10_HM hwp

Size: px

Start display at page:

Download "10_HM hwp"

불암 견
5 years ago
Views:

1 Korean Journal of Microbiology (2016) Vol. 52, No. 3, pp pissn DOI eissn Copyright c 2016, The Microbiological Society of Korea Article Edwardsiella tarda 의비배양성생존상태 (VBNC) 유도및소생특성 강남이 김은희 * 전남대학교수산생명의학과 Induction and resuscitation of viable but nonculturable Edwardsiella tarda Nam I Kang and Eunheui Kim* Department of Aqualife Medicine, Chonnam National University, Yeosu 59626, Republic of Korea (Received August 30, 2016; Revised September 21, 2016; Accepted September 26, 2016) ABSTRACT: Bacteria in the viable but nonculturable (VBNC) state fail to produce colonies on routine bacteriological media, but are still alive in the state of very low metabolic activity. The aim of the present study was to induce the VBNC state of the Edwardsiella tarda using sea water microcosm under starvation conditions at 10 C and to investigate resuscitation of the VBNC cells in temperatures changed from 10 to 25 C, with and without additives. E. tarda entered into the VBNC state within about days of incubation in the microcosm. Throughout this period, the total cell counts as determined using acridine orange direct counting remained near the original inoculum level of ~10 8 cells/ml. The live cell counts measured with direct viable counting, on the other hands, declined to ~10 4 cells/ml. When the VBNC cells were incubated with addition of yeast extract, fish muscle extract or serum at 25 C, the ratios of resuscitated samples were 37%, 23%, and 37%, respectively. The characteristics of resuscitated E. tarda were consistent with those of the original E. tarda. When the resuscitated E. tarda were intraperitoneally injected into olive flounders, all fishes died within 5 days, indicating that the VBNC E. tarda might retain its pathogenic potential. Therefore, E. tarda under starvation conditions in the winter enter into the VBNC state and the VBNC E. tarda cells resuscitated at summer and autumn seawater temperature are considered to be pathogen continuously to olive flounder on the southern coast of Korea. Key words: Edwardsiella tarda, fish pathogen, resuscitation, viable but nonculturable (VBNC) 어류에에드워드병 (edwardsiellosis) 을일으키는 Edwardsiella tarda는그람음성세균으로넓은온도, ph, 그리고염분농도범위에서생존할수있는조건성병원체로고수온이나수질악화와같은부적합한환경에서어류의상피나장으로지속적인감염이이루어지는것으로알려져있다 (Woo et al., 2011). Sakai 등 (1994) 은어류에있어서에드워드병은연중발생하지만주로고수온기에중점적으로발생하며수온이낮을때는수중에서병원균이거의분리되지않으므로, E. tarda가양식환경내에비배양성생존 (viable but nonculturable; VBNC) 상태로있을가능성을제안하였다. VBNC 상태의세균은증식할수있는능력을완전히잃어버린것이아니므로적절한 *For correspondence. ehkim@chonnam.ac.kr; Tel.: ; Fax: 조건이주어지면대사가활발해지고완전히배양가능한상태로소생될수있으며 (McDougald et al., 1998), 병원성을보유하고있어소생되었을때는감염도가능한것으로보고되어있다 (Lleò et al., 2007; Sun et al., 2008). E. tarda 이외의어류병원세균으로는 Aeromonas hydrophila (Rahman et al., 2001), Flavobacterium columnare (Arias et al., 2012), Streptococcus parauberis (Curras et al. 2002) 등이 VBNC 상태에진입할수있으며, 일부종은 VBNC 상태에서독력을보유한다 (Curras et al., 2002; Du et al., 2007) 고증명되고있기때문에수산양식장의해수와저질에서발견되는 VBNC 세포는어류에지속적인발병원인이될수있다. 우리나라에서 E. tarda는수온상승기부터수온이떨어지는 11월까지검출되는데 (Cho et al., 2007) 저수온기의 E. tarda 동태에대한연구는매우미흡하다. 따라서본연구에서

2 314 Kang and Kim 는빈영양해수 microcosm을이용하여우리나라남해안의겨울철 (12 2월) 평균해수온도인 10 C에서 E. tarda의 VBNC 상태를유도하고, 수온이상승하는여름과가을 (6 10월) 의평균수온이라할수있는 25 C에서다양한소생조건을적용하였을때 VBNC 세포의소생및병원성의유지가능성에대하여알아보고자하였다. 재료및방법 실험균주본연구에사용된 E. tarda는 2002년 7월전라남도해남에서채집한넙치병어의복수로부터분리하여 -70 C에보존한균주를이용하였다. 균주는 NaCl 농도를 1% 로조정한 tryptic soy agar (TSA, BD) 배지에서 25 C로배양하여재생시켰으며, 16S rrna 유전자염기서열분석을실시하여 (Weisburg et al., 1991) 균주동일성을확인하였다. 또한병력이없는넙치에약 10 7 CFU/fish로복강주사하여실험어가 7일이내에모두사망하는것으로독력을확인한후실험에사용하였다 E. tarda의 VBNC 상태유도 E. tarda를 VBNC 상태로유도하기위한 microcosm은 Du 등 (2007) 의방법을응용하여제작하였다. 오래된해수 (aged sea water, ASW) 를 pore size 0.45 μm cellulose nitrate membrane filter (Whatman) 를이용하여여과한후 121 C에서 20분동안 2회고압증기멸균을하였다. E. tarda는최적생장온도인 31 C 로 24시간동안 TSA에서배양하여 0.9% NaCl 용액으로 3회세척하였으며최종농도 10 8 CFU/ml가되도록멸균된 ASW 에부유하여빈영양해수 microcosm을제작하였다. 이렇게제작한 microcosms을 10 C로유지하면서주 1회 TSA에도말하여 25 C에서 48시간배양한후배지에형성된집락의수를계수하여배양가능한균 (plate countable cells, PC) 으로나타내었다. Microcosm 시료 10 ml를 pore size 0.22 μm mixed cellulose ester filter (Advantec MFS) 로여과하여필터를 TSA 배지중앙에놓은후 25 C에서 48시간배양한후나타내는집락의수가 1 CFU 미만 (0.1 CFU/ml) 일때 Baffone 등 (2003) 의기준에따라 microcosm 전체가 VBNC 상태에들어갔다고판단하였다. 전균수측정 Microcosm 내의전체세균수는 acridine orange direct counting (AODC) 방법으로확인하였다 (Hobbie et al., 1977). 연속희석한 microcosm 시료에포르말린 (37% formaldehyde solution, Junsei) 을 2% 농도가되도록첨가하여시료내세포를고정하였다. Acridine orange (Sigma) 를 0.01% 의농도가되도록첨가하며 2분동안염색한후 pore size 0.22 μm black polycarbonate filter (Merck Millipore) 로여과하였다. 시료가여과된 black polycarbonate filter 를형광현미경 (Olympus BX51, 1,000) 의 green filter 하에서관찰하여단간균이나구균형태의형광을띄는세균을계수하였으며 7일간격으로전균수를측정하였다. 생존균수확인 Microcosm 내의생존균 (VBNC 와배양가능세균 ) 은 Kogure 등 (1979) 의방법을응용하여세포분열이억제된상태에서신장, 비대된세포를검출하는 direct viable counting (DVC) 법으로측정하였다. Microcosm 시료에 yeast extract를 0.025% 되게첨가하고 DNA 합성저해제로서 nalidixic acid (100 μg/ml, Sigma) 와 pipemidic acid (50 μg/ml, Sigma) 을혼합하여 0.025% 가되게첨가한후, 25 C에서 16시간동안배양하였다. 전균수측정법에준하여포르말린을첨가하여시료내의세포를고정하고 acridine orange로염색하여형광현미경으로관찰하면서크기가신장또는비대되어있고형광을띄는세균을생존균으로계수하였다. 배양조건에따른 VBNC E. tarda 소생률비교소생실험의첨가물로써 yeast extract, 넙치근육추출물그리고혈청을사용하였다. 건강한넙치근육 10 g에 PBS (phosphate buffered saline solution, 1 ) 50 ml를첨가하여마쇄한뒤원심분리하여상층액을 0.22 μm membrane filter (Advantec MFS) 로여과하여넙치근육추출물을제작하였고, 넙치의미부정맥으로부터채혈한혈액을 4 C에서 overnight 한후혈병과혈구를제거하고 membrane filter로여과하여혈청을제작하였다. 빈영양해수 microcosm 내의 E. tarda가모두 VBNC 상태에있다고판정된시료를 10 C에서 10, 20, 30, 60일경과후각각 10 ml를취하여첨가물을각각 0.025% 가되도록추가하여 25 C로온도를상승시킨후, VBNC 상태의세포들이배양가능한형태로소생되었는지를확인하였다. 매일시료를 TSA 배지에도말하여 31 C에서 24시간배양한후집락형성유무를확인하였으며소생된세균이있는실험구는 7 일동안집락의수를확인하여비교하였다. 미생물학회지제 52 권제 3 호

E. tarda 의 VBNC 유도및소생 315 소생된 E. tarda의특성분석소생된균은 E. tarda의 fimbrial gene cluster의 upstream region을타겟으로하는특이 primer (EDtT-F, TTCCGCAACC ATGATCAAAG; EDtT-R, AGGGCATATATCCACTCACTG) (Sakai et al.

PCR은 pre-denaturation (95 C, 5 min) 1 cycle; denaturation (95 C, 30 sec), annealing (55 C, 30 sec), extension (72 C, 30 sec) 30 cycles; final-extension (72 C, 5 min), 1 cycle의조건으로실시한후, 산물을 2% agarose

3 E. tarda 의 VBNC 유도및소생 315 소생된 E. tarda의특성분석소생된균은 E. tarda의 fimbrial gene cluster의 upstream region을타겟으로하는특이 primer (EDtT-F, TTCCGCAACC ATGATCAAAG; EDtT-R, AGGGCATATATCCACTCACTG) (Sakai et al., 2009) 를이용하여 colony PCR을실시하였다. PCR은 pre-denaturation (95 C, 5 min) 1 cycle; denaturation (95 C, 30 sec), annealing (55 C, 30 sec), extension (72 C, 30 sec) 30 cycles; final-extension (72 C, 5 min), 1 cycle의조건으로실시한후, 산물을 2% agarose gel에전기영동하여 original E. tarda와비교하였다. 또한소생된 E. tarda는 TSA에 1회계대한후 TSA 배지에서의배양성상과 Salmonella-Shigella (SS, BD) 배지에서검은색의집락을형성하는지확인하였고, API 20E kit와 API CH 50E kit (biomérieux) 로생화학적특성을비교분석하였다. API test는제조회사의 manual에따라수행하였으며결과는 Api-web ( 을통해확인하였다. 소생된균의병원성은넙치에대한인위감염으로확인하였다. 수조에 30 L 해수를넣고전장 cm 넙치를 10마리씩수용한후수온을 25 ± 1.0 C로유지하면서 5일동안순치시켰다. Original E. tarda와소생된 E. tarda를각각넙치에 CFU/fish로복강접종하고대조구넙치는 0.9% 생리식염수를주사한후 7일동안사망개체를확인하였다. 사망개체는해부하여간과신장으로부터세균을분리하였으며분리된세균이 SS 배지에서검은색집락을형성할때 E. tarda에의한사망으로판단하였다. 결과 저온빈영양해수 microcosm 내에서 E. tarda 의균수변화 Microcosm에서 E. tarda의균수변화를조사한결과 (Fig. 1), 일정시간경과후 E. tarda의 PC 값은계수할수없을수치 (<0.1 CFU/ml) 까지감소하였다. 전균수는모든균이 VBNC 상태에진입한이후까지처음접종했던농도인약 10 8 cells/ml 로일정하게나타났다. 반면 DVC 균수는배양시간이경과함에따라점차줄어드는경향을보였으며 7주가경과하자 10 4 cells/ml로감소하였으며모든세포가 VBNC 상태에진입하였다고판단되는이후에도약 10 4 cells/ml로유지되고있었다. AODC법으로관찰하였을때모든세균은형광을띄는단간균또는구균의형태 (Fig. 2A) 로나타난반면, DVC법으로관찰하였을때는 VBNC 상태의균을포함하여살아있는모든균은길이가신장되거나부피가증가되어나타났다 (Fig. 2B). 30개 microcosm을대상으로모든세포가 VBNC 상태에들어가는기간을비교한결과 (Fig. 3), 최단 42일부터최장 84일로평균약 70일이었다. (A) (B) Fig. 2. Morphological characteristics of the Edwardsiella tarda analyzed by the acridine orange direct count (A) and direct viable count (B) method under an epifluorescence microscope (Olympus BX51, 1,000). Fig. 1. Entry of Edwardsiella tarda into the viable but nonculturable state in an oligotrophic sea water microcosm at 10 C. (, PC), plate culturable cells counted by plate counting method on TSA; (, AODC), total cells counted by acridine orange direct count method; (, DVC), live cells including viable but nonculturable (VBNC) cells counted by direct viable count method. Fig. 3. Periods of induction of Edwardsiella tarda (10 8 CFU/ml) into the viable but nonculturable state in the oligotrophic seawater microcosm at 10 C. Korean Journal of Microbiology, Vol. 52, No. 3

4 316 Kang and Kim VBNC 상태 유도 후의 경과 기간에 따른 E. tarda의 소생 E. tarda가 VBNC 상태에 모두 진입하였다고 판정한 30개 의 빈영양 해수 microcosm에서 VBNC 세포의 소생을 조사한 결과(Fig. 4), 20일과 30일 경과한 시료의 15개 이상(50% 이 상)에서 소생이 확인되었으며, 60일 경과한 경우에는 평균 3 개(10%)의 시료에서 소생을 보였다. 소생된 균의 생화학적 특성과 독성 E. tarda 특이 프라이머를 이용하여 PCR을 실시한 결과, 혈 CH 50E test에서는 99.8% 상동성을 보였으며, 결과 profile이 original E. tarda와 동일하였다. 소생된 E. tarda를 넙치에 접종하였을 때 시험어는 접종 후 3일 이내에 에드워드병의 전형적인 증상인 복부팽만, 탈장 등 을 보이며 95% 이상 사망하였으며(Fig. 6) 사망어류의 간과 신 장에서 E. tarda가 재분리 되었다. 그러나 소생된 균을 접종한 실험구의 사망어 발생 시기는 original 균을 접종한 실험구에 비해 다소 지연되는 경향을 보였고, 대조구에서도 사망어가 발생하였지만 이들로부터 E. tarda는 분리되지 않았다. 청, 넙치근육추출물, 효모추출물을 각각 첨가하고 온도를 상 승시킨 조건과 유기물 첨가 없이 온도만 상승시킨 조건에서 소생된 E. tarda는 모두 약 270 bp 위치에서 original E. tarda와 고 찰 동일하게 단일 밴드를 나타내었다(Fig. 5). 또한 이들 소생된 세균은 영양 고갈, 온도 및 삼투압 변화, 자외선 노출 등과 균은 API 20E test에서 E. tarda와 99.4% 상동성이 있었고, API 같은 환경적 스트레스에 의해 VBNC 상태로 진입 할 수 있다 는 것이 다수 보고되어 있다(Oliver, 2010; Nowakowska and Oliver, 2013; Zhang et al., 2015), VBNC 상태의 세균은 낮은 대사 활성을 가지고 있음에도 불구하고 소생 되었을 때는 배 양 가능하며 독성을 나타낼 수도 있기 때문에 환경에서 VBNC 상태의 존재는 잠재적인 병원체로 중요하게 여겨진다. 우리나라에서 양식 넙치의 에드워드병은 연중 발생하는 질 병 중의 하나이므로 E. tarda가 우리나라 남해안의 겨울 해수 온도에서 VBNC 상태로 진입하는지 알아보기 위하여 인위적 인 microcosm에서 E. tarda의 VBNC 상태를 유도하였다. E. tarda가 접종된 빈영양 해수 microcosm을 10 C에서 배양하였 을 때, E. tarda는 Oliver (2005)가 제시하였던 전형적인 VBNC Fig. 4. Sample ratios showed the resuscitation of the VBNC Edwardsiella tarda (in vitro) with the addition of fish serum (0.025%, v/v), fish muscle extract (0.025%, v/v), or yeast extract (0.025%, w/v) and with temperature increase only (to 25 C), depending on the days elapsed since VBNC induction. Fig. 5. Colony PCR of resuscitated Edwardsiella tarda. O, original E. tarda; T, temperature increase only (to 25 C); Y, addition of yeast extract; M, addition of muscle extract; S, addition of serum; M, 100 kb ladder used as a size marker. 미생물학회지 제52권 제3호 유도 그래프를 나타내었다(Fig. 1). 시간 경과에 따라 PC, AODC, DVC에서 계수되는 수는 달랐지만 전 균수는 약 108 cells/ml 로 일정하였으며 평균 70일 경과 후에 VBNC 상태로 완전 진 Fig. 6. Mortality of olive flounder (Paralichthys olivaceus) infected with 6 original Edwardsiella tarda ( CFU/fish), resuscitated E. tarda 6 ( CFU/fish), and sterilized saline solution at 25 C.

5 E. tarda 의 VBNC 유도및소생 317 입하여약 10 4 cells/ml로유지되고있었다. Du 등 (2007) 은 E. tarda CW7을 CFU/ml 농도로 4 C에서배양하였을때 28 일이내에 VBNC 상태에들어간다고보고하였고, Sakai 등 (1994) 은 E. tarda를약 10 6 CFU/ml 농도로 25 C 해수또는담수에서배양하였을때해수에서는 5일, 담수에서는 15일이내에배양가능한세포가계수되지않는다고보고한바있다. 본연구에서는 Du 등 (2007) 의실험보다 microcosm 내의균농도가낮고유도온도는높은조건에서, 모든균이 VBNC 상태로도입되는시기는더길게나타나 E. tarda가 VBNC 상태로진입하는시기는온도와균농도에따라많이달라질것으로판단되었다. VBNC 상태유도후소생률을확인한결과, 온도와배지에따른소생률차이를보이지는않았으나, VBNC 상태경과시간에따라소생률차이를나타내었고 20 30일경과한 microcosm 에서소생률이높았다 (Fig. 4). 그러므로우리나라남해안에서는수온이낮아지면서 E. tarda는 VBNC 상태로유도되기시작하지만, 다시수온이올라가는시기까지는배양가능한균과 VBNC 상태의균이혼재할가능성이높아보이며수온이올라가면서 VBNC 세포가소생되어균의증가를가져오면서 E. tarda 에의한질병발생가능성이높아지는것으로생각된다. 이는 E. tarda가 VBNC 상태로유지되는시간이짧은우리나라남해안의경우에연중에드워드병이발생할수있음을시사한다. 반면, 온도만상승시킨대조구와영양물의첨가와함께온도를상승시킨실험구의소생에차이가없는것으로보아 E. tarda는영양물의유무보다는온도상승이소생에크게영향을끼치는것으로판단되었다. 소생된 E. tarda의생화학적특성은모두 original E. tarda와일치하였는데 Elabed 등 (2012) 도 Pseudomonas aeruginosa가 VBNC 상태로 14년동안유지되었음에도불구하고소생되었을때초기에는일부 cell의생화학적특성이달랐지만소생후 48시간이경과하면원래특성을회복함을보고한바있다. 많은병원성세균이 VBNC 상태에서도독력을유지한다는보고들이있지만 Colwell 등 (1996) 은 VBNC 상태의 Vibrio cholerae를이용한실험에서 VBNC 유도후장기간존재하였던세포들은감염성을잃을지도모른다고제안하였다. 본연구의인위감염실험에서소생된 E. tarda를넙치에접종하였을때시험어는 100% 사망하였지만, original 균을접종한실험구에비해사망어발생시기는다소지연되는경향을보였다. 이는소생된균의경우지속적인분열상태에있던 original 균에비해초기세대시간이길어감염어내에서의세균수에차이를나타내었기때문인것으로판단되며, 추후독성관련유전자의발현에관한연구가요구된다. 이상의결과를통해우리나라남해안의겨울해수온도 10 C 에서 E. tarda 는평균 70 일후에 VBNC 상태로완전진입할수 있으며 VBNC 상태인 E. tarda 는해수중에 10 5 cells/ml 이하 로생존하면서여름과가을철해수온도가 25 C 로상승되면 소생되어넙치에게지속적인병원체로작용한다고판단된다. 적요 Viable but nonculturable (VBNC) 상태에들어간세균은일반적인증균배지에서는집락을형성하지않지만, 죽은것이아니라낮은대사활성상태로유지되고있다. 본연구에서는 10 C의저온빈영양해수에서 Edwardsiella tarda를 VBNC 상태로유도한후, 해수온도를 10에서 25 C로상승시킬때첨가된유기물의종류에따라 VBNC 상태인균의소생가능성을알아보고자하였다. E. tarda가접종된빈영양해수 microcosm을 10 C에유지하였을때 VBNC 유도기간은 42 84일까지다양하였다. 유도기간동안 acridine orange direct counting법으로계수한총균수는초기접종농도인약 10 8 cells/ml로일정하였으며, direct viable counting법으로계수한생존균수는약 10 4 cells/ml로감소되었다. VBNC E. tarda에효모추출물, 넙치근육추출물그리고혈청을첨가하여 25 C에서소생을유도한결과전체시료개수의 37%, 23%, 37% 에서각각소생이확인되었으며소생된 E. tarda의특성은 VBNC 유도전원래의세균과일치하였다. 소생된 E. tarda를넙치 (Paralichthys olivaceus) 에복강주사하였을때접종후 5일이내에시험어가모두사망함으로써 VBNC 상태의 E. tarda가독력을유지하고있었음을시사하였다. 그러므로 E. tarda는우리나라남해연안겨울의저온빈영양해수에서 VBNC 상태로유도되었다가여름과가을시기에수온상승과더불어소생되어양식넙치에지속적인발병요인이되고있는것으로생각된다. 감사의말 이논문은 2013년도전남대학교학술연구비지원에의하여연구되었음. References Arias, C.R., LaFremtz, S., Cai, W., and Olivares-Fuster, O Adaptive response to starvation in the fish pathogen Flavo- Korean Journal of Microbiology, Vol. 52, No. 3

6 318 Kang and Kim bacterium columnare: cell viability and ultrastructural changes. BMS Microbiol. 12, 266. Baffone, W., Citterio, B., Vittoria, E., Casaroli, A., Campana, R., Falzano, L., and Donelli, G Retention of virulence in viable but non-culturable halophilic Vibrio spp. J. Food Microbiol. 89, Cho, M.Y., Kim, M.S., Kwon, M.G., Jee, B.Y., Choi, H.S., Choi, D.L., Park, K.H., Lee, C.H., Kim, J.D., Lee, J.S., et al Epidemiological study of bacterial disease of cultured olive flounder, Paralichthys olivaceus from 2005 to 2006 in Korea. J. Fish Pathol. 20, Colwell, R., Brayton, P., Herrington, D., Tall, B., Huq, A., and Levine, M Viable but non-culturable Vibrio cholerae O1 revert to a cultivable state in the human intestine. World J. Microbiol. Biotechnol. 12, Curras, M., Magarinos, B., Toranzo, A., and Romalde, J Dormancy as a survival strategy of the fish pathogen Streptococcus parauberis in the marine environment. Dis. Aquat. Org. 52, Du, M., Chen, J., Zhang, X., Li, A., Li, Y., and Wang, Y Retention of virulence in a viable but nonculturable Edwardsiella tarda isolate. Appl. Environ. Microbiol. 73, Elabed, H., Bakhrouf, A., Hamza, R., Azaiez, M., and Gaddour, K Evidence of the adaptive response in Pseudomonas aeruginosa to 14 years of incubation in seawater. Ann. Microbiol. 62, Hobbie, J.E., Daley, R.J., and Jasper, S Use of nuclepore filters for counting bacteria by fluorescence microscopy. Appl. Environ. Microbiol. 33, Kogure, K., Simidu, U., and Taga, N A tentative direct microscopic method for counting living marine bacteria. Can. J. Microbiol. 25, Lleò, M.M., Benedetti, D., Tafi, M.C., Signoretto, C., and Canepari, P Inhibition of the resuscitation from the viable but nonculturable state in Enterococcus faecalis. Environ. Microbiol. 9, McDougald, D., Rice, S.A., Weichart, D., and Kjelleberg, S Nonculturability: adaptation or debilitation?. FEMS Microbiol. Ecol. 25, 1 9. Nowakowska, J. and Oliver, J.D Resistance to environmental stresses by Vibrio vulnificus in the viable but nonculturable state. FEMS Microbiol. Ecol. 84, Oliver, J.D The viable but nonculturable state in bacteria. J. Microbiol. 43, Oliver, J.D Recent findings on the viable but nonculturable state in pathogenic bacteria. FEMS Microbiol. Rev. 34, Rahman, M.H., Suzuki, S., and Kawai, K Formation of viable but non-culturable state (VBNC) of Aeromonas hydrophila and its virulence in goldfish, Carassius auratus. Microbiol. Res. 156, Sakai, M., Atsuta, S., and Kobayashi, M Survival of fish pathogen Edwardsiella tarda in sea water and fresh water. Bull. Eur. Assoc. Fish Pathol. 14, Sakai, T., Yuasa, K., Sano, M., and Iida, T Identification of Edwardsiella ictaluri and E. tarda by species-specific polymerase chain reaction targeted to the upstream region of the fimbrial gene. J. Aquat. Anim. Health. 21, Sun, F., Chen, J., Zhong, L., Zhang, X.H., Wang, R., Guo, Q., and Dong, Y Characterization and virulence retention of viable but nonculturable Vibrio harveyi. FEMS Microbiol. Ecol. 64, Weisburg, W.G., Barns, S.M., Pelletier, D.A., and Lane, D.J S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 173, Woo, P.T., Leatherland, J.F., and Bruno, D.W Edwardsiella septicaemias : Fish diseases and disorders, Vol. 3, pp In Plumb, J.A. (eds.) CABI, New York, USA. Zhang, S., Ye, C., Lin, H., Lv, L., and Yu, X UV disinfection induce a VBNC state in Escherichia coli and Pseudomonas aeruginosa. Environ. Sci. Technol. 49, 미생물학회지제 52 권제 3 호

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.

1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -