10_HM hwp
|
|
- 불암 견
- 6 years ago
- Views:
Transcription
1 Korean Journal of Microbiology (2016) Vol. 52, No. 3, pp pissn DOI eissn Copyright c 2016, The Microbiological Society of Korea Article Edwardsiella tarda 의비배양성생존상태 (VBNC) 유도및소생특성 강남이 김은희 * 전남대학교수산생명의학과 Induction and resuscitation of viable but nonculturable Edwardsiella tarda Nam I Kang and Eunheui Kim* Department of Aqualife Medicine, Chonnam National University, Yeosu 59626, Republic of Korea (Received August 30, 2016; Revised September 21, 2016; Accepted September 26, 2016) ABSTRACT: Bacteria in the viable but nonculturable (VBNC) state fail to produce colonies on routine bacteriological media, but are still alive in the state of very low metabolic activity. The aim of the present study was to induce the VBNC state of the Edwardsiella tarda using sea water microcosm under starvation conditions at 10 C and to investigate resuscitation of the VBNC cells in temperatures changed from 10 to 25 C, with and without additives. E. tarda entered into the VBNC state within about days of incubation in the microcosm. Throughout this period, the total cell counts as determined using acridine orange direct counting remained near the original inoculum level of ~10 8 cells/ml. The live cell counts measured with direct viable counting, on the other hands, declined to ~10 4 cells/ml. When the VBNC cells were incubated with addition of yeast extract, fish muscle extract or serum at 25 C, the ratios of resuscitated samples were 37%, 23%, and 37%, respectively. The characteristics of resuscitated E. tarda were consistent with those of the original E. tarda. When the resuscitated E. tarda were intraperitoneally injected into olive flounders, all fishes died within 5 days, indicating that the VBNC E. tarda might retain its pathogenic potential. Therefore, E. tarda under starvation conditions in the winter enter into the VBNC state and the VBNC E. tarda cells resuscitated at summer and autumn seawater temperature are considered to be pathogen continuously to olive flounder on the southern coast of Korea. Key words: Edwardsiella tarda, fish pathogen, resuscitation, viable but nonculturable (VBNC) 어류에에드워드병 (edwardsiellosis) 을일으키는 Edwardsiella tarda는그람음성세균으로넓은온도, ph, 그리고염분농도범위에서생존할수있는조건성병원체로고수온이나수질악화와같은부적합한환경에서어류의상피나장으로지속적인감염이이루어지는것으로알려져있다 (Woo et al., 2011). Sakai 등 (1994) 은어류에있어서에드워드병은연중발생하지만주로고수온기에중점적으로발생하며수온이낮을때는수중에서병원균이거의분리되지않으므로, E. tarda가양식환경내에비배양성생존 (viable but nonculturable; VBNC) 상태로있을가능성을제안하였다. VBNC 상태의세균은증식할수있는능력을완전히잃어버린것이아니므로적절한 *For correspondence. ehkim@chonnam.ac.kr; Tel.: ; Fax: 조건이주어지면대사가활발해지고완전히배양가능한상태로소생될수있으며 (McDougald et al., 1998), 병원성을보유하고있어소생되었을때는감염도가능한것으로보고되어있다 (Lleò et al., 2007; Sun et al., 2008). E. tarda 이외의어류병원세균으로는 Aeromonas hydrophila (Rahman et al., 2001), Flavobacterium columnare (Arias et al., 2012), Streptococcus parauberis (Curras et al. 2002) 등이 VBNC 상태에진입할수있으며, 일부종은 VBNC 상태에서독력을보유한다 (Curras et al., 2002; Du et al., 2007) 고증명되고있기때문에수산양식장의해수와저질에서발견되는 VBNC 세포는어류에지속적인발병원인이될수있다. 우리나라에서 E. tarda는수온상승기부터수온이떨어지는 11월까지검출되는데 (Cho et al., 2007) 저수온기의 E. tarda 동태에대한연구는매우미흡하다. 따라서본연구에서
2 314 Kang and Kim 는빈영양해수 microcosm을이용하여우리나라남해안의겨울철 (12 2월) 평균해수온도인 10 C에서 E. tarda의 VBNC 상태를유도하고, 수온이상승하는여름과가을 (6 10월) 의평균수온이라할수있는 25 C에서다양한소생조건을적용하였을때 VBNC 세포의소생및병원성의유지가능성에대하여알아보고자하였다. 재료및방법 실험균주본연구에사용된 E. tarda는 2002년 7월전라남도해남에서채집한넙치병어의복수로부터분리하여 -70 C에보존한균주를이용하였다. 균주는 NaCl 농도를 1% 로조정한 tryptic soy agar (TSA, BD) 배지에서 25 C로배양하여재생시켰으며, 16S rrna 유전자염기서열분석을실시하여 (Weisburg et al., 1991) 균주동일성을확인하였다. 또한병력이없는넙치에약 10 7 CFU/fish로복강주사하여실험어가 7일이내에모두사망하는것으로독력을확인한후실험에사용하였다 E. tarda의 VBNC 상태유도 E. tarda를 VBNC 상태로유도하기위한 microcosm은 Du 등 (2007) 의방법을응용하여제작하였다. 오래된해수 (aged sea water, ASW) 를 pore size 0.45 μm cellulose nitrate membrane filter (Whatman) 를이용하여여과한후 121 C에서 20분동안 2회고압증기멸균을하였다. E. tarda는최적생장온도인 31 C 로 24시간동안 TSA에서배양하여 0.9% NaCl 용액으로 3회세척하였으며최종농도 10 8 CFU/ml가되도록멸균된 ASW 에부유하여빈영양해수 microcosm을제작하였다. 이렇게제작한 microcosms을 10 C로유지하면서주 1회 TSA에도말하여 25 C에서 48시간배양한후배지에형성된집락의수를계수하여배양가능한균 (plate countable cells, PC) 으로나타내었다. Microcosm 시료 10 ml를 pore size 0.22 μm mixed cellulose ester filter (Advantec MFS) 로여과하여필터를 TSA 배지중앙에놓은후 25 C에서 48시간배양한후나타내는집락의수가 1 CFU 미만 (0.1 CFU/ml) 일때 Baffone 등 (2003) 의기준에따라 microcosm 전체가 VBNC 상태에들어갔다고판단하였다. 전균수측정 Microcosm 내의전체세균수는 acridine orange direct counting (AODC) 방법으로확인하였다 (Hobbie et al., 1977). 연속희석한 microcosm 시료에포르말린 (37% formaldehyde solution, Junsei) 을 2% 농도가되도록첨가하여시료내세포를고정하였다. Acridine orange (Sigma) 를 0.01% 의농도가되도록첨가하며 2분동안염색한후 pore size 0.22 μm black polycarbonate filter (Merck Millipore) 로여과하였다. 시료가여과된 black polycarbonate filter 를형광현미경 (Olympus BX51, 1,000) 의 green filter 하에서관찰하여단간균이나구균형태의형광을띄는세균을계수하였으며 7일간격으로전균수를측정하였다. 생존균수확인 Microcosm 내의생존균 (VBNC 와배양가능세균 ) 은 Kogure 등 (1979) 의방법을응용하여세포분열이억제된상태에서신장, 비대된세포를검출하는 direct viable counting (DVC) 법으로측정하였다. Microcosm 시료에 yeast extract를 0.025% 되게첨가하고 DNA 합성저해제로서 nalidixic acid (100 μg/ml, Sigma) 와 pipemidic acid (50 μg/ml, Sigma) 을혼합하여 0.025% 가되게첨가한후, 25 C에서 16시간동안배양하였다. 전균수측정법에준하여포르말린을첨가하여시료내의세포를고정하고 acridine orange로염색하여형광현미경으로관찰하면서크기가신장또는비대되어있고형광을띄는세균을생존균으로계수하였다. 배양조건에따른 VBNC E. tarda 소생률비교소생실험의첨가물로써 yeast extract, 넙치근육추출물그리고혈청을사용하였다. 건강한넙치근육 10 g에 PBS (phosphate buffered saline solution, 1 ) 50 ml를첨가하여마쇄한뒤원심분리하여상층액을 0.22 μm membrane filter (Advantec MFS) 로여과하여넙치근육추출물을제작하였고, 넙치의미부정맥으로부터채혈한혈액을 4 C에서 overnight 한후혈병과혈구를제거하고 membrane filter로여과하여혈청을제작하였다. 빈영양해수 microcosm 내의 E. tarda가모두 VBNC 상태에있다고판정된시료를 10 C에서 10, 20, 30, 60일경과후각각 10 ml를취하여첨가물을각각 0.025% 가되도록추가하여 25 C로온도를상승시킨후, VBNC 상태의세포들이배양가능한형태로소생되었는지를확인하였다. 매일시료를 TSA 배지에도말하여 31 C에서 24시간배양한후집락형성유무를확인하였으며소생된세균이있는실험구는 7 일동안집락의수를확인하여비교하였다. 미생물학회지제 52 권제 3 호
3 E. tarda 의 VBNC 유도및소생 315 소생된 E. tarda의특성분석소생된균은 E. tarda의 fimbrial gene cluster의 upstream region을타겟으로하는특이 primer (EDtT-F, TTCCGCAACC ATGATCAAAG; EDtT-R, AGGGCATATATCCACTCACTG) (Sakai et al., 2009) 를이용하여 colony PCR을실시하였다. PCR은 pre-denaturation (95 C, 5 min) 1 cycle; denaturation (95 C, 30 sec), annealing (55 C, 30 sec), extension (72 C, 30 sec) 30 cycles; final-extension (72 C, 5 min), 1 cycle의조건으로실시한후, 산물을 2% agarose gel에전기영동하여 original E. tarda와비교하였다. 또한소생된 E. tarda는 TSA에 1회계대한후 TSA 배지에서의배양성상과 Salmonella-Shigella (SS, BD) 배지에서검은색의집락을형성하는지확인하였고, API 20E kit와 API CH 50E kit (biomérieux) 로생화학적특성을비교분석하였다. API test는제조회사의 manual에따라수행하였으며결과는 Api-web ( 을통해확인하였다. 소생된균의병원성은넙치에대한인위감염으로확인하였다. 수조에 30 L 해수를넣고전장 cm 넙치를 10마리씩수용한후수온을 25 ± 1.0 C로유지하면서 5일동안순치시켰다. Original E. tarda와소생된 E. tarda를각각넙치에 CFU/fish로복강접종하고대조구넙치는 0.9% 생리식염수를주사한후 7일동안사망개체를확인하였다. 사망개체는해부하여간과신장으로부터세균을분리하였으며분리된세균이 SS 배지에서검은색집락을형성할때 E. tarda에의한사망으로판단하였다. 결과 저온빈영양해수 microcosm 내에서 E. tarda 의균수변화 Microcosm에서 E. tarda의균수변화를조사한결과 (Fig. 1), 일정시간경과후 E. tarda의 PC 값은계수할수없을수치 (<0.1 CFU/ml) 까지감소하였다. 전균수는모든균이 VBNC 상태에진입한이후까지처음접종했던농도인약 10 8 cells/ml 로일정하게나타났다. 반면 DVC 균수는배양시간이경과함에따라점차줄어드는경향을보였으며 7주가경과하자 10 4 cells/ml로감소하였으며모든세포가 VBNC 상태에진입하였다고판단되는이후에도약 10 4 cells/ml로유지되고있었다. AODC법으로관찰하였을때모든세균은형광을띄는단간균또는구균의형태 (Fig. 2A) 로나타난반면, DVC법으로관찰하였을때는 VBNC 상태의균을포함하여살아있는모든균은길이가신장되거나부피가증가되어나타났다 (Fig. 2B). 30개 microcosm을대상으로모든세포가 VBNC 상태에들어가는기간을비교한결과 (Fig. 3), 최단 42일부터최장 84일로평균약 70일이었다. (A) (B) Fig. 2. Morphological characteristics of the Edwardsiella tarda analyzed by the acridine orange direct count (A) and direct viable count (B) method under an epifluorescence microscope (Olympus BX51, 1,000). Fig. 1. Entry of Edwardsiella tarda into the viable but nonculturable state in an oligotrophic sea water microcosm at 10 C. (, PC), plate culturable cells counted by plate counting method on TSA; (, AODC), total cells counted by acridine orange direct count method; (, DVC), live cells including viable but nonculturable (VBNC) cells counted by direct viable count method. Fig. 3. Periods of induction of Edwardsiella tarda (10 8 CFU/ml) into the viable but nonculturable state in the oligotrophic seawater microcosm at 10 C. Korean Journal of Microbiology, Vol. 52, No. 3
4 316 Kang and Kim VBNC 상태 유도 후의 경과 기간에 따른 E. tarda의 소생 E. tarda가 VBNC 상태에 모두 진입하였다고 판정한 30개 의 빈영양 해수 microcosm에서 VBNC 세포의 소생을 조사한 결과(Fig. 4), 20일과 30일 경과한 시료의 15개 이상(50% 이 상)에서 소생이 확인되었으며, 60일 경과한 경우에는 평균 3 개(10%)의 시료에서 소생을 보였다. 소생된 균의 생화학적 특성과 독성 E. tarda 특이 프라이머를 이용하여 PCR을 실시한 결과, 혈 CH 50E test에서는 99.8% 상동성을 보였으며, 결과 profile이 original E. tarda와 동일하였다. 소생된 E. tarda를 넙치에 접종하였을 때 시험어는 접종 후 3일 이내에 에드워드병의 전형적인 증상인 복부팽만, 탈장 등 을 보이며 95% 이상 사망하였으며(Fig. 6) 사망어류의 간과 신 장에서 E. tarda가 재분리 되었다. 그러나 소생된 균을 접종한 실험구의 사망어 발생 시기는 original 균을 접종한 실험구에 비해 다소 지연되는 경향을 보였고, 대조구에서도 사망어가 발생하였지만 이들로부터 E. tarda는 분리되지 않았다. 청, 넙치근육추출물, 효모추출물을 각각 첨가하고 온도를 상 승시킨 조건과 유기물 첨가 없이 온도만 상승시킨 조건에서 소생된 E. tarda는 모두 약 270 bp 위치에서 original E. tarda와 고 찰 동일하게 단일 밴드를 나타내었다(Fig. 5). 또한 이들 소생된 세균은 영양 고갈, 온도 및 삼투압 변화, 자외선 노출 등과 균은 API 20E test에서 E. tarda와 99.4% 상동성이 있었고, API 같은 환경적 스트레스에 의해 VBNC 상태로 진입 할 수 있다 는 것이 다수 보고되어 있다(Oliver, 2010; Nowakowska and Oliver, 2013; Zhang et al., 2015), VBNC 상태의 세균은 낮은 대사 활성을 가지고 있음에도 불구하고 소생 되었을 때는 배 양 가능하며 독성을 나타낼 수도 있기 때문에 환경에서 VBNC 상태의 존재는 잠재적인 병원체로 중요하게 여겨진다. 우리나라에서 양식 넙치의 에드워드병은 연중 발생하는 질 병 중의 하나이므로 E. tarda가 우리나라 남해안의 겨울 해수 온도에서 VBNC 상태로 진입하는지 알아보기 위하여 인위적 인 microcosm에서 E. tarda의 VBNC 상태를 유도하였다. E. tarda가 접종된 빈영양 해수 microcosm을 10 C에서 배양하였 을 때, E. tarda는 Oliver (2005)가 제시하였던 전형적인 VBNC Fig. 4. Sample ratios showed the resuscitation of the VBNC Edwardsiella tarda (in vitro) with the addition of fish serum (0.025%, v/v), fish muscle extract (0.025%, v/v), or yeast extract (0.025%, w/v) and with temperature increase only (to 25 C), depending on the days elapsed since VBNC induction. Fig. 5. Colony PCR of resuscitated Edwardsiella tarda. O, original E. tarda; T, temperature increase only (to 25 C); Y, addition of yeast extract; M, addition of muscle extract; S, addition of serum; M, 100 kb ladder used as a size marker. 미생물학회지 제52권 제3호 유도 그래프를 나타내었다(Fig. 1). 시간 경과에 따라 PC, AODC, DVC에서 계수되는 수는 달랐지만 전 균수는 약 108 cells/ml 로 일정하였으며 평균 70일 경과 후에 VBNC 상태로 완전 진 Fig. 6. Mortality of olive flounder (Paralichthys olivaceus) infected with 6 original Edwardsiella tarda ( CFU/fish), resuscitated E. tarda 6 ( CFU/fish), and sterilized saline solution at 25 C.
5 E. tarda 의 VBNC 유도및소생 317 입하여약 10 4 cells/ml로유지되고있었다. Du 등 (2007) 은 E. tarda CW7을 CFU/ml 농도로 4 C에서배양하였을때 28 일이내에 VBNC 상태에들어간다고보고하였고, Sakai 등 (1994) 은 E. tarda를약 10 6 CFU/ml 농도로 25 C 해수또는담수에서배양하였을때해수에서는 5일, 담수에서는 15일이내에배양가능한세포가계수되지않는다고보고한바있다. 본연구에서는 Du 등 (2007) 의실험보다 microcosm 내의균농도가낮고유도온도는높은조건에서, 모든균이 VBNC 상태로도입되는시기는더길게나타나 E. tarda가 VBNC 상태로진입하는시기는온도와균농도에따라많이달라질것으로판단되었다. VBNC 상태유도후소생률을확인한결과, 온도와배지에따른소생률차이를보이지는않았으나, VBNC 상태경과시간에따라소생률차이를나타내었고 20 30일경과한 microcosm 에서소생률이높았다 (Fig. 4). 그러므로우리나라남해안에서는수온이낮아지면서 E. tarda는 VBNC 상태로유도되기시작하지만, 다시수온이올라가는시기까지는배양가능한균과 VBNC 상태의균이혼재할가능성이높아보이며수온이올라가면서 VBNC 세포가소생되어균의증가를가져오면서 E. tarda 에의한질병발생가능성이높아지는것으로생각된다. 이는 E. tarda가 VBNC 상태로유지되는시간이짧은우리나라남해안의경우에연중에드워드병이발생할수있음을시사한다. 반면, 온도만상승시킨대조구와영양물의첨가와함께온도를상승시킨실험구의소생에차이가없는것으로보아 E. tarda는영양물의유무보다는온도상승이소생에크게영향을끼치는것으로판단되었다. 소생된 E. tarda의생화학적특성은모두 original E. tarda와일치하였는데 Elabed 등 (2012) 도 Pseudomonas aeruginosa가 VBNC 상태로 14년동안유지되었음에도불구하고소생되었을때초기에는일부 cell의생화학적특성이달랐지만소생후 48시간이경과하면원래특성을회복함을보고한바있다. 많은병원성세균이 VBNC 상태에서도독력을유지한다는보고들이있지만 Colwell 등 (1996) 은 VBNC 상태의 Vibrio cholerae를이용한실험에서 VBNC 유도후장기간존재하였던세포들은감염성을잃을지도모른다고제안하였다. 본연구의인위감염실험에서소생된 E. tarda를넙치에접종하였을때시험어는 100% 사망하였지만, original 균을접종한실험구에비해사망어발생시기는다소지연되는경향을보였다. 이는소생된균의경우지속적인분열상태에있던 original 균에비해초기세대시간이길어감염어내에서의세균수에차이를나타내었기때문인것으로판단되며, 추후독성관련유전자의발현에관한연구가요구된다. 이상의결과를통해우리나라남해안의겨울해수온도 10 C 에서 E. tarda 는평균 70 일후에 VBNC 상태로완전진입할수 있으며 VBNC 상태인 E. tarda 는해수중에 10 5 cells/ml 이하 로생존하면서여름과가을철해수온도가 25 C 로상승되면 소생되어넙치에게지속적인병원체로작용한다고판단된다. 적요 Viable but nonculturable (VBNC) 상태에들어간세균은일반적인증균배지에서는집락을형성하지않지만, 죽은것이아니라낮은대사활성상태로유지되고있다. 본연구에서는 10 C의저온빈영양해수에서 Edwardsiella tarda를 VBNC 상태로유도한후, 해수온도를 10에서 25 C로상승시킬때첨가된유기물의종류에따라 VBNC 상태인균의소생가능성을알아보고자하였다. E. tarda가접종된빈영양해수 microcosm을 10 C에유지하였을때 VBNC 유도기간은 42 84일까지다양하였다. 유도기간동안 acridine orange direct counting법으로계수한총균수는초기접종농도인약 10 8 cells/ml로일정하였으며, direct viable counting법으로계수한생존균수는약 10 4 cells/ml로감소되었다. VBNC E. tarda에효모추출물, 넙치근육추출물그리고혈청을첨가하여 25 C에서소생을유도한결과전체시료개수의 37%, 23%, 37% 에서각각소생이확인되었으며소생된 E. tarda의특성은 VBNC 유도전원래의세균과일치하였다. 소생된 E. tarda를넙치 (Paralichthys olivaceus) 에복강주사하였을때접종후 5일이내에시험어가모두사망함으로써 VBNC 상태의 E. tarda가독력을유지하고있었음을시사하였다. 그러므로 E. tarda는우리나라남해연안겨울의저온빈영양해수에서 VBNC 상태로유도되었다가여름과가을시기에수온상승과더불어소생되어양식넙치에지속적인발병요인이되고있는것으로생각된다. 감사의말 이논문은 2013년도전남대학교학술연구비지원에의하여연구되었음. References Arias, C.R., LaFremtz, S., Cai, W., and Olivares-Fuster, O Adaptive response to starvation in the fish pathogen Flavo- Korean Journal of Microbiology, Vol. 52, No. 3
6 318 Kang and Kim bacterium columnare: cell viability and ultrastructural changes. BMS Microbiol. 12, 266. Baffone, W., Citterio, B., Vittoria, E., Casaroli, A., Campana, R., Falzano, L., and Donelli, G Retention of virulence in viable but non-culturable halophilic Vibrio spp. J. Food Microbiol. 89, Cho, M.Y., Kim, M.S., Kwon, M.G., Jee, B.Y., Choi, H.S., Choi, D.L., Park, K.H., Lee, C.H., Kim, J.D., Lee, J.S., et al Epidemiological study of bacterial disease of cultured olive flounder, Paralichthys olivaceus from 2005 to 2006 in Korea. J. Fish Pathol. 20, Colwell, R., Brayton, P., Herrington, D., Tall, B., Huq, A., and Levine, M Viable but non-culturable Vibrio cholerae O1 revert to a cultivable state in the human intestine. World J. Microbiol. Biotechnol. 12, Curras, M., Magarinos, B., Toranzo, A., and Romalde, J Dormancy as a survival strategy of the fish pathogen Streptococcus parauberis in the marine environment. Dis. Aquat. Org. 52, Du, M., Chen, J., Zhang, X., Li, A., Li, Y., and Wang, Y Retention of virulence in a viable but nonculturable Edwardsiella tarda isolate. Appl. Environ. Microbiol. 73, Elabed, H., Bakhrouf, A., Hamza, R., Azaiez, M., and Gaddour, K Evidence of the adaptive response in Pseudomonas aeruginosa to 14 years of incubation in seawater. Ann. Microbiol. 62, Hobbie, J.E., Daley, R.J., and Jasper, S Use of nuclepore filters for counting bacteria by fluorescence microscopy. Appl. Environ. Microbiol. 33, Kogure, K., Simidu, U., and Taga, N A tentative direct microscopic method for counting living marine bacteria. Can. J. Microbiol. 25, Lleò, M.M., Benedetti, D., Tafi, M.C., Signoretto, C., and Canepari, P Inhibition of the resuscitation from the viable but nonculturable state in Enterococcus faecalis. Environ. Microbiol. 9, McDougald, D., Rice, S.A., Weichart, D., and Kjelleberg, S Nonculturability: adaptation or debilitation?. FEMS Microbiol. Ecol. 25, 1 9. Nowakowska, J. and Oliver, J.D Resistance to environmental stresses by Vibrio vulnificus in the viable but nonculturable state. FEMS Microbiol. Ecol. 84, Oliver, J.D The viable but nonculturable state in bacteria. J. Microbiol. 43, Oliver, J.D Recent findings on the viable but nonculturable state in pathogenic bacteria. FEMS Microbiol. Rev. 34, Rahman, M.H., Suzuki, S., and Kawai, K Formation of viable but non-culturable state (VBNC) of Aeromonas hydrophila and its virulence in goldfish, Carassius auratus. Microbiol. Res. 156, Sakai, M., Atsuta, S., and Kobayashi, M Survival of fish pathogen Edwardsiella tarda in sea water and fresh water. Bull. Eur. Assoc. Fish Pathol. 14, Sakai, T., Yuasa, K., Sano, M., and Iida, T Identification of Edwardsiella ictaluri and E. tarda by species-specific polymerase chain reaction targeted to the upstream region of the fimbrial gene. J. Aquat. Anim. Health. 21, Sun, F., Chen, J., Zhong, L., Zhang, X.H., Wang, R., Guo, Q., and Dong, Y Characterization and virulence retention of viable but nonculturable Vibrio harveyi. FEMS Microbiol. Ecol. 64, Weisburg, W.G., Barns, S.M., Pelletier, D.A., and Lane, D.J S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 173, Woo, P.T., Leatherland, J.F., and Bruno, D.W Edwardsiella septicaemias : Fish diseases and disorders, Vol. 3, pp In Plumb, J.A. (eds.) CABI, New York, USA. Zhang, S., Ye, C., Lin, H., Lv, L., and Yu, X UV disinfection induce a VBNC state in Escherichia coli and Pseudomonas aeruginosa. Environ. Sci. Technol. 49, 미생물학회지제 52 권제 3 호
-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More information1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More information42(3)-11(p ).fm
The Korean Journal of Microbiology, Vol. 42, No. 3, September 2006, p. 199-204 Copyright 2006, The Microbiological Society of Korea e ³ w ³ w Á Á½ Áx Á 1 Á 2, * w w w w w w e ³ ³ w p w. e ³ w ù š» 30 cm.
More information레이아웃 1
2014 의약품 제품 요약 해설집 National Fisheries Research & Development Institute 정 부 간 행 물 등 록 번 호 11-1192266-000040-01 과학원간행물 등록번호 S P - 2 0 1 4 - A Q - 0 0 2 2014 의약품 제품 요약 해설집 National Fisheries Research & Development
More information농림축산식품부장관귀하 본보고서를 미생물을활용한친환경작물보호제및비료의제형화와현장적용매뉴 얼개발 ( 개발기간 : ~ ) 과제의최종보고서로제출합니다 주관연구기관명 : 고려바이오주식회사 ( 대표자 ) 김영권 (
농림축산식품부장관귀하 본보고서를 미생물을활용한친환경작물보호제및비료의제형화와현장적용매뉴 얼개발 ( 개발기간 :2014. 7. 29 ~ 2016. 7. 28.) 과제의최종보고서로제출합니다. 2016. 7. 28. 주관연구기관명 : 고려바이오주식회사 ( 대표자 ) 김영권 ( 인 ) 협동연구기관명 : 목원대학교산학협력단 ( 대표자 ) 고대식 ( 인 ) 협동연구기관명
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More information( )Kju225.hwp
비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More informationDBPIA-NURIMEDIA
JFM SE, 29(3), pp. 834~846, 2017. www.ksfme.or.kr 수산해양교육연구, 제29권제3 호, 통권87 호, 2017. http://dx.doi.org/10.13000/jfmse.2017.29.3.834 2016 년도제주지역양식넙치(Paralichthys olivaceus ) 에서분리된어병세균의 tetracycline 내성유전자분포
More information22(3)-07.fm
J. Fd Hyg. Safety Vol. 22, No. 3, pp. 179~191 (2007),QWTPCN QH (QQF *[IKGPG CPF 5CHGV[ Available online at http://www.foodhygiene.or.kr Î ÜôÚ ò Ù Â 1 Â 2 Âú äâ Ö 3 Â Ùý* w w w, 1 w tœw, 2 w yw, 3 w yl
More information<B8F1C2F72E687770>
제1장 제17장 성홍열 및 사슬알균 감염증 사슬알균 (Streptococci)은 증식 중의 특징적으로 쌍 또는 사슬모양의 그람양성 알균 으로 catalase 음성, 통성혐기성균이며, 보통 한천배지에서는 발육이 어렵고 혈액이나 혈청 등을 첨가한 배지에서 잘 발육한다. 포도당이나 다른 탄수화물을 분해하나 포도당 을 분해하여 가스를 생성하지 않는다. 이들은 최소
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More information(....).hwp
sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More information기후변화에따른담수호수생태계변화조사 및보전에관한연구 (Ⅲ) - 기후변화에따른유해남조류발생특성연구 - 물환경연구부유역생태연구팀 Ⅲ 2012
11-148523-132-1 기후변화에따른담수호수생태계변화조사 및보전에관한연구 (Ⅲ) - 기후변화에따른유해남조류발생특성연구 - 물환경연구부유역생태연구팀 Ⅲ 212 목차 Ⅰ Ⅱ Ⅲ ⅰ 목차 Ⅳ ⅰ 목차 iii 목차 ⅳ Abstract ⅴ Ⅰ. 서론 1 Ⅱ. 연구내용및방법 < 그림 1> 대청호유역추소리조사지점도 2 Ⅱ. 연구내용및방법 3 Ⅱ. 연구내용및방법
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More informationMicrosoft PowerPoint - PDFCoTemp.PPT
주요유방염세균의검출및 항생제감수성검사 임숙경 1. 검사시료 1. 시료채취 유방염우유 2. 체세포수측정 3. 대상세균 - Staphylococcus aureus - Coagulase negative staphylococci -Escherichia coli 3. 균분리방법 E. coli CHEC Agar 직접도말 (37 18-24h) 보라색집락 EMB Agar
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More information- 2 -
- 1 - - 2 - - 3 - - 4 - - 5 - [ 그림 1] 산수유 [ 그림 2] 더덕 - 6 - - 7 - sample [ 그림 3] 균분리를위한접종 - 8 - PCA PCA with inoculum Slide glass [ 그림 4] Slide culture 모식도 - 9 - - 10 - Nutrient Medium Paperdisk with Antibiotics
More information398 이다원ㆍ전려진ㆍ김승민ㆍ정준범 (Lee and Kim, 2013)., Em (Lee et al., 2016) Korean statistical information service (KOSIS),,., Em (Han et al., 2012; Sung et
한수지 51(4), 397-403, 2018 Original Article Korean J Fish Aquat Sci 51(4),397-403,2018 제주지역양식넙치 (Paralichthys olivaceus) 에서분리한어병세균내 Erythromycin 내성유전자분석 이다원 전려진 김승민 1 정준범 * 제주대학교해양의생명과학부, 1 주식회사우진비앤지 Analysis
More information18 이수정 윤이나 김진도 이정식 김은희 연구자들은항세균성, 항곰팡이성, 항바이러스성물질을생산하는비병원성의세균을탐색하여양식장에적용하고자노력해왔다. 방등 (1999) 은 Lactobacillus plantarum, Bacillus coagulans 및 lactoferri
한국어병학회지제27권제1호 (2014) www.ksfp.org pissn 1226-0819, eissn 2233-5412 J. Fish Pathol., 27(1) : 17~24 http://dx.doi.org/10.7847/jfp.2014.27.1.017 어류병원세균, Listonella anguillarum 에대한 Pseudomonas aeruginosa
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More informationJournal of Life Science 2011, Vol. 21. No μ μ
Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,
More information가자미식해의제조공정최적화 37., (Choi et al., 200).. 재료 재료및방법 (Verasper Jordan et Gilbert;, ), (, ), (, ) (, )., (, ), (, ), (, ), (, ), (, ), (, ). 가자미식해제조 (round
한수지 48(), 036-043, 205 Original Article Kor J Fish Aquat Sci 48(),036-043,205 반응표면분석법을이용한가자미 (Verasper moseri Jordan et Gilbert) 식해제조최적화 한대원 김덕기 한호준 조순영 2 * 강릉원주대학교식품과학과, 강릉원주대학교동해안해양생물자원연구센터, 2 강릉원주대학교식품가공유통학과
More information보도자료 년 5 월 16 일 ( 목 ) 조간부터보도하여주시기바랍니다. 문의 : 에너지환경표준과최철우과장, 류지영연구사 ( ) 화장품에도국제표준이...? - 화장품도이젠표준선점으로세계시장선도를 - [ 붙임 1
보도자료 http://www.motie.go.kr 2013 년 5 월 16 일 ( 목 ) 조간부터보도하여주시기바랍니다. 문의 : 에너지환경표준과최철우과장, 류지영연구사 (509-7272) 화장품에도국제표준이...? - 화장품도이젠표준선점으로세계시장선도를 - [ 붙임 1 참조 ] [ 붙임 2 참조 ] [ 붙임 3, 4 참조 ] 이보도자료와관련하여보다자세한내용이나취재를원하시면산업통상자원부기술표준원에너지환경표준과류지영연구사
More informationJksvs019(8-15).hwp
Grade I Grade II Grade III 12 대한혈관외과학회지 : 제 20 권 제 1 호 2004 Control Group A Group B Fig. 4. Microscopic findings of vein wall in control, group A and group B on the day of 7 after venous occlusion. The
More information10(3)-10.fm
w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Feb.; 29(2), IS
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Feb.; 29(2), 93 98. http://dx.doi.org/10.5515/kjkiees.2018.29.2.93 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) UHF-HF
More information<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More informationuntitled
理 葉 CNFH-88-04 行 87 年 9 1 88 年 6 30 類 葉 Staphylococcus aureus Staphylococcus epidermidis Streptococcus mutans Streptococcus sanguis Escherichia coli Klebsiella pneumoniae Pseudomonas aeruginosa Candida
More information한수지 47(5), , 2014 Original Article Kor J Fish Aquat Sci 47(5), ,2014 MPN 및 H-NS 유전자를표적으로하는 PCR assay 를병용한장염비브리오 (Vibrio parahaemolyticus)
한수지 47(5), 556-561, 2014 Original Article Kor J Fish Aquat Sci 47(5),556-561,2014 MPN 및 H-NS 유전자를표적으로하는 PCR assay 를병용한장염비브리오 (Vibrio parahaemolyticus) 의정량 김태옥 박권삼 * 군산대학교식품생명공학과 Quantification of Vibrio
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More informationmau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
More information<C3D6C1BEBAB8B0EDBCAD2E687770>
Counter Pulse Generator TRX(Thyratron) Oscilloscope Pump Chamber Power Supply Oscilloscope Controller Inductor High Voltage Pulse Generator (-) 펄스폭:-0.5uS, 승압비:-1:2(GND) (-) 펄스폭:-2uS, 승압비:-1:1(GND)
More informationePapyrus PDF Document
Trans. of the Korean Hydrogen and New Energy Society(2013. 4), Vol. 24, No. 2, pp. 136~141 DOI: http://dx.doi.org/10.7316/khnes.2013.24.2.136 흡기관 분사식 수소 SI기관의 희박과급 적용에 관한 연구 이광주 1 ㆍ이종구 1 ㆍ이종태 2 1 성균관대학교
More information°Ç°�°úÁúº´5-44È£ÃÖÁ¾
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: * Strenghening the Cap
Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.27-43 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.27 * Strenghening the Capacity of Cultural Arts Required in Special Education
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More informationca_02.hwp
SPSPSPSP SPSPSPS SPSPSP SPSPS SPSP SPS 공기청정기 항균필터 SPS - KACA009-139 한국공기청정협회 2002년 12월 31일 제정 2016년 -월 -일 개정예정 http://www.kaca.or.kr 1.1 적용범위 이 표준은 에어필터로 공기중의 입자제거 및 미생물 제균 성능을 지닌 필터에 대하여
More information한수지 52(2), , 2019 Note Korean J Fish Aquat Sci 52(2), ,2019 국내유통김 (Porphyra sp.) 의미생물오염도평가 노보영 황선혜 1 조용선 1 * 한국식품연구원식품표준센터, 1 한국식품연구원식품분석
한수지 52(2), 80-84, 209 Note Korean J Fish Aquat Sci 52(2),80-84,209 국내유통김 (Porphyra sp.) 의미생물오염도평가 노보영 황선혜 조용선 * 한국식품연구원식품표준센터, 한국식품연구원식품분석센터 Microbial Contamination Levels in Porphyra sp. Distributed in
More information11¹ÚÇý·É
Journal of Fashion Business Vol. 6, No. 5, pp.125~135(2002) The Present State of E-Business according to the Establishment Year and the Sales Approach of Dongdaemun Clothing Market Park, Hea-Ryung* and
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More information- 1 -
발간등록번호 11-1541000-001345-01 전통된장의농가기업형대량생산 system 개발 - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23
More informationKor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More information서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소
2012 년도기초과학연구소 대학중점연구소심포지엄 마이크로파센서를이용한 혈당측정연구 일시 : 2012 년 3 월 20 일 ( 화 ) 14:00~17:30 장소 : 서강대학교과학관 1010 호 주최 : 서강대학교기초과학연구소 Contents Program of Symposium 2 Non-invasive in vitro sensing of D-glucose in
More information<BFACBCBCC0C7BBE7C7D02831302031203139292E687770>
延 世 醫 史 學 제12권 제2호: 29-40, 2009년 12월 Yonsei J Med Hist 12(2): 29-40, 2009 특집논문 3 한국사회의 낙태에 대한 인식변화 이 현 숙 이화여대 한국문화연구원 1. 들어가며 1998년 내가 나이 마흔에 예기치 않은 임신을 하게 되었을 때, 내 주변 사람들은 모두 들 너무나도 쉽게 나에게 임신중절을 권하였다.
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More information2) 소독제 본 연구에 사용한 소독제는 78% ethanol 스펀지와 1 : 100 으로 희석된 고준위 소독액 중 하나인 High level disinfectant (New Genn, England)이다. 2. 연구 방법 연구에 사용된 미생물학적 검사법은 식품의약품안전
ISSN (print) 1226-8496 J Korean Acad Pediatr Dent 40(4) 2013 http://dx.doi.org/10.5933/jkapd.2013.40.4.268 The Effectiveness of Clinical Sterilization Methods in Dental Air/water Syringes Seyoung Shin,
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information46(6)완결.indd
한수지 46(6), 689-695, 2013 Original Article Kor J Fish Aquat Sci 46(6),689-695,2013 가자미 (Verasper moseri Jordan et Gilberu) 식해의최적발효조건 ( 온도및염도 ) 한대원 1 한호준 김덕기 임미진 1 조순영 2* 강릉원주대학교식품과학과, 1 강릉원주대학교동해안해양생물자원연구센터,
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information04±èºÎ¼º
Introduction of Integrated Coastal Management Program and Sustainable Development of Fishing Villages in Cheonsu Bay Region* Boosung Kim** Abstract : Sustainable Development(SD) is an important concept
More informationJournal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI: * Suggestions of Ways
Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp.65-89 DOI: http://dx.doi.org/10.21024/pnuedi.29.1.201903.65 * Suggestions of Ways to Improve Teaching Practicum Based on the Experiences
More information- 1 -
- 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - μ μ - 13 - - 14 - - 15 - - 16 - - 17 - δ - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - A As S - 24 - - 25 - - 26 - - 27 - - 28 - μ
More informationECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Dec.; 27(12), 1036 1043. http://dx.doi.org/10.5515/kjkiees.2016.27.12.1036 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More information미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More information<4D F736F F F696E74202D20B3D2C4A1BFACBCE2B1B8B1D5C1F528BEC6C4EDBEC6C0CEC6F7292E >
넙치연쇄구균증의발생현황및대책 1. 서론 병리연구과권문경 우리나라의넙치양식은 1970년대후반부터종묘생산이시작되어 1986년도에제주도에서종묘생산기술개발을계기로육상양식이시작되었다. 1997년도에는 5,500톤을생산하였으며 ( 허등, 2001), 이후급속도로발전하여 2008년에는 46,432톤을생산함으로서 11년만에약10 배의생산량증가를이루었다. 양식산업이발전함에따라시설규모도소규모에서대규모로전환되고사육방법또한고밀도로사육하는경우가많아사육관리부주의등으로각종질병이발생되고있으며,
More information1. KT 올레스퀘어 미디어파사드 콘텐츠 개발.hwp
Journal of Next-generation Convergence Information Services Technology Vol.4, No.1, June (2015), pp. 1-8 차세대컨버전스정보서비스기술논문지 KT 올레스퀘어 미디어파사드 콘텐츠 개발 Media Fasade Contents Development of KT Olleh Square 김동조
More informationYI Ggodme : The Lives and Diseases of Females during the Latter Half of the Joseon Dynasty as Reconstructed with Cases in Yeoksi Manpil (Stray Notes w
497 의사학 제24권 제2호(통권 제50호) 2015년 8월 Korean J Med Hist 24 ː497-532 Aug 2015 c대한의사학회 http://dx.doi.org/10.13081/kjmh.2015.24.497 pissn 1225-505X, eissn 2093-5609 역시만필( 歷 試 漫 筆 ) 의 사례로 재구성한 조선후기 여성의 삶과 질병
More information- 2 -
- 1 - - 2 - - 3 - - 4 - μ μ μ μ μ μ μ α μ μ μ μ μ - 5 - μ μ μ μ - 6 - μ - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - μ μ μ α μ λ - 14 - μ μ μ μ μ - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22
More information(....).hwp
연구기관 한국식품연구원 농림부 연구기관 한국식품연구원 농림부 Analytical Semi-preparative Solution A 1) Solution B 2) Mixing Spreading Coating medium Corona treated OPP 3) film Casting Drying
More information한수지 51(1), 23-30, 2018 Original Article Korean J Fish Aquat Sci 51(1),23-30,2018 넙치 (Paralichthys olivaceus) 근육채취방법에따른 Kudoa septempunctata 진단효율비교 송준영
한수지 51(1), 23-30, 2018 Original Article Korean J Fish Aquat Sci 51(1),23-30,2018 넙치 (Paralichthys olivaceus) 근육채취방법에따른 Kudoa septempunctata 진단효율비교 송준영 정승희 1 최혜승 2 * 국립수산과학원남동해수산연구소, 1 국립수산과학원병리연구과, 2 국립수산과학원남해수산연구소
More informationAbstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More information04김호걸(39~50)ok
Journal of Environmental Impact Assessment, Vol. 22, No. 1(2013) pp.39~50 Prediction of Landslides Occurrence Probability under Climate Change using MaxEnt Model Kim, Hogul* Lee, Dong-Kun** Mo, Yongwon*
More information45권4호내지최종5.indd
Original Article 한수지 45(4), 367-37, 22 H-NMR 스펙트럼의다변량통계분석을통한넙치 (Paralichthys olivaceus) 의백신반응의지표물질분석 조지영 * 순천향대학교해양생명공학과 Multivariate Analysis on H-NMR Spectroscopy of Olive Flounder Paralichthys olivaceus
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More informationMBL fm
Microbiol. Biotechnol. Lett. (2017), 45(3), 250 256 pissn 1598-642X eissn 2234-7305 Microbiology and Biotechnology Letters 해양유래미생물을이용한어류질병세균에대한항균활성탐색 김동휘, 박소현, 김지현, 이해리, 허문수 * 제주대학교해양과학대학수산생명의학과 Received:
More information???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information02양은용
The filial piety of Won-Buddhism in the tradition of filial piety Yang, Eun-Yong Dept. of Korean Culture, Wonkwang University Keyword : Filial piety, Fourfold Grace, the grace of parents, Xiao Jing (),
More information개최요강
55 2009. 5. ( ) ( ) < > 1. 1 2. 2. 2. 3 1) 3 2) 3 3) GC-MS 4. 5 1) 5 2) 5 3) ICP-OES 6 3. 7. 7 1) 7 2) 10. 13 1) 1g 13 2),,, 14 3), 15 4),, 15 4. 17 19 < > [ 1] 2 [ 2] ICP-OES 6 [ 3] 13 [ 4] 1g 13 [ 5]
More information제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김 상 욱 이 수 형 이 상
6차 산업 수익모델 시범사업 농산물가공품개발 연구용역 최 종 보 고 서 영남대학교 식품공학과 연구책임자 : 한 기 동 제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김
More information01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education
More information<B3EDB9AEC1FD5F3235C1FD2E687770>
경상북도 자연태음악의 소박집합, 장단유형, 전단후장 경상북도 자연태음악의 소박집합, 장단유형, 전단후장 - 전통 동요 및 부녀요를 중심으로 - 이 보 형 1) * 한국의 자연태 음악 특성 가운데 보편적인 특성은 대충 밝혀졌지만 소박집합에 의한 장단주기 박자유형, 장단유형, 같은 층위 전후 구성성분의 시가( 時 價 )형태 등 은 밝혀지지 않았으므로
More information101~110 ¿õ´ã.¿ìȲ
101 DOI : 10.3831/KPI.2010.13.2.101 Received : 10. 05. 06 Accepted : 10. 05. 27 The Experimental Study on the Effect of Fel Ursi & Bovis Calculus Pharmacopuncture Solution in Bacterial Species which cause
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities
More information338 김승민ㆍ전려진ㆍ박명애ㆍ정현도ㆍ정준범 viral hemorrhagic septicemia (VHS) Scuticocilate,, cm, 1-3.,,.,, cohabitation test. 실험어 재료및방법 2010 (E03), 2011 (E06),
한수지 48(3), 337-345, 2015 Original Article Korean J Fish Aquat Sci 48(3),337-345,2015 제주도여윔증상넙치 (Paralichthys olivaceus) 로부터분리한점액포자충의특성분석 김승민 전려진 1 박명애 2 정현도 3 정준범 * 제주대학교해양의생명과학부, 1 제주대학교수산백신연구센터, 2 국립수산과학원수산생물방역과,
More informationAbstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie
Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung
More informationDBPIA-NURIMEDIA
J East Asian Soc Diet Life 27(3): 348 363 (2017) http://dx.doi.org/10.17495/easdl.2017.6.27.3.348 348 1 1 2 1 1, 2 Mixed Culture Characteristics of Fungi Strains isolated from Korean Traditional Nuruk
More information<31382D322D3420BDC5B1D4C8AF5FB3EDB9AE28C3D6C1BEBABB292E687770>
醫 史 學 제18권 제2호(통권 제35호) 2009년 12월 Korean J Med Hist 18ː57 72 18ː173-188 Dec. Dec. 2009 2009 C 大 韓 醫 史 學 會 ISSN ISSN 1225 505X 1225-505X 지방병 연구와 식민지배 : 1927년 영흥 및 해남지역 에메틴 중독사건을 중심으로 신 규 환* 1. 머리말 2. 일제의
More information한약재품질표준화연구사업단 작약 ( 芍藥 ) Paeoniae Radix 생약연구과
한약재품질표준화연구사업단 작약 ( 芍藥 ) Paeoniae Radix 생약연구과 - 2 - KP 11 CP 2015 JP 16 Paeoniae Radix Paeoniae Radix Alba Paeoniae Radix Rubra Paeoniae Radix Paeonia lactiflora Pallas paeoniflorin, albiflorin 2.3% Paeonia
More information10(3)-12.fm
w y wz 10«3y 273~280 (2010.12.) Journal of Korean Society of Urban Environment p yá xá½k w y œw (2010 9 15, 2010 12 2 k) Analysis of Characteristics of Delivered Nonpoint Source Pollution at Forested Watershed
More information