게검출할수있는능력이다. 특이성검증을위해생물의약품생산을위해사용되는 CHO-K1 세포주와 CHO- DG44 세포주, human keratinocyte, human mesenchymal stem cell 및 C8166, Vero, MA104, A9 과같은총 8 종의세포 ( 주 ) 를대상으로 cross-reactivity 를측정하였다. 시험에사용한각세포 ( 주 ) 의농도는 10 6 cell/ml 이었다. Real-time PCR 양성대조군으로는농도가 10 4 CFU/mL 인 M. fermentans 를사용하였으며, 음성대조군으로는 phosphate buffered saline (PBS) 을사용하였다. 2.4.2. 검출한계검증검출한계값은총시험건수중 95% 가양성으로검출될수있는검체량당최소목표핵산의양을의미한다. 최소한 3 개의연속희석한패널을독립적으로준비하여각희석배수당 24 회반복검사를실시한후결과를분석하였다. 7 종의마이코플라스마를각각 1 10 3 CFU/mL 에서 1 10-1 CFU/mL 까지 10 배수로연속적으로희석하여최적화된 real-time PCR 방법으로검출시험을수행하였다. 2.4.3. 완건성검증완건성은시험방법중일부조건이소규모라도의도적으로변경되었을때측정값이얼마나영향을받는지에대한척도를나타내는것으로통상적으로검사법의신뢰도에대한지표이다. 마이코플라스마음성배양세포에대하여정해진검출한계값의 3 배에해당하는농도가되도록해당마이코플라스마핵산을첨가한후검사를실시할때모두양성으로확인될경우검사법의견고성을입증할수있다. 이를위해마이코플라스마음성배양세포인사람각질세포에각마이코플라스마균주검출한계의 3 배에해당되는농도를첨가한다음 3 회의 real-time PCR 을실시한후평균 Cp 값을비교하였다. MgCl 2 의농도에따른 real-time PCR 시험법의견고성검증을검증하기위해 M. hyorhinis 를 1 10 3 CFU/mL 부터 1 10 1 CFU/mL 까지연속적으로희석한후 MgCl 2 의농도를 3 mm, 4 mm, 5 mm 로변화시켜서 3 회의 real-time PCR 을실시한후평균 Cp 값을비교하였다. 제조사를달리한 primer 에따른 real-time PCR 방법의견고성을검증하기위해 M. hyorhinis 균주를 1 10 3 CFU/mL 부터 1 10 1 CFU/mL 까지연속희석한후 3 곳의 primer 제조회사가제조한 primer 로 3 회의 real-time PCR 을실시한후평균 Cp 값을비교하였다. 2.4.4. 마이코플라스마 DNA copy 수대집락형성단위비율결정마이코플라스마 DNA copy 수대집락형성단위비율은 realtime PCR 민감도와배양법의민감도비교동등성을결정하는데매우중요하다. 먼저마이코플라스마 DNA copy 수정량을위한 plasmid standard 를제작하였다이를위해 A. laidlawii 16S rrna 유전자를기초로하여본연구를통해확립된 realtime PCR 증폭유전자부위를포함하여 780 bp 산물이증폭되도록 primer 를디자인하였다. Forward primer 는 TGCATGT TGAACGGGATGTAGC, Reverse primer 는 GCCAGTATCCA AAGCGGACTGA 로 PCR 산물을 T-Blunt vector 에삽입하였다. E. coli DH5a 에 plasmid standard 를 transformation 시킨후배양하여 plasmid standard 를증폭한다음 QIAfilter plasmid midi kit (Qiagen, USA) 를사용하여 plasmid standard 를추출하였다. 260 nm 와 280 mm 의흡광도로 plasmid standard 의농도를측정하여 copy 수로환산하였다. Plasmid standard 를 1 10 7 copies/µl 부터 1 10 1 copies/µl 까지 10 배수로연속적으로희석하여 TaqMan probe real-time PCR 을수행하고, copy 수에따른 Cp 값을환산하여정량을위한표준곡선을작성하였다. 각마이코플라스마의 CFU 에따른 Cp 값을표준곡선에대입하여마이코플라스마 DNA copy 수대집락형성단위비율을결정하였다. 2.4.5. 피부세포및줄기세포를이용한배양법과비교동등성시험배양법과의비교동등성을시험하기위하여 real-time PCR 시험법과공정서상의마이코플라스마부정시험법의검출한계시험을동시에실시하는방법을따라시험하였다. T-25 flask 에배양된 keratinocyte 와 mesenchymal stem cell 에 7 종의마이코플라스마를 10 3 CFU, 10 2 CFU, 10 1 CFU 의농도로접종하여오염시킨후 2 일간배양하였다. 상등액을제거한후세포표면과잔존세포배양액에남아있을수있는마이코플라스마를완벽히제거하기위해 PBS 로 3 번세척한다음새배양액을첨가하였다. 다시하루를배양한후세포를모두 5 ml 부피로부유시킨후세포와배양액을회수하여 DNA 를추출한후 real-time PCR 을수행하는한편, 공정서에따른마이코플라스마부정시험을수행하기위하여세포를모두부유시킨후세포와배양액을 200 µl 씩취하여마이코플라스마부정시험용 PPLO 고체배지네개에접종한후두개는호기상태로다른두개는혐기상태로 14 일간배양하여마이코플라스마집락형성유무를관찰하였다. 2.5. Vero 세포주에서 real-time PCR 을이용한마이코플라스마검출확립된 real-time PCR 을생물의약품제조공정검증에적용할수있는지확인하기위하여 rabies vaccine 생산세포주인 Vero 세포주에인위적으로마이코플라스마를오염시킨후마이코플라스마검출시험을실시하였다. Vero 세포를 10% 우혈청을첨가한 DMEM 배지 (Gibco BRL, USA) 에배양하였

마이코플라스마정량검출을위한 TaqMan Probe Real-Time PCR 365 다. T-25 flask 에배양된 Vero 세포주에 10 4 CFU/mL 농도인 M. fermentans 를 1 ml 접종한후 2 일동안배양하였다. 세포배양액을제거한후세포표면과잔존세포배양액에남아있을수있는마이코플라스마를완벽히제거하기위해 PBS 로 3 번세척한다음새배양액을첨가하였다. 다시하루를배양한후세포를 3 회계대배양하면서각계대때마다세포를 5 ml 부피로회수하였다. 이중 1 ml 을계대배양을위해사용하고, 나머지 4 ml 로부터확립된 real-time PCR 방법을이용하여마이코플라스마존재여부를확인하였다. Real-time PCR 양성대조군으로는농도가 10 4 CFU/mL 인 M. fermentans 를사용하였으며, 음성대조군으로는비감염된 Vero 세포주와 PBS 를사용하였다. 3. RESULTS AND DISCUSSION 3.1. 마이코플라스마 DNA 정량을위한 real-time PCR 최적화마이코플라스마 DNA 정량을위한 TaqMan probe real-time PCR 의민감도는시료로부터 DNA 를추출하는효율, 프라이머의염기서열과 PCR 반응조건등에의해결정되는마이코플라스마 DNA 증폭효율, 증폭되는핵산을검출하기위한 probe 의염기서열에의해결정된다. 먼저마이코플라스마 DNA 추출시험방법을최적화하기위해서로다른 5 종류의 DNA 추출 kit 에대한비교실험을실시하였다. 1 10 5 CFU/mL 인 M. fermentans 를대상으로각 kit 제조회사의메뉴얼에따라 DNA 를추출한후 TaqMan probe real-time PCR 검출시험을실시한결과 PrepSEQ nucleic acid extraction kit 를사용하여추출한 DNA 에서가장먼저증폭이일어났다 ( 자료미제시 ). M. fermentans 를순차적으로 1 10 4 CFU/mL, 1 10 2 CFU/ ml, 1 10 0 CFU/mL 로희석한후 annealing temperature 를 50, 52, 54, 56, 58, 60 o C 로변화시켜서 real-time PCR 을수행하였을때온도에따른큰차이가없었지만 60 o C 에서 Cp 값이가장낮게나타나 60 o C 가최적온도임을알수있었다 ( 자료미제시 ). 최적온도에서 MgCl 2 농도를변화시켜 PCR 조건을최적화하였다. M. fermentans 를순차적으로 1 10 4 CFU/mL, 1 10 2 CFU/mL, 1 10 0 CFU/mL 로희석한후 MgCl 2 농도를 3 mm, 4 Fig. 1. Amplification plots obtained with 10-fold serial dilutions of M. fermentans (A) and the standard curve obtained by the regression analysis of crossing point values versus initial M. fermentans titer (B). mm, 5 mm, 6 mm 로변화시켜서 real-time PCR 을수행하였을때 4 mm 에서 Cp 값이가장낮게나타나최적 MgCl 2 농도는 4 mm 임을알수있었다 ( 자료미제시 ). 최적화된조건에서 Titer 가 1 10 4 CFU/mL 인 M. fermentans 를순차적으로 10 배씩희석한후 real-time PCR 을수행하였다. 각시료에대해 real-time PCR cycle 수에따른 fluorescence 값의증가를관찰한결과 1 10 0 CFU/mL 까지 M. fermentans DNA 를검출할수있었다 (Fig. 1). M. fermentans log titer (log 10 CFU/mL; x) 에대한 Cp 값 (y) 간의표준회귀식은 y = -3.374x+36.406 ( 결정계수 r 2 =0.999) 로 M. fermentans log titer 와 Cp 값간의회귀성이매우높았다. 다른 6 종의마이코플라스마에대해서도정량곡선을작성하고 log titer (log 10 CFU/ ml; x) 에대한 Cp 값 (y) 간의표준회귀식을구한결과결정계수가모두 0.99 이상으로계산되었다 (Table 3). 이와같은결과에서확립된 real-time PCR 은마이코플라스마정량검출 Table 3. Linear regression analysis of amplification plots obtained with 10-fold serial dilutions of mycoplasma species Mycoplasma CFU/ml Regression curve species 10 5 10 4 10 3 10 2 10 1 10 0 10-1 Y = -ax + b r 2 A. laidlawii 26.39 29.65 33.04 36.88 N/A Y = -3.488X + 36.722 0.998 M. gallisepticum 22.94 26.28 29.58 33.32 35.72 N/A Y = -3.259X + 36.085 0.996 M. fermentans 22.81 26.50 29.57 32.95 36.46 N/A Y = -3.374X + 36.406 0.999 M. hyorhinis 17.79 21.08 24.84 28.25 31.65 34.97 N/A Y = -3.458X + 35.076 1.000 M. orale 25.46 29.12 32.82 35.50 N/A Y = -3.382X + 35.798 0.995 M. pneumoniae 24.88 28.40 31.94 35.04 N/A Y = -3.402X + 35.170 0.999 M. synoviae 26.36 29.67 32.87 36.45 N/A Y = -3.346X + 39.702 0.999

366 Korean Society for Biotechnology and Bioengineering Journal 29(5): 361-371 (2014) 3.2. Real-time PCR 의신뢰성검증마이코플라스마 DNA 정량을위한 real-time PCR 방법의신뢰성을보증하기위해확립된실험법의특이도, 검출한계, 완건성을검증하였다. Fig. 2. Specificity of real-time PCR assay to human and animal cells. Specificity of the real-time PCR assay to human and animal cells such as human keratinocyte, human mesenchymal stem cell, CHO-K1 cell, CHO-DG44 cell (A), C8166 cell, Vero cell, MA104 cell, and A9 cell (B) was evaluated using real-time PCR. 시 log titer 와 Cp 값사이에직선성이매우높음을확인하였다. Real-time PCR 의효율을표준회귀식의기울기값으로판단할수있다. 100% 증폭효율을나타내는기울기값은 -3.32 이며, 일반적으로 -3.60 에서 -3.10 의기울기값을나타내면증폭효율이 90~110% 로정량시험법으로적합한 real-time PCR 시험방법으로판단한다. 본연구를통해확립된 real-time PCR 의표준회귀식에서기울기값은 -3.259 에서 -3.488 값사이에존재하였다. 이와같은결과에서확립된 real-time PCR 은정량시험법으로적합한시험법임을확인하였다. 3.2.1. 특이도검증생물의약품은다양한종류의사람과동물세포주, 혈액, 조직, 기관등을이용해서생산된다. 확립된 real-time PCR을생물의약품생산공정에적용하기위해항체치료제, 유전자재조합단백질의약품등생산에사용되는세포주인 CHO-K1 세포주와 CHO-DG44 세포주, 사람피부세포치료제생산에사용되는 human keratinocyte, 줄기세포치료제생산에사용되는 human mesenchymal stem cell을대상으로특이성을시험한결과완충용액음성대조군과같이 fluorescence값의증가를관찰할수없었고, 양성대조구인 M. fermentans의경우에만 fluorescence값의증가를관찰할수있었다 (Fig. 2A). 또한사람과원숭이, 쥐유래세포주인 C8166 (Human T cell leukaemia), Vero (Cercopithecus aethiops kidney cell), MA104 (Cercopithecus aethiops kidney cell), A9 (Mouse fibroblast cell) 세포주를대상으로특이성을시험한결과완충용액음성대조군과같이 fluorescence값의증가를관찰할수없었고, 양성대조구인 M. fermentans의경우에만 fluorescence값의증가를관찰할수있었다 (Fig. 2B). 3.2.2. 검출한계검증검출한계검증을위해각마이코플라스마당 3 개의연속희석한샘플을준비하여각희석배수당 8 회에걸쳐총 24 회검출시험을실시하였다. Table 4 는 M. fermentans 를대상으로수행한검출한계시험의결과이다. 검출한계값은총시험건수중 95% 가양성으로검출될수있는검체의부피당마이코플라스마 CFU 수를의미하기때문에총 24 회시험중 23 회이상양성값이나온농도인 10 CFU/mL 을검출한계로결정하였다. 동일한방법의시험결과 A. laidlawii, M. gallisepticum, M. hyorhinis, M. orale, M. pneumoniae 의검출한계는 10 CFU/mL, M. synoviae 의검출한계는 1 CFU/mL 로나타났다 Table 4. Determination of LOD (Limit of Detection) of M. fermentans Run CFU/mL 10 3 10 2 10 1 10 0 10-1 LOD 1 + + + + + + + + + + + + - - - 1 CFU/mL 2 + + + + + + + + + + + + - - - 1 CFU/mL 3 + + + + + + + + + + + + - - - 1 CFU/mL 4 + + + + + + + + + + + + - - - 1 CFU/mL 5 + + + + + + + + + + + + - - - 1 CFU/mL 6 + + + + + + + + + + + + - - - 1 CFU/mL 7 + + + + + + + + + + + - - - - 10 CFU/mL 8 + + + + + + + + + - - - - - - 10 CFU/mL Decision 10 CFU/mL Three independent 10-fold dilution series of M. fermentans were tested on different days with 8 replicates for each dilution. LOD for the individual run was determined as the lowest CFU/mL of detectable. + represented the positive signal while - represented the negative signal for each replicate.

마이코플라스마정량검출을위한 TaqMan Probe Real-Time PCR 367 Table 5. Summary of the validated LOD (Limit of Detection) for each Mycoplasma tested in the validation study Mycoplasma species Limit of detection A. laidlawii 10 CFU/mL M. gallisepticum 10 CFU/mL M. fermentans 10 CFU/mL M. hyorhinis 10 CFU/mL M. orale 10 CFU/mL M. pneumoniae 10 CFU/mL M. synoviae 1 CFU/mL LOD was determined as the lowest CFU/mL number of each Mycoplasma detectable at least 23 out of 24 replicates (more than 95%) in all 8 runs performed during validation study. (Table 5). European Pharmacopea section 2.6.7 가이드라인에따르면핵산증폭검사법이배양시험법 ( 직접도말법, 증균배양법, 멤브레인필터법 ) 을대신하기위해서는 Table 1 에기술된마이코플라스마참조패널각각을모두 10 CFU/mL 이상의민감도로검출하여야만한다 [12]. 검출한계검증시험결과확립된 TaqMan probe real-time PCR 시험법은 European Pharmacopea 의기준을만족하였다. 3.2.3. 완건성검증확립된 real-time PCR 방법의완건성을검증하기위해마이코플라스마음성으로확인된사람각질세포를회수하여각마이코플라스마검출한계의 3 배에해당되는농도가되게 spiking 한후검출시험을실시하였다. 실험결과 7 종의마이코플라스마가모두검출되었다 (Table 6). MgCl 2 농도변화에따른완건성을검증하기위해 M. hyorhinis 를대상으로 MgCl 2 농도를 3 mm, 4 mm, 5 mm 로변화 시켜 real-time PCR 을실시한후평균 Cp 값을비교하였다 (Table 7). Cp 값에대한 CV % 는각 1.41, 0.79, 2.36 으로확인되었다. 실험조건의농도에서 Cp 값의변화가거의없어 MgCl 2 농도의변화에대한완건성이있음을확인할수있었다. 제조회사를달리한 primer 에따른 real-time PCR 방법의완건성을검증하기위해 3 곳의 primer 제조회사가제조한 primer 를선정하였다. M. hyorhinis 균주를 1 10 3 CFU/mL 부터 1 10 1 CFU/mL 까지연속희석한후 primer 별로 3 회의 realtime PCR 을실시한후평균 Cp 값을비교하였다. Cp 값에대한 CV % 는 1.12, 0.79, 0.70 으로확인되었다. 서로다른제조회사의 primer 에서 Cp 값의변화가거의없어완건성이있음을확인하였다 (Table 8). 3.3. 마이코플라스마 DNA copy 수대집락형성단위비율결정마이코플라스마 DNA copy 수대집락형성단위비율은 realtime PCR 민감도와배양법의민감도비교동등성을결정하는데매우중요하다 [12,15]. 본연구에사용된 7 가지표준균주의 DNA copy 수 (DNA copy number/ml) 대집락형성단위 (CFU/mL) 비율은 9~740 까지넓은구간에걸쳐있었다 (Table 9). Touch down PCR 마이코플라스마검출시험법을검증한최근보고의경우에도마이코플라스마 DNA copy 수대집락형성단위비율은 5~5,511 까지넓은구간에걸쳐있었다 [15]. 집락형성단위는마이코플라스마성장단계에따라달라질수있다. 지수성장기에회수한마이코플라스마의 DNA copy 수대집락형성단위비율은정체기에회수한마이코플라스마의 DNA copy 수대집락형성단위비율보다작다 ( 미발표자료 ). 또한배양환경과방법에따라집락형성단위수가달 Table 6. Robustness of real-time PCR assay (Detection of Mycoplasma from human keratinocyte spiked with 3 times amount of LOD of each mycoplasma) Mycoplasma species Spiked concentration Detection of Mycoplasma (Cp values) Decision A. laidlawii 30 CFU/ml 28.01 28.09 28.04 Positive M. gallisepticum 30 CFU/ml 31.02 31.27 31.22 Positive M. fermentans 30 CFU/ml 31.78 32.06 32.08 Positive M. hyorhinis 30 CFU/ml 29.33 29.70 29.90 Positive M. orale 30 CFU/ml 29.50 30.37 29.95 Positive M. pneumoniae 30 CFU/ml 28.01 28.06 28.27 Positive M. synoviae 3 CFU/ml 32.10 32.50 32.18 Positive Table 7. Robustness of real-time PCR assay (Effect of different MgCl 2 concentrations) M. hyorhinis (CFU/mL) Below optimal concentration (3 mm) Optimal concentration (4 mm) Cp values Above optimal concentration (3 mm) Mean of Cp SD of Cp CV(%) 1 10 3 22.47 22.24 22.37 22.41 21.76 22.08 21.88 21.65 21.80 22.07 0.31 1.41 1 10 2 25.87 25.60 25.68 25.55 25.59 25.71 25.24 25.40 25.30 25.55 0.20 0.79 1 10 1 29.38 31.07 28.93 29.05 29.04 29.06 29.14 28.89 28.87 29.27 0.69 2.36 Negative control N/A N/A N/A N/A N/A N/A N/A N/A N/A - - - Three independent 10-fold dilution series of M. hyorhinis were tested using different concentrations of MgCl 2 for real-time PCR. Mean and standard deviation (SD) of Cp were calculated. CV(%): Coefficient of variance % = (SD of Cp/Mean of Cp) 100 N/A, Not Applicable; real-time PCR signals were not detected.

368 Korean Society for Biotechnology and Bioengineering Journal 29(5): 361-371 (2014) Table 8. Robustness of real-time PCR assay (Effect of primer sets made by different vendors) M. hyorhinis (CFU/mL) Cp values Vendor A Vendor B Vendor C Mean of Cp SD of Cp CV(%) 1 x 10 3 21.82 21.93 21.66 22.19 21.91 21.70 22.41 21.76 22.08 21.94 0.24 1.12 1 x 10 2 25.19 25.18 25.16 25.28 25.29 25.39 25.55 25.59 25.71 25.37 0.20 0.79 1 x 10 1 28.73 28.91 28.46 29.06 28.93 29.02 29.05 29.04 29.06 28.92 0.20 0.70 Negative control N/A N/A N/A N/A N/A N/A N/A N/A N/A - - - Three independent 10-fold dilution series of M. hyorhinis were tested using different primer sets made by different vendors for real-time PCR. Mean and standard deviation (SD) of Cp were calculated. CV(%): Coefficient of variance % = (SD of Cp/Mean of Cp) 100 N/A, Not Applicable; real-time PCR signals were not detected. Table 9. Average gene copy to CFU ratio for mycoplasma strains Mycoplasma species Average gene copy to CFU ratio A. laidlawii 91 M. gallisepticum 740 M. fermentans 37 M. hyorhinis 132 M. orale 33 M. pneumoniae 9 M. synoviae 43 라질수있기때문에마이코플라스마의 DNA copy 수대집락형성단위비율도배양환경과방법에따라달라질수있다. 3.4. 사람피부세포및줄기세포를이용한배양시험법과비교동등성시험마이코플라스마검출을위한배양시험법과확립된 real-time PCR 방법의비교동등성을시험하기 T-25 flask 에배양된 keratinocyte 와 mesenchymal stem cell 에 7 종의마이코플라스마를각각 10 3 CFU, 10 2 CFU, 10 1 CFU 의농도로접종한후각시험법으로검출시험을실시하였다 (Table 10). Real-time PCR 방법은 keratinocyte 와 mesenchymal stem cell 시료에서 7 종모두 10 1 CFU 의농도로접종한경우까지검출하였다. 배양시험법으로마이코플라스마를검출하였을때호기상태에서배양한경우 10 3 CFU 의농도로접종한 A. laidlawii, M. hyorhinis, M. orale, M. gallisepticum, M. pneumoniae, M. synoviae Table 10. Comparability test between real-time PCR assay and culture method Mycoplasma species Detection methods Spiked titer (CFU) 1 10 3 1 10 2 1 10 1 A. laidlawii Culture method (Anaerobic) ND ND ND M. gallisepticum Culture method (Anaerobic) ND ND ND M. fermentans Culture method (Aerobic) ND ND ND Culture method (Anaerobic) D ND ND M. hyorhinis Culture method (Anaerobic) ND ND ND M. orale Culture method (Anaerobic) D ND ND Real-time PCR D D ND M. pneumoniae Culture method (Anaerobic) ND ND ND M. synoviae Culture method (Anaerobic) ND ND ND Solutions of mycoplasma species were spiked into human keratinocyte and mesenchymal stem cells cultivated in T-25 flask. After 2 days culture, culture supernatant were removed and washed three times with PBS to completely remove mycoplasma which might be present in culture supernatant. Then each flask was fed with 5 ml of culture medium and incubated again. After 1 day culture, cells were harvested and mycoplasma were detected using real-time PCR assay and culture method, respectively. D : Detected, ND : Not detected

마이코플라스마정량검출을위한 TaqMan Probe Real-Time PCR 369 의경우에만배양된콜로니를확인할수있었고, 10 2 CFU 와 10 1 CFU 의농도로접종한경우에는배양된콜로니를확인할수없었다. 혐기상태에서배양한경우 10 3 CFU 의농도로접종한 M. fermentans 와 M. orale 의경우에서만 keratinocyte 와 mesenchymal stem cell 시료에서배양된콜로니를확인할수있었다. 10 2 CFU 과 10 1 CFU 의농도로접종한경우에는배양된콜로니를확인할수없었다. 이와같은결과에서 real-time PCR 방법이배양시험법보다훨씬더신속하고민감하게마이코플라스마를검출할수있음을확인하였다. 개인단위의소량으로생산되는세포치료제의경우투여 72 시간전에마이코플라스마오염여부검사를공정서에수재된배양시험법또는 indicator cell culture 법으로실시하고 3 일간의시험결과를확인한후임상에적용하도록하고있다 [22]. 이러한배양시험법또는 indicator cell culture 법은그결과를확인하는데 28 일이소요되기때문에환자에게투여한후마이코플라스마오염여부검사결과가나오게되는세포치료제에적용하기에는현재어려움이많다. 또한배양시험법또는 indicator cell culture 법의경우검출배지의조성, 시료의특성및배양조건등많은요인에의해그결과가영향을받을수있어위음성결과가나올가능성이상존하고있다. 따라서세포치료제의경우, 마이코플라스마부정시험법으로신속검사법의적용이절실하게필요하다. 확립된 real-time PCR 을세포치료제제조공정에적용할경우배양시험법보다훨씬더신속하고민감하게마이코플라스마를검출할수있을것으로사료된다. 3.5. Vero 세포주에서 real-time PCR 을이용한마이코플라스마검출확립된 real-time PCR 을생물의약품제조공정에적용할수있는지확인하기위하여 rabies vaccine 생산세포주인 Vero 세포주에인위적으로 M. fermentans 를오염시킨후마이코플라스마검출시험을실시하였다. T-25 flask 에배양된 Vero 세포에 M. fermentans 를 10 4 CFU 의농도로오염시킨후 T-25 flask 에 3 번계대배양하면서각계대때마다세포를 5 ml 부피로회수하였다. 확립된 real-time PCR 방법을이용하여회수한세포배양액에존재하는마이코플라스마의농도를확인하였다 (Fig. 3). 1 회계대배양시료에서는 7.87 10 3 CFU/mL 농도의 M. fermentans 가검출되었고, 2 회및 3 회계대배양시료에서는각각 2.42 10 6, 1.71 10 6 CFU/mL 농도의 M. fermentans 가검출되었다. M. fermentans 가비감염된 Vero 세포주와 PBS 음성대조군에서는마이코플라스마가검출되지않았다. 마이코플라스마는세포벽이있는세균과는달리세포벽이없어형태가쉽게변하며, 직경이 0.3~0.8 µm 로작아세포배양용배지여과에사용되는 0.22~0.45 µm 의멤브레인필터를통과할수있기때문에세포배양용배지를통하여오염될수있다. 또한, 세포주가고농도의마이코플라스마에오염되어있어도배지의혼탁도, ph 의변화, 그리고세포변성효과등의가시적인변화가없기때문에오염사실이간과되는경향 Fig. 3. Quantitative detection of M. fermentans in artificially contaminated Vero cells. M. fermentans solution of 10 4 CFU was spiked into Vero cells and subcultured three times. M. fermentans was quantitatively detected from the artificially contaminated Vero cells using real-time PCR. 이있다. 마이코플라스마는이론적으로세포배양을위해사용되는동물과식물유래어떤물질로부터도오염될수있다. 또한토양이나물, 공기로부터도오염될수있다. 특히마이코플라스마가오염된세포의배양시에어로졸형태로다른세포주를오염시킬수있다 [2,23]. 미국과유럽, 일본, 한국의규제기관에서는세포배양시스템에서마이코플라스마검출시험을필수적으로수행하도록하고있다. 세포배양기로부터 unprocessed bulk 를회수하기전에세포배양액에서마이코플라스마를검출하도록하고있지만, 공정서에수재된배양시험법 ( 직접도말법, 증균배양법, 멤브레인필터법 ) 과 indicator cell culture 법을사용하면그결과를최종적으로확인하는데 28 일이소요된다 [12,13]. 보통 unprocessed bulk 는 48 시간안에 downstream process 를통해제품화가진행되기때문에마이코플라스마검출시험결과가나오기전에공정에투입되게되어마이코플라스마가오염된 unprocessed bulk 의경우분리정제공정시설과장비를오염시키게된다. 따라서마이코플라스마를신속하게검출할수있는시험법의적용이필요하다. European Pharmacopoeia section 2.6.7 은마이코플라스마검출을위한핵산증폭법을생물의약품공정에적용할수있게하기위하여분석법의특이도와검출한계, 완건성검증을위한방법과기준을제시하였다 [12]. 본연구에서는생물의약품제조공정에서마이코플라스마를신속하게검출하기위한 TaqMan probe real-time PCR 방법을개발하였다. 또한 European Pharmacopoeia section 2.6.7 과식품의약품안전청의 핵산증폭검사법검증가이드라인 에따라검증하여신뢰성을확보하였다. 확립된시험법은다양한종류의세포주와사람세포로부터분리한 DNA 에대해음성의결과를나타내었다. 또한 Table 1 에기술된마이코플라스마참조패널각각을모두 10 CFU/mL 이상의민감도로검출하여 European Pharmacopea 의기준을만족하였다. 확립된시험법은 MgCl 2 농도를변화시키거나서로다른제조사에서제조한 primer 를사용할경우에도동일한결과값을나타내었다. 또한마이코플라스마음성으로확인된 human keratinocyte 배양세포를회수하여각마이코플라스마검출한계의 3 배에해당되는농

370 Korean Society for Biotechnology and Bioengineering Journal 29(5): 361-371 (2014) 도가되게 spiking 한후 DNA 를추출한후검출시험을실시한결과 7 종의마이코플라스마가모두검출되어완건성이있음을확인하였다. 세포배양공정에직접적용하기위해인위적으로마이코플라스마를 keratinocyte 와 mesenchymal stem cell 에오염시킨후 3 일동안배양한다음 real-time PCR 시험법과직접도말배양법으로검출시험을실시한결과 real-time PCR 시험법이훨씬더민감하게검출할수있었다. 또한 Vero 세포주에마이코플라스마를오염시킨후확립된 real-time PCR 시험법으로검출한결과회수한세포주에서마이코플라스마를신속하게검출할수있었다. 4. CONCLUSION 본연구에서는다양한종류의마이코플라스마를신속하고, 특이적으로검출할수있는 TaqMan probe 를이용한 real-time PCR 시험법을확립하였다. 확립된시험법을 European Pharmacopoeia section 2.6.7 과식품의약품안전청의 핵산증폭검사법검증가이드라인 에따라검증하여신뢰성을확보하였다. 인위적으로마이코플라스마를사람각질세포와중간엽줄기세포, Vero 세포주에오염시킨후확립된 real-time PCR 시험법으로검출한결과회수한세포주에서마이코플라스마를신속하게검출할수있었다. 본연구를통해확립된 realtime PCR 시험법은생물의약품제조공정중생산용세포주, 원료물질, 공정중간물질, 완제품에서마이코플라스마신속검출을위해유용하게사용될수있을것으로기대된다. Acknoledgements 본연구는식품의약품안전청용역연구개발사업 ( 과제번호 : 11172 바약안 371) 과산업통상자원부및한국산업기술평가관리원의산업융합원천기술개발사업 ( 과제번호 : 10040197, 항체바이오베터개발을위한항체특성분석기반기술개발 ) 의일환으로수행하였음. 본내용의일부는세포치료제시험정보집 2 (Real-time PCR 을이용한마이코플라스마부정시험 ) 자료로출간됨. REFERENCES 1. Razin, S., D. Yogev, and Y. Naot (1998) Molecular biology and pathogenicity of mycoplasmas. Microbiol. Mol. Bio. Rev. 62: 1094-1156. 2. Razin, S. and L. Hayflick (2010) Highlights of mycoplasma research-an historical perspective. Biologicals 38: 183-190. 3. Roger, J. M. and R. A. Nicholas (1998) Introduction. pp. 1-6. In J. M. Roger and R. A. Nicholas (eds.). Mycoplasma protocols. Human Press, New Jersey, USA. 4. Masover, G. and L. Hayflick (1981) The genera Mycoplasma, Ureaplasma and Acholeplasma and associated organisms (Thermoplasmas and Anaeroplasmas). pp. 2247-2270. In M. P. Starr, H. Stolp, H. G. Truper, A. Balows, and H. G. Schlegel (eds.). The prokaryotes. Springer-Verlag, Berlin, German. 5. Hay, R. J., M. L. Macy, and T. R. Chen (1989) Mycoplasma infection of cultured cells. Nature 339: 487-488. 6. Stanbridge, E. (1971) Mycoplasmas and cell culture. Bacteriol. Rev. 35: 206-227. 7. Mirjalilia, A., E. Parmoora, S. Moradi Bidhendib, and B. Sarkari (2005) Microbial contamination of cell cultures: a 2 years study. Biologicals 33: 81-85. 8. Armstrong, S. E., J. A. Mariano, and D. J. Lundin (2010) The scope of mycoplasma contamination within the biopharmaceutical industry. Biologicals 38: 211-213. 9. Ogata, M. and K. Koshimizu (1967) Isolation of mycoplasmas from tissue cell lines and transplantable tumor cells. Jpn. J. Microbiol. 11: 289-303. 10. Chang, M. W. and K. H. Kim (1993) Detection of contaminated mycoplasmas on the cultured cell lines. J. Korean Soc. Microbiol. 28: 209-221. 11. Crispin, J. M., H. S. Kassem, S. D. Pepper, Y. Hey, T. H. Ward, and G. P. Margison (2003) Mycoplasma infection significantly alters microarray gene expression profiles. BioTechniques 35: 812-814. 12. European Pharmacopoeia. 6.1, section 2.6.7 Mycoplasmas. 13. Lawrence, B., H. Bashiri, and H. Dehghani (2010) Cross comparison of rapid mycoplasma detection platforms. Biologicals 38: 218-223. 14. Eldering, J. A., C. Felten, C. A. Veilleux, and B. J. Potts (2004) Development of a PCR method for mycoplasma testing of Chinese hamster ovary cell cultures used in the manufacture of recombinant therapeutic proteins. Biologicals 32: 183-193. 15. Zhi, Y., A. Mayhew, N. Seng, and G. B. Takle (2010) Validation of a PCR method for the detection of mycoplasmas according to European Pharmacopoeia section 2.6.7. Biologicals 38: 232-237. 16. Bruchmller, I., E. Pirkl, R. Herrmann, M. Stoermer, H. Eichler, H Klter, and P. Bugert (2006) Introduction of a validation concept for a PCR-based Mycoplasma detection assay. Cytotherapy 8: 62-69. 17. Ishikawa, Y., T. Kozakai, H. Morita, K. Saida, S. Oka, and Y. Masuo (2006) Rapid detection of mycoplasma contamination in cell cultures using SYBR Green-based real-time polymerase chain reaction. In Vitro Cell Dev. Biol. Anim. 42: 63-69. 18. Harasawa, R., H. Mizusawa, M. Fujii, J. Yamamoto, H. Mukai, T. Uemori, K. Asada, and I. Kato (2005) Rapid detection and differentiation of the major mycoplasma contaminants in cell cultures using real-time PCR with SYBR Green I and melting curve analysis. Microbiol. Immunol. 49: 859-863. 19. Stormer, M., T. Vollmer, B. Henrich, K. Kleesiek, and J. Dreier (2009) Broad-range real-time PCR assay for the rapid identification of cell-line contaminants and clinically important mollicute species. Int. J. Med. Microbiol. 299: 291-300. 20. Korea Food and Drug Administration (2003) Guidance on the validation of nucleic acid amplification tests, Korea Food & Drug Administration, Seoul, Korea. 21. Wong-Lee, J. G. and M. Lovett (1993) Rapid and sensitive PCR

마이코플라스마정량검출을위한 TaqMan Probe Real-Time PCR 371 method for identification of mycoplasma species in tissue culture. pp. 257-260. In: D. H. Persing, T. F. Smith, F. C. Tenover, and T. J. White (eds.). Diagnostic molecular microbiology principles and applications. American Society for Microbiology, Washington, DC, USA. 22. Korea Food and Drug Administration (2008) Draft guidance on the mycoplasma test suitable for cell therapy products. 23. Folmsbee, M., G. Howard, and M. McAlister (2010) Nutritional effects of culture media on mycoplasma cell size and removal by filtration. Biologicals 38: 214-217.