KOD FX Blend Taq -Plus- Crude Sample 또는 GC-rich Target과 같이 PCR이 어려운 샘플에 최적 높은 PCR 성공율 GC-rich 또는 crude sample(blood, bacteria, fungi, yeast 등)에서 높은 증폭
|
|
- 서용 탁
- 8 years ago
- Views:
Transcription
1 KOD -Plus- 높은 정확성과 증폭율로 Cloning에 적합한 PCR enzyme TOYOBO 겨울 할인 행사 Conventional PCR enzyme TOYOBO 대표 제품, KOD Polymerase란? PCR 관련 제품 20%할인 일본 코타카라섬(화산)에서 고온 미생물인 Thermococcus kodakaraensis로부터 추출한 고온 증폭 효소로 PCR 반응의 반복적인 100 조건에서 가장 안정적이라고 알려져 있음 Cloning 실험에 필수인 높은 정확성 Taq 의 약 80배의 PCR fidelity Hot-start PCR로 PCR specificity 향상 PCR 반응 buffer의 적정화로 증폭길이, 증폭효율 향상 우수한 내열성으로 GC-rich 샘플에 유리 KOD -Plus-로 PCR을 하면 Mutation 걱정이 없습니다! Colony number Mutation frequency (%) Total Mutant KOD -Plus- 10, A 社 High fidelity PCR enzyme 10, Pfu based 6, Taq 10, Obligatory anaerobic Heterotrophic nutrition 높은 Long Target PCR 성공률 GC-rich 샘플에서의 높은 증폭 효율 Evolutional family tree Kodakara island (Japan) KOD -Plus- High fidelity enzyme (Company B) M Intermittent spring [Yellowstone national park (USA)] 5 3 exonuclease activity에 강력한 5 exonuclease activity (proof reading)가 있어 잘못 가져온 염기를 제거하면서 합성 Taq 에 비해 약 80배 높은 정확성을 가지고 있어 정확한 DNA합성을 요구하는 실험에 적합 DNA 복제 속도는 약 130 base/sec로 Taq DNA pol.의 약 2 배 고효율 고속 PCR에 적합 KOD pol.의 Thumb 영역이 다른 효소에 비해 이완된 상태로 존재, 이러한 구조적인 특징으로 높은 증폭속도와 정확한 복제가 가능 일반 Taq 보다 80배 높은 정확성과 고효율 KOD -Plus- Neo KOD -Plus- KOD FX Pfu DNA Polymerase Long PCR enzyme (A company) Taq DNA Polymerase Mutation frequency (Number of misincorporated bases/100,000 bases) Thermococcus kodakaraensis KOD1 Growth temperature : 60~100 Optimum : 85 KOD 의 특징에 따른 두 가지 라인업 3.6 kb 2.8 kb 1.3 kb 0.6 kb Target : Human β-globin gene Reaction condition : see typical reaction setup Sample : Plasmid clone 50 ng / 50 μl reaction Cycling condition : 94 : 2 min 98 : 10 sec Tm-5 : 30 sec 30 cycles 68 : 1 min. kb 1 : human β-globin 0.6 kb 2 : human β-globin 1.3 kb 3 : human β-globin 2.8 kb 4 : human β-globin 3.6 kb 2 kb Target : Lipase gene (Pseudomonas sp.) [GC=70%] Reaction condition : see typical reaction setup Sample : Plasmid clone 10 ng / 50 μl reaction Cycling condition : 94 : 2 min 98 : 10 sec 60 : 30 sec 30 cycles 68 : 2 min 1 : KOD -Plus- 2 : Taq 3 : Taq + 5% DMSO 4 : Taq + PCR enhancer (company A) 5 : High efficient Taq (company B) M : 200 bp Ladder Markers 높은 효율의 신장력 40 sec 60 sec KOD Pfu Taq 90 sec 120 sec 60 sec 90 sec 120 sec 150 sec 60 sec 90 sec 120 sec 150 sec
2 KOD FX Blend Taq -Plus- Crude Sample 또는 GC-rich Target과 같이 PCR이 어려운 샘플에 최적 높은 PCR 성공율 GC-rich 또는 crude sample(blood, bacteria, fungi, yeast 등)에서 높은 증폭율 보임 High specificity anti-kod antibody를 포함하여 hot-start PCR 가능 긴 target PCR 가능 (~24 Kb) 정확성 : 기존 Taq 보다 낮은 PCR error률 높은 PCR 증폭율로 다양한 목적의 PCR에 범용으로 사용할 수 있음 일반 Taq과 Pfu로 대표되는 proofreading 기능의 효소를 최적의 비율로 blending한 제품 일반 Taq보다 높은 정확성을 가지면서도 증폭 효율은 향상 미량의 template (5 ng)도 효율적 증폭 Blend Taq -Plus-는 anti-taq antibody를 포함하여 hot-start PCR에 적합 TA-cloning kit을 이용하여 cloning 가능 복잡한 전처리 과정없이 훌륭한 PCR 결과를 내주는 KOD FX 일반 Taq DNA Polymerase에 비해 3~4배 낮은 Error-rate Long Target 증폭에 유리한 Blend Taq Series Mouse Sample Processing Mouse tail (ca 3 mm) 50 mm NaOH 180 μl Vortex well 95 for 10 min 1 M Tris-HCl(pH8.0) 20 μl Vortex well 12,000 rpm, 5 min Supernatant 0.5~2 μl PCR Transfer to microtube Crude Mouse Tail Lysate로부터의 증폭 Plant Sample Processing Transfer to microtube Buffer A 100 μl Vortex for 10 min Vortex well Refference:BioTechniques, 19:394 (1995) Leaf (3 x 3 mm) / Rice grain Buffer A : 100 mm Tris-HCl (ph9.5) 1 M KCl 10 mm EDTA Left : Rice leaf Right : Rice grain Supernatant 1 μl PCR Plant Tissue Lysate로부터 rcbl 유전자의 증폭 (lacking proofreading activity) Missincorporation Pausing (lacking proofreading activity) (having proofreading activity) Repairing (lacking proofreading activity) Quick Taq TM HS Dye Mix Quick Taq HS DyeMix* Primers PCR-grade water High efficient Taq Blend Taq Blend Taq -Plus- (Company A) M M M M M M M : 1 kb Ladder Marker 1 : β-globin 1.3 kb 2 : β-globin 2.7 kb 3 : β-globin 3.6 kb 4 : β-globin 17.5 kb 5 : β-globin 23.0 kb Sample : Human genomic DNA, Target : β-globin gene Loading Dye (BPB)를 포함하고 Hot-start PCR 가능한 2X Hot-start Taq Master Mix Cycling comdition : 94, 2 min. 94, 30 sec. 60, 30 sec. 72, 1 min./kb 30 cycles 2x master mixture로, primer와 template만을 넣어 바로 PCR 가능 일반 Taq 보다 높은 PCR효율 Hot-start Taq : anti-taq antibody가 포함되어, 높은 sensitivity와 specificity 보임 30회 이상의 freeze-thaw 및 4 에서 3개월간 안정성 보장 Crude sample (colony)에서 직접 PCR 가능 KOD Neo Series Elongation enhance의 첨가에 의해 Plateau effect 를 억제하여 20 cycles 이후에도 증폭효율 향상 특히 long target의 증폭효율이 큰 폭으로 향상하였고 빠른 증폭속도 (30sec/kb) 실현 Plateau effect 란? 일반적으로 PCR반응에서 20 cycles 이후, 기질이 모두 소모되거나 열에 의한 효소의 activity 감소, 부산물에 의한 효율억제 등 다양한 요인에 의해 증폭 산물이 더 이상 증가하지 않는 현상 Add sample (DNA solution, colony etc.) PCR (Hot-start) Directly Electrophoresis 간편하지만 강력한 증폭 효율 BTQ-101 Blend Taq 250 U (500rxns, 20 μl 기준) 102,480 BTQ-201 Blend Taq -Plus- 250 U (500rxns, 20 μl 기준) 112,560 DTM-101 Quick Taq HS DyeMix 1.25 ml x 2 (250rxns, 20 μl 기준) 88,000 KFX-101 KOD FX 200 U (500rxns, 20 μl 기준) 216,000 KFX-201 KOD FX Neo 200 U (500rxns, 20 μl 기준) 216,000 KOD-201 KOD Plus 200 U (500rxns, 20 μl 기준) 161,920 KOD-401 KOD Plus Neo 200 U (500rxns, 20 μl 기준) 143,680 M Template : Human Genomic DNA (50 ng/50 μl reaction scale) M : 1 kb ladder 94, 2 min. 1 : Quick Taq TM HS DyeMix 2 : rtaq (Hot-start) 94, 30 sec. 2.9 kb 3 : rtaq DNA polymerse 60, 30 sec. 4 : C 社 Taq Master Mix 68, 3 min. Forward Primer : AATGGATGATTTGATGCTGTCCC Reverse Primer : ATAAGAGCTCCCAAGACTTAG Final concetration : 2 µm 40 cycles
3 Mutagenesis Product Cloning Product KOD -Plus- Mutagenesis Kit Ligation high Ver.2 KOD -Plus- Enzyme을 이용한 Inverse PCR (ipcr) 기법의 간단하며 정확한 Site-directed Mutagenesis Kit 기존 Taq 보다 정확성이 80배 높은 TOYOBO의 KOD -Plus- PCR enzyme을 사용하여 PCR error-rate를 최소화하면서 유전자의 삽입, 삭제를 수행 최대 95%의 mutation 효율 최대 11 kb large-size plasmid의 유전자 변이 가능 3 step으로 transformation까지 완료 간편한 Ready-to-Use 타입의 고효율성 Ligase 신속성 : 5~30분내 ligation 완료 편리성 : 동결되지 않아 바로 사용 가능 A - attachment mix (TOTAK - 301)을 병용하여 사용함으로서 Blunt-End의 PCR 산물도 A-tailing을 통해 TA vector에 넣을 수 있음 Cohesive, blunt 또는 overhang DNA fragments에 효과적 치환 삭제 삽입 Purified PCR Products을 이용한 TA Cloning Unpurified PCR Products을 이용한 TA cloning Template Plasmid Workflow Template (Plasmid) Template A B PCR Primer x Mutation Methylated site Inverse PCR (5~10 cycles ) <0.5~2hr> PCR products Digestion of the template plasmid by Dpn I <37 1hr> TArget Clone -Plus- 간편한 Ready-to-Use 타입의 고효율성 Ligase Purification 하지 않은 PCR산물 바로 사용가능 고효율의 ligase에 의해 5분만에 간편하게 cloning 완료 TArget Clone -Plus-의 경우, A-attachment mix가 포함되어 blunt PCR 산물에도 사용 가능 PCR products are not digested by Dpn I. DpnI digests methylated sites. C Mutant D Transform E.coli Self-ligationof PCR products (Kinase / Ligase) <16 1hr> KOD -Plus-와 Blend Taq을 이용한 500 bp PCR Product의 TA Cloning Cloning efficiency (%) TArget Clone TArget Clone -Plus- SMK-101 KOD-Plus-Mutagenesis kit 20rxns 225,840 LGK-201 Ligation high Ver.2 100rxns 143,680 TAK-201 Target Clone -Plus- 10rxns 96,480
4 Real-time PCR Real-time PCR Master Mix / SYBR Green Real-time PCR Master Mix & Plus- 2x Master Mix의 Ready-to-Use Solution, Hot-start System Roche Light cycler에 사용 가능 (optimized protocol 제공) Life Technologies ABI PRISM에 사용 가능 (optimized protocol 제공) 용도 : SYBR Green I을 이용한 intercalation assay SYBR Green Realtime PCR Master Mix TaqMan Assays 또는 hybridization probe assay Realtime PCR Master Mix THUNDERBIRD TM SYBR / Probe qpcr Mix 고효율의 2X Master Mix Solution (Rox Dye (50X) 별도 구성) 특허 출원 PCR enhancer로 target의 PCR efficiency 대폭 증가 적은 양의 target도 detection 가능하며 dimer가 증폭되지 않음 대부분의 real-time PCR cycler에 적용 가능 Anti-Taq antibody 포함으로 hot-start PCR 가능 용도 : SYBR Green I을 이용한 intercalation assay THUNDERBIRD SYBR qpcr Master Mix TaqMan assay 또는 hybridization probe assay THUNDERBIRD probe qpcr Master Mix Melting Curve 분석 결과, 높은 Specifity로 실험의 재현성을 높임 SYBR Green I의 Specificity 비교 (기기 : ABI 7900HT) Amplification curve Melting curve SYBR Green Realtime PCR Master Mix (TOYOBO) THUNDERBIRD SYBR qpcr Mix Company A Company A Delaying of the rising point 가능한 PCR 기기 Company B Dispersion of end points Company B Delaying of the rising point 정확한 결과 : Serial Dilution을 통한 테스트 결과 Generation of primer dimers Applied Biosystems Bio-Rad Roche Stratagene TaKaRa ABI PRISM 7000/7700 ABI 7300/7500 ABI 7900HT ABI Step One CFX96 Mini Opticon LightCycler 1.x/2.0 LightCycler 480 Mx3005P Mx4000 Thermal Cycler Dice Amplification curve on TaqMan assay (ABI PRISM 7700) Template : total RNA (5 M dilution : 6.4 ng~100 μl) Target : β-actin mrna Cat. No. 품 명 용 량 행사가(원) QPK-101 Realtime PCR Master Mix 1 ml x 5 (500rxns-20ul기준) 232,000 QPK-201 SYBR Green Realtime PCR Master Mix 1 ml x 5 (500rxns-20ul기준) 232,000 QPS-101 THUNDERBIRD Probe qpcr Mix 1.67 ml x 3 (500rxns-20ul기준) 224,000 QPS-201 THUNDERBIRD SYBR Green qpcr Mix 1.67 mll x 3 (500rxns-20ul기준) 224,000
5 Protein Research Can Get Signal 기존 Antibody Reaction Buffer(TBS-T 또는 Bloking Reagents) 대신 사용하는 새로운 조성의 Immunoreaction Enhancer Solution Buffer Signal-to-noise가 개선되어, signal 증폭 효과 폭넓은 적용범위 : Western Blot, Dot Blot, ELISA 등 간편한 사용법 : ready-to-use ECL system과 함께 사용 Can Get Signal Immunostain 기존 Antibody Reaction Buffer 대신 사용하는 새로운 조성의 Immunoreaction Enhancer Solution Buffer Antigen-antibody reaction 향상으로 sensitivity 향상 용도 : immunohistochemistry (IHC), immunocytochemistry, chemogenetic, fluorescent assay 조직 세포에 적용 가능 파라핀 절편 동결 절편에 적용 가능 일반 세포 형광염색에 적용 가능 Signal은 높게, Background는 낮게 도출된 결과 Conventional Conventional Can Get Siganl (TBS-T) Can Get Siganl (TBS-T) p-akt p-erk1 p-erk2 Sample : Cultured bovine adrenal medulla cells 1. Control (H2O) 2. Insulin (1 nm, stimulated for 5 min) 3. Insulin (10 nm, stimulated for 5 min) 4. Insulin (100 nm, stimulated for 5 min) Western Blot, ELISA용 Can Get Signal 결과 HRP tagging Ab 및 Fluorescent tagging Ab에 모두 사용할 수 있음 현재 사용하는 blocking solution 및 detection reagent를 변경할 필요 없음 S2 cell에서의 α-tubulin detection 결과 파라핀조직을 사용한 CD133 detection 결과 Prestained Marker Samples RT-1 h RT-1 h RT-1 h Cat. No. 품 명 용 량 행사가(원) NKB-101 Can Get Signal Immunoreaction Enhancer Solution 250 ml x 2 289,200 NKB-401 Can Get Signal Immunostain Starter Set 5 ml x 2 104,720 SDS-PAGE Transfer Blocking Primary antibody Secondary antibody Detection Solution 1 Solution 2 Can Get Siganl
6 cdna synthesis kit 할인 품목 리스트 ReverTra Ace -α- Kit High Quality cdna 합성을 위한 편리성과 고효율성을 지닌 RT Kit ReverTra Ace(기능이 향상된(M-MLV) RTase) 이용 Reverse transcription에 필요한 모든 components 포함 14 kb 이상 긴 길이의 cdna 합성 가능 생성된 cdna는 purification없이 바로 PCR 가능 용도 : cdna synthesis, RT-PCR용 ReverTra Ace 효소의 구조 및 기능 d 경쟁사 비교 높은 cdna 합성 효율 A B C 온도에 따른 효율 비교 A : ReverTra Ace B : Reverse Transcriptase (Company A) C : Reverse Transcriptase (Company B) 제품군 품 번 품 명 용 량 행사가 (원) 일반 PCR Cloning 관련제품 BTQ-101 Blend Taq 250U 102,480 BTQ-201 Blend Taq -Plus- (500 rxns, 20 μl 기준) 112,560 DTM-101 Quick Taq HS DyeMix 1.25 ml x 2 88,000 KFX-101 KFX-201 KOD FX KOD FX Neo 200U (500 rxns, 20 μl 기준) 216,000 KOD-201 KOD Plus 200U 161,920 KOD-401 KOD Plus Neo (500 rxns, 20 μl 기준) 143,680 LGK-201 Ligation high Ver rxns 143,680 TAK-201 Target Clone -Plus- 10 rxns 96,480 SMK-101 KOD-Plus-Mutagenesis kit 20 rxns 225,840 ReverTra Ace qpcr RT Kit 잘 발현되지 않는 유전자의 확인 Real-time PCR을 위한 cdna 합성용 Kit 최적화된 RT buffer와 primer mix로 고효율의 reverse transcription 가능 RNA를 제거하는 추가 RNase H treatment step이 포함되지 않아 15분 내 모든 실험 완료 희귀 유전자 발현 검출에 적합 합성된 cdna를 PCR reaction volume의 20%까지 넣을 수 있음 정량PCR enzymes cdna 합성 kit Can Get Signal QPK-101 QPK-201 QPS-101 QPS-201 Realtime PCR Master Mix SYBR Green Realtime PCR Master Mix THUNDERBIRD Probe qpcr Mix 1.67ml x 3 THUNDERBIRD SYBR Green qpcr Mix 1 ml x 5 (500 rxns, 20 μl 기준) 232,000 (500 rxns ~ 20 μl 기준) 224,000 FSK-101 ReverTra Ace -a- 200 rxns 320,000 FSQ-101 ReverTra Ace qpcr RT kit 100 rxns 280,000 NKB-101 NKB-401 Can Get Signal Immunoreaction Enhancer Solution Can Get Signal Immunostain Starter Set 250 ml x 2 289, ,720 VAT는 별도 입니다. x : not detected FSK-101 ReverTra Ace -a- 100rxns 320,000 FSQ-101 ReverTra Ace qpcr RT kit 200rxns 280,000 비엠에스 서울 ㅣ 강남구 역삼로 7길 22 BMS 빌딩 Tel l Fax 비엠에스 대전 ㅣ유성구 계룡로 141길 B station Tel l Fax
TOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme
PCR Enzyme 부터 qpcr 까지! PCR 실험은 TOYOBO 로해결하세요! 행사기간 : 7 월 15 일 ~ 9 월 13 일까지 TOYOBO Reagent PCR Enzyme High Quality PCR Enzyme cdna Synthesis Kit qpcr One-step RT Kit Immunoreaction Enhancer Solution 추가
More information고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn
TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna
More informationPCR DNA Polymerase 선택가이드 일반적인 PCR 실험 Blend Taq / Blend Taq -Plus- Repairing 일반 DNA polymerase와 proofreading 기능의효소가섞인제품 Taq polymerase 보다 3~4 배낮은 error
TOYOBO HOT SUMMER BIG SALE 행사기간ㅣ 2015 년 6 월 22 일 ~ 8 월 28 일까지 2+1 PCR DNA Polymerase cdna Synthesis Kit ㅣ KOD Series ㅣ Blend Taq Series ㅣ Quick Taq HS DyeMix ㅣ ReverTra Ace Series 플러스혜택 Set 구매시, 최대 45%
More informationReverTra Ace cdna Synthesis Kit d ReverTra Ace M-MLV RTase의 RNase H domain 부위에유전자조작을시켜, Rnase H activity를낮추어 mrna의 degradation을방지하여 cdna 합성효율을높임 Long
2016 TOYOBO SUMMER SALE 2016.7.4 ~ 9.9 cdna Synthesis Kit qpcr Master Mix KOD Polymerase Enzyme DNA Polymerase Enzyme Immuno Enhancer ReverTra Ace cdna Synthesis Kit d ReverTra Ace M-MLV RTase의 RNase H
More informationDNA Polymerase Enzyme Quick Selection Guide for Effective PCR DNA Polymerase High Quality Polymerase General PCR / Colony PCR High Fidelity PCR (80-fo
2018 TOYOBO BIG SALE 기간 : 2018년 7월 16일 ~ 9월 21일까지 TOYOBO 전제품 최대 33% SALE PCR Enzyme cpcr Enzyme cdna Synthesis cdna Synthesis Kit qpcr Enzyme One-Step / Two-Step Kit Immuno Enhancer High Quality Enzyme
More information2019 TOYOBO BIG SALE 기간 : 2019년 7월 1일 ~ 9월 11일까지 최대 33% SALE qpcr Enzyme PCR Enzyme 20% 2+1 cpcr Enzyme cdna Synthesis 2+1 cdna Synthesis kit High Qua
2019 TOYOBO BIG SALE 기간 : 2019년 7월 1일 ~ 9월 11일까지 최대 33% SALE qpcr Enzyme PCR Enzyme cpcr Enzyme cdna Synthesis cdna Synthesis kit High Quality Enzyme Immuno Enhancer Cloning One-Step kit Can Get Signal
More informationITEM 1 PCR Enzyme 20% DNA Polymerase Enzyme Quick Selection Guide for Effective PCR DNA Polymerase General PCR / Colony PCR Long PCR (Max. 23 kb) Hot
2017 Summer BIG SALE 2017.7.3 ~ 9.8 ITEM 1 P C R Enzyme cpcr Enzyme 20% High Quality Enzyme ITEM 2 cdna Synthesis cdna Synthesis Kit 최대 33 % off ITEM 3 q P C R Enzyme Two-Step / One-Step Kit NGS Library
More information슬라이드 1
TAKARA 1. PCR 2. qpcr 2014. 02. 13. 최유미 DNA? DNA 생물체 > 기관 > 세포 >DNA DNA (Deoxyribonucleic acid) 세포내에서생물의유젂정보를보관하는물질 구성 : Adenine, Thymine, Cytosine, Guanine 종특이적, 개체특이적 PCR (Polymerase Chain Reaction)
More informationCloning
Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군
More informationSlide 1
PrimeScript 1st strand cdna Synthesis Kit 1 Central Dogma replication transcription 0 processing translation 오늘의내용은? 조직추출 RNAiso Plus 5 mrna 우리가관심있는 mrna가차지하는비율이극히일부이기때문에관심있는 mrna를증폭해서그것을눈으로확인할정도로만들어주는것이다.
More informationSpring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No ) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터
Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No. 50004) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터 (학술/제품문의) 02-2081 - 2510 www.takara.co.kr support@takara.co.kr
More informationDNA/RNA Amplification Overview AccuPower PreMix series 는세계적으로기술력을인정받은특허기술로보다경제적인가격과편리한방법으로실험할수있는제품입니다. Conventional PCR, Real-Time PCR 수행을위한 DNA ampli
DNA Amplification RNA Amplification Real-Time PCR Customized PCR DNA/RNA Amplification Phone: 1588-9788 (ext.4->2) Email: accupower-support @bioneer.co.kr DNA/RNA Amplification Overview AccuPower PreMix
More information실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양
실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양의시료를대량으로증폭할수있다는장점과그과정이간단하여 Cloning, Sequencing 등의기본기술로응용되었다.
More informationSelection chart of Bioneer s cdna synthesis products Categories Application Product cdna Synthesis Kits One step RT-PCR Kits One step RT-qPCR Kits RTa
Selection chart of Bioneer s cdna synthesis products Categories Application Product cdna Synthesis Kits One step RT-PCR Kits One step RT-qPCR Kits RTase 표준 cdna 합성 높은효율의 cdna 합성 복잡한 2 차구조 RNA 의 cdna 합성
More information3월 온라인 교육
2013 년 2 분기대리점집체교육 - Protein - Takara Korea Biomedical Protein Workflow Chapter 1: 샘플준비 Chapter 2: Electrophoresis -Precast gel (Lonza/NuSep) -ProSieve EX running buffer -Protein marker Chapter 3: Staining
More informationAutomated high multiplex qPCR platform for simultaneous detection and quantification of multiple nucleic acid targets
PCR FlashGel System 2013. 04. 24 PCR 2013. 04. 24 순서 1. PCR 이란 2. PCR 실험의기본조건 3. PCR 효소선택가이드 4. Hot Start PCR의원리 5. PCR 실험시 Troubleshooting 6. PCR 장비 _TP350 소개 PCR(Polymerase Chain Reaction) PCR 이란? -
More informationSurpass the limit of Polymerase Chain Reaction (PCR) PCR Enzyme Guide High Fidelity PCR 효소 범용적인 PCR 효소 특수목적을위한 PCR 효소 - Epigenetics - Multiplex PCR -
Surpass the limit of Polymerase Chain Reaction (PCR) PCR Enzyme Guide High Fidelity PCR 효소 범용적인 PCR 효소 특수목적을위한 PCR 효소 - Epigenetics - Multiplex PCR - Direct PCR High Fidelity PCR 효소 - NGS targeted sequencing,
More informationMicrosoft Word - Genolution RNAi Manual.doc
1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000
More information항체 포털 서비스 Preparation Peptide 총 4주 소요 / 473,000 ~ 511,000 Free of charge 2~3 days 243,000 ~ 281,000 의뢰서 작성 Peptide epitope prediction 유전자 정보
Preparation Service AbFrontier Custom service 장점 실험 담당자와의 원활한 1:1 커뮤니케이션 (신속한 feedback을 통한 맞춤형 제작 서비스) 고객연구센터 - 개별 서비스의 진행 상황 및 결과 즉시 확인 http://center.abfrontier.com (e-mail & SMS 전송) 회원제 -연구자의 프로젝트 보안
More informationmau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
More information슬라이드 1
Real Time PCR 목차 1. PCR 및 Real Rime PCR 원리 2. Real Time PCR 검출방법 3. Real Time PCR 정량방법 4. Takara Real Time PCR 시약 5. 금일실험내용 Polymerase Chain Reaction Taq DNA Polymerase - Thermostable DNA polymease from
More information슬라이드 1
EVENT 퀴아젠인기상품연말특별가전 200203 Top Taq DNA Polymerase (250U) 90,000 72,000 200205 Top Taq DNA Polymerase (1000U) 331,000 281,350 200403 Top Taq Master Mix Kit(250U) 104,000 83,200 201203 Taq DNA Polymerase
More informationCloning=Clontech In-Fusion Cloning
Cloning 을위한모든것 2014-06-18 다카라코리아바이오메디칼 Contents Cloning Restriction Enzyme General Restriction Enzyme QuickCut Restriction Enzyme Cloning Restriction Enzyme/Ligation TA Cloning In-Fusion Cloning TaKaRa
More informationPierce-Plus-Alpha.pdf
Save 40% on antibodies Primary antibody 전제품 40% 할인가로만나보세요 Count on Invitrogen 42,000 antibodies highly validated primary and secondary antibodies in our portfolio and growing 4,500 primary conjugated antibodies
More information01 Cloning AccuRapid Cloning Kit NEW 3 Gene Cloning Service 4 AccuPower Ligation PreMix 6 T4 DNA Ligase 7 Thermostable Thermus filiformis (Tfi) DNA Li
Cloning DNA Amplification DNA Preparation Cloning (Cloning Kit & Gene Cloning Service) Phone: 042-930-8793 Email: genesynthesis-support@bioneer.co.kr Cloning (Ligase) Phone: 1588-9788 (ext.4->2) DNA Amplification
More informationVer.4 (KR) All about RT (cdna Synthesis) 8-11 Munpyeongseo-ro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea) (Internatio
20170619 Ver.4 (KR) All about RT (cdna Synthesis) 8-11 Munpyeongseo-ro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea)1588-9788 (International) +82-42 - 930-8777 Email: sales@bioneer.com Selection
More informationSMARTer 시리즈
SMARTer 시리즈 SMARTer Solutions 2014.12.17 다카라코리아바이오메디칼 SMART 하게실험하고 SMARTer 한결과를얻는방법 Clontech SMARTer 시리즈 Contents 1. Introduction 1. 역전사반응이란? 2. 기존역전사반응의한계 2. SMARTer 시리즈 1. SMARTer 란? 2. SMARTer 시리즈와적용
More information뉴스지14호-칼라
2 3 4 5 6 TaKaRa Taq TM / TaKaRa Ex Taq TM / TaKaRa LA Taq TM / Pyrobest TM DNA Polymerase/ TaKaRa Z -Taq TM TaKaRa Taq TM TaKaRa Ex Taq TM TaKaRa LA Taq TM TaKaRa Z-Taq TM Pyrobest TM DNA Polymerase 7
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More information미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
More informationVer.3(KR) All about Real-Time PCR 8-11, Munpyeongseoro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea) (International) +
20170402 Ver.3(KR) All about Real-Time PCR 8-11, Munpyeongseoro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea) 1588-9788 (International) +82-42 - 930-8777 Email: sales@bioneer.com Real-Time
More information2018-09-11 Ver.4 (KR) 8-11, Munpyeongseo-ro, Daedeok-gu, Daejeon, 34302, Republic of Korea Tel: (Korea) 1588-9788 (International) +82-42-930-8777 Email: sales@bioneer.com Real-Time PCR Reagents Selection
More informationcdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR
RT-PCR 법 II. 역전사효소반응 ( 주 ) 다인바이오연구소 현재분자생물학분야에서 RNA 수준의 gene expression ( 유전자발현 ) 과 cdna (complementary DNA) cloning에널리이용되고있는 RT-PCR (Reverse transcription ploymerase chain reaction) 은생명정보가 DNA에서 RNA로전달된다는분자생물학분야의
More informationDBPIA-NURIMEDIA
Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun
More informationWestern Blot Consumable Best Seller Protein Standards Dual Color All Blue Kaleidoscope TM Dual Xtra Prestained Ch
2018 년 4 월 16 일 ~ 6 월 15 일까지 2018 비엠에스할 인 행 사 AbD Serotec 이 Bio-Rad 와하나가되었습니다. 10,000 여종의 Primary Antibody 를검색해보세요! Western Blot 장비 & 시약 5+2 증정 Western Blot Consumable Best Seller - Protein Standards -
More information2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.
2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.8.1. OIE 2012 ver. - EU ASF reference lab CISA-INIA(Spain)
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
More informationEZ-Cloning kit
EZ TM 5 /3 RACE PCR Kit Instruction Manual Korean Ver. Kit for 10 reactions Cat.# EZ025 EZ TM 5 /3 RACE PCR Kit Table of Contents I. 제품설명... 3 II. 원리... 4 III. 제품구성... 7 IV. 염기서열정보... 8 V. 주의사항... 8 VI.
More information증정 Bio-Rad 가제안하는 FAST Western Blot! FAST Western Blot 기존 acrylamide/bis solution FastCast TM TGX acrylamide solution Gel 준비 (Gel solution 준비 - casting
Bio-Rad 연말할인행사 기간 : 2015 년 10 월 19 일 ~ 12 월 18 일까지 FAST Western Blot Best Western Blot 을위한시약 & 소모품 Real-Time PCR Reagents 행사제품 400 만원이상구매시, Integra PIPETBOY ACU 증정 ( 색상랜덤 ) 증정다양한 application 에따라흡입 / 분주속도조절가능
More information뉴스레터6호F?2??訝
February 2009 No.06 Roche Diagnostics Korea Co., Ltd. Focus Tech EDITORIAL February 2009 No.06 Contents Editorial 03 Focus 04 Product 10 Talk 12 Tech 14 Activity 19 Style 22 February 2009 No.06 02 03 FOCUS
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More information슬라이드 1
New PCR Instruments 2013. 2. 21 다카라코리아바이오메디칼 Agenda FAST PCR이란? New FAST PCR Instrument _ TP450 New PCR Instrument _ TP350 기기캠페인소개 PCR FAST 관련 PCR 제품관련제품 최고수준의정확성 & 최고의신장속도 ( 신장성 5sec/kb) PrimeSTAR Max
More informationMHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State
More information김도희_HT protein expression 표준 보고서_v1.5
Production of Recombinant Proteins For Further Information, Please Contact Neurogenex Co., Ltd. Biotechnology Incubating Center "Golden Helix" Seoul Natl' Univ. Seoul 151-744, Korea TEL 82-2-875-8998 FAX
More information성공적인 Western Blot 을위한 Total Solution 기간 : 2013 년 4 월 22 일 ~ 6 월 14 일 Mini-PROTEAN Tetra & Power Supply 구매시, 전기영동 Plastic 소모품, Acrylamide/Bis Solution
성공적인 Western Blot 을위한 Total Solution 기간 : 2013 년 4 월 22 일 ~ 6 월 14 일 Mini-PROTEAN Tetra & Power Supply 구매시, 전기영동 Plastic 소모품, Acrylamide/Bis Solution TGX Gel 6 box 구매시, 전기영동장치 LaboGene tube 50 ml 1 box
More informationThermal Cycler Dice Real Time System II
Real Time System II www.takara.co.kr 높은정량성과재현성및신속성을기반으로하는 Real Time PCR은유전자발현해석및유전자검사에최적인방법입니다. 다파장모델 (Multi-Channel) 다카라바이오에서는 Real Time PCR용시약이나프라이머 (Perfect Real Time Support System) 와함께 96 well plate
More informationSMARTer Sequencing Kits for Next Generation Sequencing
Simple, Fast, Powerful SMARTer Solution for NGS 다카라코리아바이오메디칼 1 페이지 표지분석 NGS Library 제작시의어려움을, SMARTer 기술로극복! FFPE Sample 과같은 Low input, degraded RNA 로부터 Sequencing 을가능하게! Single Cell sample 로부터 Library
More informationSample Preparation SureBeads TM Magnetic Beads for Immunoprecipitation Protein A 나 Protein G 가결합된형태의 Magnetic Bead + Magnetic Rack System Centrifugati
2016 비엠에스 연말할인행사 2016 년 10 월 17 일 ~ 12 월 16 일까지 Western Blot 장비 / 시약특별이벤트 PCR/qPCR 시약 / 소모품특별이벤트 1 Sample Preparation SureBeads Protein 정량시약류 /HOT DEAL/ Protein Marker Reverse Transcription iscript cdna
More informationProtein Gel TGX TM Stain-Free Fast Cast Acrylamide Kit Resolving, stacking gel 을별도로굳히지않고한번에 casting UV 하에단백질전체량 detection 가능 Stain-Free 란? 별도염색과정 (Coo
2017 비엠에스 할인행사 행사기간 : 2017년 4월 24일 ~ 6월 23일까지 300만원이상구매시 VELP Vortexer CLASSIC Vortex mixer Protein Gel Protein 정량 / IP 시약 Antibody Western Blot Buffer 소모품 500 만원이상구매시 VWR Heat Block or Manual Pipette
More informationChapter 4. Bacteria (the first microbes)
- DNA 정제후클로닝을위한효소적절단과연결필요 -> restriction enzyme, ligase 가중요 1. DNA 조작효소범위 - 촉매반응에따라 5 분류 1. Nuclease : 핵산분자의절단, 단편화 2. Ligase : 핵산분자의연결 3. Polymerase : DNA 사슬합성 4. Modifying enzyme : 화학기능기의첨가, 제거 5. Topoisomerase
More informationCelebrate DNA milestones & innovations 1953, Rosalind Franklin는 X-ray의 회전 굴절 모양에 대한 연구를 하였으며 이를 기반으로 James Watson과 Francis Crick는 DNA의 구조에 대한 논문을 발표 하
Celebrating 60 years in DNA Discovery 다양한 할인 혜택을 만나보세요 행사 기간 : 2013년 5월 20일부터 2013년 6월 28일까지 lifetechnologies.com/dna60 1 Celebrate DNA milestones & innovations 1953, Rosalind Franklin는 X-ray의 회전 굴절 모양에
More information01 Automated Protein Expression and Purification: ExiProgen Selection Guide 3 Protein Synthesis Kit ExiProgen EC Protein Synthesis Kit 4 ExiProgen EC-
Automated Protein Expression and Purification: ExiProgen TM Manual Protein Expression and Purification: AccuRapid TM & MagListo TM Preparation of Template DNA for Protein Expression Protein Service Protein
More information01 Automated Protein Expression and Purification Using ExiProgen Selection Guide 267 ExiProgen EC Protein Synthesis Kit 268 ExiProgen EC-Maxi Protein
Automated Protein Expression and Purification Using ExiProgenTM Manual Protein Expression and Purification Preparation of Template DNA for Protein Expression Protein Service Protein Expression and Purification
More information316 Research in Plant Disease Vol. 21 No. 4, (Seo, 2009). Enzyme-Linked Immuno Sorbent Assay(ELISA) Reverse Transcription- Polymerase Chain Reaction(R
식물병연구 Research Article Open Access Res. Plant Dis. 21(4) : 315-320(2015) http://dx.doi.org/10.5423/rpd.2015.21.4.315 Reverse transcription Loop-mediated isothermal amplification Soybean mosaic virus Detection
More informationc04....
플라스틱뉴스 _ 겨울 발행인 편집인 발행처 주 소 전 화 팩 스 방한홍 한화케미칼 대전광역시 유성구 가정로 76 042/865/6400 042/861/2611 인쇄처 학예 COM. 전 화 042/625/1821 인 쇄 2012. 12. 발 행 2012. 12. 등록번호 서울 바 00407호 등 록 1972. 5. 20 본지는 한국도서잡지윤리위원회의 실천요강을
More information2011 I Summer PLASTICS news HANWHA CHEMICAL CORPORATION http://hcc.hanwha.co.kr CONTENTS 04 10 31 45 70 74 85 2011 SUMMER 3 2011 Summer HANWHA NEWS 4 PLASTICS NEWS 2011 SUMMER 5 2011 Summer HANWHA NEWS
More informationDBPIA-NURIMEDIA
Original Article Journal of Apiculture 31(1) : 41~50 (2016) Rapid Detection of Black Queen Cell Virus from Honeybee using Reverse Transcription Real-Time Recombinase Polymerase Amplification (RT/RT RPA)
More information_....
2009 I Winter PLASTICS news HANWHA CHEMICAL CORPORATION http://hcc.hanwha.co.kr CONTENTS 04 08 24 42 50 62 74 2009 WINTER 3 2009 Winter HANWHA NEWS 4 PLASTICS NEWS 2009 WINTER 5 2009 Winter HANWHA NEWS
More informationChapter 26
11 주 RNA 합성 11.1 DNA-dependent synthesis of RNA: Bacteria에서의 transcription l RNA polymerase (5 subunits로구성 : 2α, β, β, σ) l 효소에의한 RNA 합성의특징 - Complementary sequence to template DNA - RNA chain의합성방향 : 5
More information이 발명을 지원한 국가연구개발사업 과제고유번호 G1111700300320000000000000 부처명 한국환경산업기술원 연구사업명 토양지하수오염방지기술개발사업 연구과제명 시데로포아(Siderophore)의 대량생산을 통한 토양 및 지하수의 친환경 중금속 제거기술 개 발
(19) 대한민국특허청(KR) (12) 공개특허공보(A) (11) 공개번호 10-2013-0029213 (43) 공개일자 2013년03월22일 (51) 국제특허분류(Int. Cl.) C12N 1/15 (2006.01) C12P 21/00 (2006.01) C12R 1/77 (2006.01) (21) 출원번호 10-2011-0092470 (22) 출원일자 2011년09월14일
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More informationSlide 1
2013 년대리점집체교육 Exiqon 2013 년 2 월 21 일 ( 목 ) 1 Agenda 1. mirna 란무엇인가? 2. LNA 기술의장점 3. Exiqon 제품 RNA 샘플추출 cdna 합성 qpcr Array Northern blot/in situ Hybridization Inhibitor 4. 주문방법 2 이것만은꼭기억해주세요! 1. mirna 가무엇이고어디에쓰이는지안다
More information05052유식안101.hwp
제 출 문 식품의약품안전청장 귀 하 이 보고서를 유전자재조합식품 모니터링(부산광역시보건환경연구원/정구영) 과제의 연구 결과보고서로 제출합니다. 2005. 11. 30 주관연구기관명 : 부산광역시보건환경연구원 주관연구책임자 : 정구영 목 차 Ⅰ. 연구개발결과 요약문----------------------------------- 1 (한글)------------------------------------------
More information2013.. ....c04....
플라스틱뉴스 _ 봄 발행인 편집인 발행처 주 소 전 화 팩 스 방한홍 한화케미칼 대전광역시 유성구 가정로 76 042/865/6400 042/861/2611 인쇄처 학예 COM. 전 화 042/625/1821 인 쇄 2013. 3. 발 행 2013. 3. 등록번호 서울 바 00407호 등 록 1972. 5. 20 본지는 한국도서잡지윤리위원회의 실천요강을 준수합니다.
More information,,,,,,,, (), BOD,,,,,,,,,
- 1 - ,,,,,,,, (), BOD,,,,,,,,, - 2 - - 3 - 3) 4) 5) 6) 7) - 4 - - 5 - (Analytical Spectrum) 1 Biosensors 2 Electro Analysis 3 Environmental 4 Drug Discovery 5 Food Quality and Safety 6 Gas and Liquid-phase
More informationBio-Rad 할인행사, 비엠에스와함께하세요! 성공적인 PCR 실험을위한 Total Solution! 기간 : 2012 년 10 월 15 일 ~12 월 14 일 Gel Documentation System 과개인용 PCR 을특별한가격으로만나보세요! 버튼클릭한번만으로이미
Bio-Rad 할인행사, 비엠에스와함께하세요! 성공적인 PCR 실험을위한 Total Solution! 기간 : 2012 년 10 월 15 일 ~12 월 14 일 Gel Documentation System 과개인용 PCR 을특별한가격으로만나보세요! 버튼클릭한번만으로이미지획득까지! Gel Doc EZ system "UV tray 포함 " 스마트한개인용 PCR
More informationChapter 14 유전정보 (Genetic Information) A + G = C + T 일정 ( 샤가프룰 ] - Watson & Crick(1953년 ) : double helix model of DNA( 이중나선구조 ) 제시 1. 유전정보의전달경로 DNA 상의정
Chapter 14 유전정보 (Genetic Information) A + G = C + T 일정 ( 샤가프룰 ] - Watson & Crick(1953년 ) : double helix model of DNA( 이중나선구조 ) 제시 1. 유전정보의전달경로 DNA 상의정보를 RNA로옮겨주는과정 ex) retrovirus 2. DNA Replication ( 유전자복제
More information프로메가 2018 여름이벤트 BIG SALE 행사기간 2018년 8월 06일 ~ 9월 14일 *본 행사지에 표기된 금액은 부가세 별도 금액입니다. *단가 계약 및 입찰은 행사에서 제외됩니다.
프로메가 2018 여름이벤트 BIG SALE 행사기간 2018년 8월 06일 ~ 9월 14일 *본 행사지에 표기된 금액은 부가세 별도 금액입니다. *단가 계약 및 입찰은 행사에서 제외됩니다. EtBr 을아직사용하신다면? 일회용 Gel extractor 를사용해보세요! 내몸은소중하니깐 ~~~ 15ul minimum elution 이가능합니다!! 프로메가 Steady
More information2011 I Winter PLASTICS news HANWHA CHEMICAL CORPORATION http://hcc.hanwha.co.kr CONTENTS 04 08 27 40 59 64 75 2011 WINTER 3 2011 Winter HANWHA NEWS 4 PLASTICS NEWS 2011 WINTER 5 2011 Winter HANWHA NEWS
More information성공적인 Western Blot을 위한 선택! 20% 할인 + 증정 Protein Electrophoresis & Transfer System 품번 품명 행사가 (원) BR MP Tetra Cell 1.0, 10-well 1,395,000 BR165-80
성공적인 Western Blot을 위한 선택! Protein Electrophoresis & Transfer System BR165-8001 MP Tetra Cell 1.0, 10-well 1,395,000 BR165-8025 MP Tetra Cell/PP Basic 1.0, 10-well 1,994,000 BR165-8026 MP Tetra Cell/PP
More informationChapter 11
Chapter 15 RNA Polymerase II: Basal Transcription 1 Eukaryotic and bacterial RNA polymerases differ in some aspects 1. eukaryotes have three RNA polymerases, with one each specifically dedicated to rrna,
More information160106_STEPI_Insight_179호(정기철,김석관_외)rp.hwp
2015. 12. 1. 제179호 개인 유전체 기반 맞춤 의료 현황과 발전과제 2015. 12. 1. 제179호 개인 유전체 기반 맞춤 의료 현황과 발전과제 정기철 김석관 김승현 이명화 목 차 < 요 약 > Ⅰ. 개인 유전체 기반 맞춤 의료 7 Ⅱ. 맞 춤 의료 기 술 현 황과 시 사 점 10 Ⅲ. 맞춤 의료 조직 및 비즈니스모델 현황과 시사점 16 Ⅳ.
More informationConventional PCR: AllInOneCycler Real-Time PCR: Exicycler 96 Protein Synthesis and Purification: ExiProgen DNA/RNA Preparation: ExiPrep 16 Plus & ExiC
Conventional PCR: AllInOneCycler Real-Time PCR: Exicycler 96 Protein Synthesis and Purification: ExiProgen DNA/RNA Preparation: ExiPrep 16 Plus & ExiCracker Electrophoresis: Agaro-Power Microbial Culture:
More information(72) 발명자 박용우 경상남도 진주시 이현동 이현웰가 114동 1503호 구본동 경기도 양주시 백석읍 방성리 78-5 - 2 -
(51) Int. Cl. (19) 대한민국특허청(KR) (12) 등록특허공보(B1) C12Q 1/68 (2006.01) (21) 출원번호 10-2008-0117508 (22) 출원일자 2008년11월25일 심사청구일자 2008년12월15일 (65) 공개번호 10-2010-0058919 (43) 공개일자 2010년06월04일 (56) 선행기술조사문헌 KR100619189
More information<30322EBABBB9AE2E687770>
대한내과학회지 : 제 79 권부록 2 호 2010 청람연구비결과보고 대장암발생과정에서 Prostaglandin 의조절기전규명및암예방약제의반응성표지자로 15-hydroxyprostaglandin dehydrogenase의역할 울산대학교의과대학내과학교실 명승재 서 론 2. 병리조직학적분석 (Histopathologic analysis) 과제는인체에서대장암병기의각단계에서
More information<C3D6C1BEBAB8B0EDBCAD2E687770>
Counter Pulse Generator TRX(Thyratron) Oscilloscope Pump Chamber Power Supply Oscilloscope Controller Inductor High Voltage Pulse Generator (-) 펄스폭:-0.5uS, 승압비:-1:2(GND) (-) 펄스폭:-2uS, 승압비:-1:1(GND)
More informationNuclease (핵산 분해 효소)
7. Nuclease ( 핵산분해효소 ) Nuclease Nuclease 란? DNA 를중합하는 DNA polymerase 와는달리핵산을분해하는효소 Nuclease 의중요성 생체내에서는항상핵산을분해하는일이일어나고있으므로생명현상을공부한다는점에서중요 실제의분자생물학실험에서 polymerase 보다더자주쓰이고있기때문에중요 Nuclease Nuclease 를실험에이용할때염두해두어야할내용
More informationBMS Mega Sale 행사기간 : 2015 년 5 월 29 일까지
BMS Mega Sale 행사기간 : 2015 년 5 월 29 일까지 V3 1 Separate Proteins Western Workflow 15 분 Stain-free gel 사용시, 300V, 15 분만에전기영동완료 2 Visualize Separation 1 분 UV 를조사하여 coomassie stain 없이 1 분만에이미지획득 Speed 2 시간안에실험완료
More information1 원자와 분자, 그리고 이온 3 불꽃 반응, 분광계 원소는 다소 왜곡해서 원자라고 이해하자. 원소는 저마다의 특성이 있다. 그래서 불꽃에 넣으면 고유의 색을 띤다. 예를 들어 불꽃 속에서 나트륨은 노란색, 구리는 청록색을 띤다. 이를 불꽃 반응이라고 한다. 또한 각
1 원자와 분자, 그리고 이온 1 원자, 이온, 분자 원자는 원자핵과 그 핵 주위를 원 궤도에 따라 움직이는 전자로 구성돼 있다. 원자핵은 양성자와 중성자로 구성돼 있는데, 양성자의 개수는 원자의 종류에 따라 달라진다. 전자는 전기적으로 음성(-)을 띠는 반면, 원 자핵은 1(양성자, 중성자)로 인해 양성(+)을 띤다. 이 둘의 힘은 서로 상쇄되어 일반적으로
More information553호
소통과 화합 환자중심 연구중심 친절한 병원 제 553호 2012년 7월 12일 발행인 송은규 편집인 김윤하 주소 광주광역시 동구 제봉로 42 홈페이지 http://www.cnuh.com Tel 062-220-5092 FAX 062-222-8092 원무과 내과 23일 새롭게 선 보입니다 1동 1 2층으로 각각 이전 수술장 공사 28일 마감 전남대병원의 1동 리모델링
More information<C7D1BDC4BFAC20B1E8B5BFBCF6B9DABBE7B4D4676C75636F20C3D6C1BE5B315D2E687770>
Glucomannan 을이용한 기능성소재화연구 Study on the Functional and Processing Properties of Glucomannan for Food Material 연구기관 한국식품개발연구원 농림부 - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12
More informationPowerPoint Presentation
Interchapeter B : 핵산생물공학기술 (part A) Recombinant DNA techniques - 전기영동 - 제한효소 - 클로닝 - 대장균을이용한단백질대량생산 Agarose mesh DNA 분리기술 : Agarose Gel Electrophoresis ( 수평형 ) _ + DNA is negatively charged from the phosphate
More information¹ÙÀÌ¿À °æÁ¦½Ã´ë °úÇбâ¼ú Á¤Ã¥ÀÇÁ¦¿Í ´ëÀÀÀü·«---.PDF
: : www.stepi.re.kr : : S&T Policy Agenda and Options for the BioEconomy 발 간 사 바이오 경제는 화학과 물리학이 주축이 되는 Physical Science의 한계로 지목되 고 있는 이른바 지속 가능성의 위기 를 극복하기 위한 대안이며, Life Science의 이론적, 기술적 기반 위에서 성립하는
More informationc04....
2012 I Spring PLASTICS news HANWHA CHEMICAL CORPORATION http://hcc.hanwha.co.kr CONTENTS 04 09 26 44 48 59 2012 SPRING 3 한화뉴스 2012 Spring HANWHA NEWS TRC사 PV Cell 분석 세미나 (1월 17일) 한화케미칼 중앙연구소 분석팀 및 폴리실리콘연구센터에서는
More information대한진단검사의학회지 : 제 24 권제 5 호 2004 Korean J Lab Med 2004; 24: 진단유전학 실시간중합효소연쇄반응을이용한상대정량에서표준곡선의영향 이미경 김태형 1 중앙대학교의과대학진단검사의학교실, 비뇨기과학교실 1 Influence of
대한진단검사의학회지 : 제 24 권제 5 호 2004 Korean J Lab Med 2004; 24: 327-33 진단유전학 실시간중합효소연쇄반응을이용한상대정량에서표준곡선의영향 이미경 김태형 1 중앙대학교의과대학진단검사의학교실, 비뇨기과학교실 1 Influence of Standard Curves on Relative Quantification using Real-time
More information믿음, 신뢰를 바탕으로 당신의 행복한 순간을 약속하겠습니다 새로운 행복, 설레는 출발을 선사하기 위해 최선을 다하겠습니다. 결혼정보회사 대명위드원은 600만 싱글에게 1등 결혼을 약속하겠습니 다. 가족의 가치를 소중히 여기고 사람이 중심인 대명그룹의 사명에 따라 소중한
格 이 다른 만남 대표전화 1588-3883 홈페이지 www.withone.co.kr 본사 서울시 서초구 서초대로 320 하림빌딩 9층 Tel. 1588-3883 / Fax. 02-583-7104 영남지사 부산시 부산진구 부전대로 751 부전메디칼빌딩 12층 Tel. 051-818-1883 / Fax. 051-818-1886 대구 지사 대구시 중구 달구벌대로
More informationIntroduction 신뢰성 있는 결과 높은 품질의 제품을 생산하기 위해서는 제품의 공정 시스템이 중요 품질관리실험실은 품질보증과정에서 매우 중요한 역할 분석시스템은 품질관리실험실의 매우 중요한 요소 분석시스템의 결과를 기본으로 하여 제품의 품질을 결정 R&D 실험실
적정의 올바른 분석방법 Kopack Seminar May 2012 Agenda Introduction Risks and Measures Summary 1 1 Introduction 신뢰성 있는 결과 높은 품질의 제품을 생산하기 위해서는 제품의 공정 시스템이 중요 품질관리실험실은 품질보증과정에서 매우 중요한 역할 분석시스템은 품질관리실험실의 매우 중요한 요소
More informationOld View of the World (,,, ). 2
Supply Chain Management / Logis5cs 1 Old View of the World (,,, ). 2 Ver5cal Integra5on ( ) (Ford) Rouge Plant (Toyota ) ( ),,,,,,,...,,, 1927 Model A 15 15,000,000 120,000 3 Old View of the World 7-Eleven
More informationDBPIA-NURIMEDIA
Mass-production of Four Specific Proteins Originated from Deformed Wing Virus, Honeybee-viral Pathogen Joo-seong Lee, Giang Thi Huong Luong and Byoung-Su Yoon* Department of Life Science, College of Natural
More informationPowerPoint 프레젠테이션
Product News Letter 4 호 User s Guide for Ligation Independent Cloning Inspect into "Overlap Cloner" Cloning 의일반적인방법 미래기술 Recombineering "Overlap Cloner" 의원리와응용분야 자주하는질문 Trouble Shooting 은단백질전문기술기업입니다기술혁신형중소기업입니다고객상담전화
More informationDBPIA-NURIMEDIA
Original Article Journal of Apiculture 32(2) : 119~131 (217) DOI: 1.17519/apiculture.217.6.32.2.119 Development of Rapid Detection System for Small Hive Beetle (Aethina tumida) by using Ultra-Rapid PCR
More information연구보고서화학물질노출에의한유전자돌연변이 ( 발암 ) 의조기확인 (II) - 실험동물을이용한고감도발암성확인기법의검증 - 임경택 김수진
연구보고서화학물질노출에의한유전자돌연변이 ( 발암 ) 의조기확인 (II) - 실험동물을이용한고감도발암성확인기법의검증 - 임경택 김수진 요약문 i ii 화학물질노출에의한유전자돌연변이 ( 발암 ) 의조기확인 (II) 요약문 iii iv 화학물질노출에의한유전자돌연변이 ( 발암 ) 의조기확인 (II) 요약문 v vi 화학물질노출에의한유전자돌연변이 ( 발암 ) 의조기확인
More information목차 1. 서론 줄기세포의간세포분화능평가시고려사항 간세포분화능평가시험법 분
세포치료제시험정보집 7 줄기세포치료제의 간세포분화능평가시험 2015. 4. 30. 식품의약품안전평가원 차세대줄기세포기반제제평가연구사업단 목차 1. 서론 --------------------------------------------- 1 2. 줄기세포의간세포분화능평가시고려사항 --------------- 2 3. 간세포분화능평가시험법 -----------------------------
More information(......).hwp
7 6 4 10 20 30 ph 5 4 3 0 10 20 30 40 50 60 Fermentation time(day) Fig.2-1. Changes of ph in DLMK according to various fermentation temperature 2 4 10 20 30 Acidity (%) 1 0 0 10 20 30 40 50 60 Fermentation
More information歯20010629-001-1-조선일보.PDF
6. 29 () 11:00 ( ) 20 0 1. 6. 29 11( ).(397-1941) 1. 2. 3. 4. 5. 1. 28, 60() (,, ) 30 619(, 6. 29) () 6 (,,,,, ),,, - 1 - < > (, ), () < > - 2 - 2.,,, 620,, - 3 - 3. ( ) 1,614,, 864 ( ) 1,6 14 864 () 734
More information11민락초신문4호
꿈을 키우는 민락 어린이 제2011-2호 민락초등학교 2011년 12월 21일 수요일 1 펴낸곳 : 민락초등학교 펴낸이 : 교 장 심상학 교 감 강옥성 교 감 김두환 교 사 김혜영 성실 근면 정직 4 8 0-8 6 1 경기도 의정부시 용현로 159번길 26 Tel. 031) 851-3813 Fax. 031) 851-3815 http://www.minrak.es.kr
More information대한진단검사의학회지제 26 권제 3 호 2006 Korean J Lab Med 2006;26: 원저 진단분자유전학 실시간중합효소연쇄반응검사와아가로오스겔전기영동에의한중합효소연쇄반응물의정량검사비교 이미경 김혜련 중앙대학교의과대학진단검사의학교실 Comparison
대한진단검사의학회지제 26 권제 3 호 2006 Korean J Lab Med 2006;26:217-22 원저 진단분자유전학 실시간중합효소연쇄반응검사와아가로오스겔전기영동에의한중합효소연쇄반응물의정량검사비교 이미경 김혜련 중앙대학교의과대학진단검사의학교실 Comparison between Real-Time PCR and Agarose Gel Electrophoresis
More information5-03-Â÷¼¼´ëÀ¥Iš
141 142 Ver. 2011 143 144 Ver. 2011 145 146 Ver. 2011 147 148 Ver. 2011 149 150 Ver. 2011 151 152 Ver. 2011 153 154 Ver. 2011 155 156 Ver. 2011 157 158 Ver. 2011 159 160 Ver. 2011 161 162 Ver. 2011 163
More informationSystem Biology Core
System Biology Core 연세의생명연구원연구지원부 _ 연세유전체센터 The RNAi Consortium (TRC) shrna 안내 Ⅰ. MISSION shrna 의설계 MIT 와 Harvard 의 Broad Institute 의 The RNAi Consortium (TRC) 에서설계하고개발한 MISSION shrna clones 는 21 base
More information