응용곤충51권4호
|
|
- 영남 안
- 2 years ago
- Views:
Transcription
1 Original article KOREAN JOURNAL OF APPLIED ENTOMOLOGY 한국응용곤충학회지 c The Korean Society of Applied Entomology Korean J. Appl. Entomol. 51(4): (2012) pissn , eissn DOI: 미토콘드리아 COI 영역의뉴클레오티드서열차이를이용한팥나방과어리팥나방의 PCR 판별법 서보윤ㆍ정진교 * ㆍ조점래 1 ㆍ김용균 2 ㆍ박창규 1 농촌진흥청국립식량과학원, 1 농촌진흥청국립농업과학원, 2 국립안동대학교생명자원과학부식물의학전공 A PCR Method to Distinguish Matsumuraeses phaseoli from M. falcana Based on the Difference of Nucleotide Sequence in the Mitochondrial Cytochrome c Oxidase Subunit I Bo Yoon Seo, Jin Kyo Jung*, Jum Rae Cho 1, Yonggyun Kim 2 and Chang Gyu Park 1 National Institute of Crop Science, Seodun-dong, Suwon , Rep. Korea 1 National Academy of Agricultural Science, Seodun-dong, Suwon , Rep. Korea 2 Major in Plant Medicine, School of Bioresource Sciences, Andong National University, Andong , Rep. Korea ABSTRACT: The two closely related major leguminous crop pests in Korea, Matsumuraeses phaseoli and M. falcana (Lepidoptera: Tortricidae) have very similar morphological characters, which occasionally give rise to a failure in distinguishing between the two. In this study, we report an easy PCR-SSP method to distinguish between them, with a sequence specific primer set (P-SF2, F-SF3, and C-SR3) based on single nucleotide mismatch in 3ʹ terminal base of a primer, which is found in the mitochondrial cytochrome c oxidase subunit I DNA (mtcoi). Through application of this method, each species may be clearly identified in terms of its PCR band size and pattern, only one band (245 bp) for M. falcana and one (409 bp) or two bands (409 bp & 245 bp) for M. phaseoli. Key words: Matsumuraeses phaseoli, M. falcana, mitochondrial cytochrome c oxidase subunit I (mtcoi), PCR-SSP 초록 : 콩과 (Fabaceae) 작물해충인팥나방 (Matsumuraeses phaseoli) 과어리팥나방 (M. falcana) ( 나비목 : 잎말이나방과 ) 은형태적으로매우유사하여종구별이힘든것으로알려져있다. 본연구에서는 PCR-SSP(PCR with Sequence Specific Primers) 방법으로두종을빠르고정확하게구별할수있는판별법을찾고자두종의미토콘드리아시토크롬옥시다제 I(mtCOI) DNA 부분영역 (439 bp) 의염기서열을해독하였다. 그리고다른나방종의 mtcoi 염기서열과함께나열하여비교한후팥나방과어리팥나방에서종특이적으로차이가나는단일뉴클레오티드를프라이머의 3ʹ 말단으로하는염기서열특이프라이머조합을만들었다. PCR 산물들을전기영동한결과, 어리팥나방은 245 bp, 팥나방은 409 bp 와 245 bp 의특이적밴드패턴을보여두종을구별할수있었다. 검색어 : 팥나방, 어리팥나방, 미토콘드리아시토크롬옥시다제 I (mtcoi), PCR-SSP 팥나방 (Matsumuraeses phaseoli) 과어리팥나방 (M. falcana) 은잎말이나방과 (Tortricidae) 에속하는데, 국내에는현재까지같은속에이두종만이기록되어있다. 특히어리팥나방은팥나방의성페로몬을연구하는과정 (Cho et al., 2007; Yum, *Corresponding author: jungjk@korea.kr Received June ; Revised September Accepted September ) 에서성페로몬트랩에포획된개체들중에발견되어최근기록되었다 (Byun et al., 2005). 이들은유충이콩과 (Fabaceae) 작물의어린잎을말고그안에서섭식을하거나줄기속또는생식생장기에는꼬투리안으로들어가피해를주는것으로알려져있다 (Park et al., 1978). 국내에서팥나방은유충이팥생식기관을주로가해하는것으로관찰되었고 (Jung et al., 2009), 어리팥나방은콩의어린순을가해하는것이관찰되었다 (Heo The Korean Society of Applied Entomology (KSAE) retains the exclusive copyright to reproduce and distribute for all KSAE publications. The journal follows 365an open access policy.
2 Table 1. PCR primer sets used to amplify mtcoi region of M. falcana and M. phaseoli Primer set 1 2 Primer name D* Sequence (5-3 ) C1-J-1751 F GGATCACCTGATATAGCATTCCC C1-N-2191 R CCCGGTAAAATTAAAATATAAACTTC P-SF2 F AAATAATATAAGATTTTGAC F-SF3 F TAGCTGGAATTTCATCTATC C-SR3 R GATGTTGATAAAGAATAGGG Annealing temp. Length of PCR product bp 46.2 M. falcana: 245 bp M. phaseoli: 409 bp * D (Direction of transcription), F (forward primer), R (reverse primer) et al., 2009). 두종은형태적으로매우유사하여유충과암컷은구별할수있는검색키가없으며수컷의경우에내부생식기인파악기의형태적차이 (Byun et al., 2005) 로동정하고있으나그차이가뚜렷하게드러나지않는경우가종종있어왔다 (Jung, J.K., unpublished observation). 또두종에대해보고된성페로몬조성들 (Cho et al., 2007; Yum, 2010) 을이용하여야외에서성충을포획하고파악기의형태적특징만으로구별할때, 한종의성페로몬트랩에두종이한꺼번에포획되는현상이발견되어 (Jung, J.K., unpublished observation) 형태적특징하나만을이용한종동정에불완전성을보였다. 따라서형태동정의오류를극복하고자, 미토콘드리아시토크롬옥시다제 (mtcoi) DNA영역의염기서열을판독하고 PCR-RFLP 방법으로두종이유전자수준에서차이를보이는것을뚜렷하게밝혀두종을구분할수있는분자판별도구를마련하였다 (Heo et al., 2009). 그러나그보고에서 mtcoi DNA 염기서열판독에오류가발견되었는데, 본연구에서는그오류를수정하고, 정확한염기서열에근거하여두종 mtcoi DNA 주형과프라이머 3ʹ 말단염기서열차이 (mismatch) 에따른 PCR 반응효과를이용한간단한 PCR-SSP (Polymerase Chain Reaction with Sequence Specific Primer) 방법 (Kwok et al., 1990; Steffensen et al., 2000) 으로대량의샘플을빠르게동정할수있는분자표지를개발하여보고한다. 재료및방법미토콘드리아시토크롬옥시다제 (mtcoi) DNA 부분영역염기서열해독 팥나방은 2004년경기도수원시팥포장에서, 어리팥나방은 2008년전라남도무안군콩포장에서채집되어실내에서누대사육되었다. 각종의수컷성충으로부터 G-spin TM Genomic DNA Extraction Kit (For Cell/Tissue) (intron Biotechnology, Inc) 를이용하여제조사의방법에따라순수하게게놈 DNA를추출하였다. mtcoi DNA 영역부분염기서열해독을위해각각의게놈 DNA를주형으로보존형 PCR 프라이머인, C1-J -1751과 C1-N-2191 (Table 1) (Simon et al., 1994) 를이용하여 PCR 반응을시켰다. PCR 반응은 AccuPower PCR PreMix (( 주 ) 바이오니아 ) 튜브에게놈 DNA 주형 1 μl, 두종의프라이머각각 10 pmol 1 μl씩넣고고압멸균된 3차증류수를 17 μl를넣어최종 20 μl를만들고잘섞어 Heo et al.(2009) 의반응시간조건을이용하였다. 증폭된 PCR 산물은 1x TAE 버퍼와 1% 아가로스겔 (SeaKem LE Agarose, Lonza) 을이용하여 100V로 30분간전기영동시켜약 500 bp 사이즈의단일밴드를확인하였다. 단일밴드는다시 1% 아가로스겔로부터 QIAquick gel extraction kit (QIAGEN) 를이용하여순수하게회수하였다. 순수분리된 PCR 산물을주형으로 ( 주 ) 마크로젠 ( 서울 ) 에의뢰하여팥나방과어리팥나방의 mtcoi DNA 영역부분염기서열 439 bp를해독하였으며각각의염기서열을 GenBank에등록하였다 ( 어리팥나방 : JN , 팥나방 : JN ). 종특이 PCR 프라이머제작 MegAlign (DNAStar, USA) 프로그램을이용하여팥나방과어리팥나방의 mtcoi 439 bp를잎말이나방과 (Tortricidae) 의코드링나방 (Cydia pomonella), 복숭아순나방붙이 (Grapholita dimorpha), 복숭아순나방 (Grapholita molesta) 과밤나방과 (Noctuidae) 의멸강나방 (Mythimna separata), 왕담배나방 (Helicoverpa armigera) 의같은영역의염기서열과함께 Clustal W방법으로나열하고비교하였다 (Fig. 1). 이비교에서다른나방들과다르면서팥나방과어리팥나방사이에만특이적으로차이가나는뉴클레오티드를찾았다. 해당부분을 forward 프라이머의 3ʹ 말단염기로하여 Gene Runner 3.01 프로그램 (by Spruyt and Buquicchio) 을이용하여 PCR 프라이머 366 Korean J. Appl. Entomol. 51(4): 365~370 (2012)
3 조합을검색하였다. 3ʹ 말단염기가팥나방과어리팥나방에서는모두일치하지만다른나방종과는차이가나는곳을찾아 reverse 프라이머를설계하였다. 따라서팥나방과어리팥나방종특이적 forward 프라이머각각 1개 (P-SF2, F-SF3) 와 reverse 프라이머 1개 (C-SR3) 로구성된염기서열특이 PCR 프라이머세트 (PCR-sequence specific primer, PCR-SSP) (Table 1) 를 ( 주 ) 마크로젠에의뢰하여합성하였다. 종판별을위한 PCR 반응및전기영동본연구에서설계한종특이 PCR 프라이머세트 (P-SF2, F-SF3, C-SR3) 를이용하여팥나방과어리팥나방판별가능성을확인하기위해팥나방과어리팥나방의수컷성충머리와가슴부위로부터순수하게추출된게놈 DNA를주형으로 PCR 반응을수행하였다. 그리고동일프라이머세트를이용하여멸강나방과왕담배나방의게놈 DNA를주형으로 PCR 반응을하여예상대로팥나방과어리팥나방에서만특이적으로작동하는지확인하였다. 또한실제로수원의야외포장에서팥나방과어리 팥나방성페로몬트랩에포획된수컷성충의종판별가능성을검토하였다. PCR 반응은게놈 DNA 1 μl, 두종류의 PCR 프라이머 (10 pmol) 각각 1 μl씩총 3 μl와고압멸균 3차증류수 16 μl를 AccuPower PCR PreMix (( 주 ) 바이오니아 ) 튜브에첨가하고잘섞어준후 MJ Mini 48-Well Personal Thermal Cycler (BIO-RAD) 를이용하여다음과같이수행하였다. 95 5분간반응시킨후 95 30초 (denaturation), 초 (Primer annealing), 72 30초 (Primer extension) 순서로 34회반복하고 72 에서 10분간반응시켰다. PCR 결과를확인하기위해 1% 아가로스겔 (SeaKem LE Agarose, Lonza) 을준비하고 PCR 산물을 2 μl씩로딩하여 1x TAE 버퍼에서 100 V로 30분간전기영동시켰다. 결과및고찰 mtcoi DNA 부분영역염기서열비교 팥나방과어리팥나방 mtcoi 439 bp 의염기서열을비교한 Fig. 1. Alignment of mtcoi DNA sequence (439 bp) of seven different lepidopteran species (five from Tortricidae and two from Noctuidae) and deduced amino acid sequence for M. falcana and M. phaseoli (dotted line box). A sequence specific PCR primer set (P-SF2, F-SF3, and C-SR3) to distinguish M. falcana from M. phaseoli is shown by arrow lines (5ʹ to 3ʹ direction) below each target template sequence. Red boxes show one different nucleotide in 3ʹ terminal of primers to specifically identify M. falcana and M. phaseoli. Nucleotides with black background indicate different sequences between M. falcana and M. phaseoli. A dot ( ) shows identity with sequence of M. falcana. Gray box indicates a cleavage site (GTAC) by the restriction enzyme, RsaI (Heo et al., 2009). * GenBank accession number: C. pomonella(cydia pomonella; FJ ), G. dimorpha (Grapholita dimorpha; JQ ), G. molesta (Grapholita molesta; FJ ), H. armigera-44, 45 (Helicoverpa armigera; Seo, B.Y. et al., unpublished observation), M. separata-1, 2 (Mythimna separata; Seo, B.Y. et al., unpublished observation) 팥나방과어리팥나방의 PCR 판별 367
4 Fig. 1. Continued 결과, 23개의단일뉴클레오티드에서차이가관찰되었으며그중 22개는코돈 (codon) 의세번째염기가, 나머지 1개는첫번째염기가치환되었으나해당 DNA 염기서열로부터도출된아미노산서열은두나방사이에 100% 일치하였다 (Fig. 1). 또한 Heo et al.(2009) 이보고한바와달리서로결실된뉴클레오티드가없어두나방사이해당유전자의크기변이는관찰되지않았다 (Fig. 1). 팥나방과어리팥나방의종구분을위해 Heo et al.(2009) 에의해보고된 PCR-RFLP 방법에서제한효소 RsaI 의절단영역인 GTAC(Fig. 1, 회색박스 ) 염기서열은팥나방과복숭아순나방붙이에서확인되었다. 따라서종특이성을높이기위해보존형 PCR 프라이머보다는종특이프라이머를통한 PCR 산물에제한효소를처리하는방법이근연종판별을위해더욱정확성을높일수있을것으로판단되었다. 368 Korean J. Appl. Entomol. 51(4): 365~370 (2012)
5 Fig. 2. Agarose gel electrophoresis (1%) of DNA fragment after PCR amplification with the sequence specific primer set (P-SF2, F-SF3, and C-SR3) from the individual genomic DNA of M. falcana (lane 1-4), M. phaseoli(lane 7-10), Mythimna separata (lane 6 and 12), and Helicoverpa armigera (lane 5 and 11) * M indicates a 100 bp ladder plus molecular size marker (Bioneer) 팥나방과어리팥나방판별 PCR-SSP Fig. 3. Example of species identification with the sequence specific PCR primer set (P-SF2, F-SF3, and C-SR3) between M. falcana male (F) and M. phaseoli male (P) captured by respective sex pheromone traps in the field. A: Target species of sex pheromone trap B: Species identification based on the result of PCR-SSP * M indicates a 100 bp ladder molecular size marker (Bioneer) 본연구에서설계한종특이 PCR 프라이머세트 (P-SF2, F-SF3, C-SR3) 를이용하여팥나방과어리팥나방의게놈 DNA 를주형으로 PCR 반응을시킨결과예상대로어리팥나방에서 245 bp 사이즈의단일증폭산물이특이적으로나타났다 (Fig. 2). 그런데팥나방의경우, 예상했던 409 bp의단일증폭산물은 4개체의팥나방게놈 DNA로부터모두나타났으나, 어리팥나방에서나왔던 245 bp의단일증폭산물은 3개체에서 409 bp 밴드보다약하거나동일한수준으로함께나타났다 (Fig. 2). 이러한결과는팥나방특이 forward 프라이머인 P-SF2가어리팥나방게놈 DNA 주형에는분명하게작동되지않았지만, 어리팥나방의특이 forward 프라이머인 F-SF3가팥나방게놈 DNA 주형에서는어느정도작동될수있음을보여주었다. 이는 Kwok et al.(1990) 의결과와고찰에서처럼같은 DNA 주형이라도프라이머 3ʹ 말단염기와 DNA 주형의염기종류조합차이와 dntp 농도와 DNA polymerase의 5ʹ 3ʹ exonuclease 활성, 프라이머 annealing 온도등반응성분및조건등에따라상대적 PCR 증폭효율이다를수있기때문으로추정된다. 그러나왕담배나방과멸강나방게놈 DNA에서는예상대로증폭산물이나오지않았으며팥나방과어리팥나방의 PCR 증폭산물의밴드패턴을통해서두종을구별하는데어려움은없을것으로판단된다 (Fig. 2). 다만, 현재까지무안에서채집된어리팥나방과수원에서채집된팥나방집단의 mtcoi DNA 염기서열 (439 bp) 에서는개체변이가관찰되지않았고이를토대로제작한종특이프라이머세트를이용하여종판별이가능하였으나, 만일해당프라이머영역의 3ʹ 말단염기에서개체변이가있을경우본연구에서개발된프라이머세트가오류를범할수있어추가로보완된마커개발이필요할것으로사료된다. 한편, 실제야외에서발생하는팥나방과어리팥나방샘플에서도종특이 PCR 프라이머세트가잘작동하는지확인하기위하여수원지역에설치된팥나방 (Yum, 2010) 과어리팥나방 (Cho et al., 2007) 성페로몬트랩에서포획된팥나방과어리팥나방수컷의게놈 DNA를주형으로본연구에서제작한종특이 PCR 프라이머세트를이용하여 PCR 반응을시킨결과, 팥나방과어리팥나방을분명하게구별할수있도록 245 bp와 409 bp의단일증폭밴드가나왔다 (Fig. 3). 또한팥나방성페로몬트랩에어리팥나방수컷성충들이포획된것을확인할수있었다 (Fig. 3). 팥나방과어리팥나방은형태적으로구별하기어렵고야외포장의성페로몬트랩에두종이한꺼번에포획되기때문에 (Yum, 2010; Jung, J.K. et al., unpublished observation) 본연구에서제작된 PCR 프라이머세트가팥나방과어리팥나방을구분하여각종의피해및발생생태를연구하는데매우유용하게사용될것으로기대한다. 사사 근연종의미토콘드리아유전자염기서열에관해귀중한조언을해준국립농업과학원의박해철박사와한태만씨에게감사드린다. 본연구는농촌진흥청기관고유사업 ( 과제번호 : PJ008692) 의지원으로수행한결과입니다. Literature Cited Byun, B-.K., Park, K-.T., Park, Y-.M., Review of Genus Matsumuraeses Issiki (Lepidoptera, Tortricidae) with discovery of 팥나방과어리팥나방의 PCR 판별 369
6 M. falcana (Walsingham) in Korea. J. Asia-Pacific Entomol. 8, Cho, J.R., Choi, K.S., Jung, J.K., Park, J.H., Seo, B.Y., Development of sex pheromone trap for monitoring Matsumuraeses falcana (Walshingham) (Lepidoptera: Tortricidae). J. Asia-Pacific Entomol. 10, Heo, H.J., Son, Y.R., Seo, B.Y., Jung, J.K., Kim, Y.G., A molecular marker discriminating the soybean podworm, Matsumuraeses phaseoli and the podborer, M. falcana (Lepidoptera: Tortricidae). Korean J. Appl. Entomol. 48, Jung, J.K., Seo, B.Y., Cho, J-.R., Kwon, Y-.H., Kim, G-.H., Occurrence of lepidopteran insect pests and injury aspects in adzuki bean fields. Korean J. Appl. Entomol. 48, Kwok, S., Kellogg, D.E., McKinney, N., Spasic, D., Goda, L., Levenson, C., Sninsky, J.J., Effects of primer-template mismatches on the polymerase chain reaction: human immunodeficiency virus type 1 model studies. Nucleic Acids Res. 18, Park, K.T., Hwang, C.Y., Choi, K.M., Lepidopterous insect pests on soybean. Kor. J. Pl. Prot. 17, 1-5. Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H., Flook, P., Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann. Entomol. Soc. Am. 87, Steffensen, R., Thiel, S., Varming, K., Jersild, C., Jensenius, J.C., Detection of structural gene mutations and promoter polymorphisms in the mannan-binding lectin (MBL) gene by polymerase chain reaction with sequence-specific primers. J. Immunol. Methods 241, Yum, K.H., Identification of sex pheromone of the soybean podworm, Matsumuraeses phaseoli Matsumura (Lepidoptera: Tortricidae), MS Thesis, Chungnam National University, Daejeon. 370 Korean J. Appl. Entomol. 51(4): 365~370 (2012)
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social
More informationCloning
Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More information미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More informationChapter 26
11 주 RNA 합성 11.1 DNA-dependent synthesis of RNA: Bacteria에서의 transcription l RNA polymerase (5 subunits로구성 : 2α, β, β, σ) l 효소에의한 RNA 합성의특징 - Complementary sequence to template DNA - RNA chain의합성방향 : 5
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More information232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특
한국도시행정학회 도시행정학보 제25집 제4호 2012. 12 : pp.231~251 생활지향형 요소의 근린주거공간 분포특성 연구: 경기도 시 군을 중심으로* Spatial Distribution of Daily Life-Oriented Features in the Neighborhood: Focused on Municipalities of Gyeonggi Province
More information08김현휘_ok.hwp
(Regular Paper) 21 3, 2016 5 (JBE Vol. 21, No. 3, May 2016) http://dx.doi.org/10.5909/jbe.2016.21.3.369 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a), a) An Audio Coding Technique Employing the Inter-channel
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More information01-15(3)-12(최장경).fm
Res. Plant Dis. 15(3) : 165-169 (2009) Research in Plant Disease The Korean Society of Plant Pathology GM s ü š w Cucumber mosaic virus v y 1 Á y Á»x 1 Á * w w, 1 w y w Comparative Analysis of Coat Protein
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More information02À±¼ø¿Á
Geomorphic Development of Marine Terraces at Jeongdongjin-Daejin area on the East Coast, Central Part of Korean Peninsula Soon-Ock Yoon*, Sang-Ill Hwang** and Hak-Kyun Ban*** Abstract : In this paper we
More informationAnalysis of teacher s perception and organization on physical education elective courses Chang-Wan Yu* Korea Institute of curriculum and evaluation [Purpose] [Methods] [Results] [Conclusions] Key words:
More informationEZ-Cloning kit
EZ TM 5 /3 RACE PCR Kit Instruction Manual Korean Ver. Kit for 10 reactions Cat.# EZ025 EZ TM 5 /3 RACE PCR Kit Table of Contents I. 제품설명... 3 II. 원리... 4 III. 제품구성... 7 IV. 염기서열정보... 8 V. 주의사항... 8 VI.
More information12이문규
Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More informationDBPIA-NURIMEDIA
Original Article Journal of Apiculture 32(2) : 119~131 (217) DOI: 1.17519/apiculture.217.6.32.2.119 Development of Rapid Detection System for Small Hive Beetle (Aethina tumida) by using Ultra-Rapid PCR
More informationAutomated high multiplex qPCR platform for simultaneous detection and quantification of multiple nucleic acid targets
PCR FlashGel System 2013. 04. 24 PCR 2013. 04. 24 순서 1. PCR 이란 2. PCR 실험의기본조건 3. PCR 효소선택가이드 4. Hot Start PCR의원리 5. PCR 실험시 Troubleshooting 6. PCR 장비 _TP350 소개 PCR(Polymerase Chain Reaction) PCR 이란? -
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More information대한한의학원전학회지24권6호-전체최종.hwp
小兒藥證直訣 의 五臟辨證에 대한 小考 - 病證과 處方을 중심으로 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 ㆍ 韓醫學古典硏究所 白裕相1,2*1)2) A study on The Diagnosis and Treatment Using The Theory of Five Organs in Soayakjeungjikgyeol(小兒藥證直訣) 1 Dept. of Oriental
More information???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More informationDBPIA-NURIMEDIA
Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun
More informationJournal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI: * Suggestions of Ways
Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp.65-89 DOI: http://dx.doi.org/10.21024/pnuedi.29.1.201903.65 * Suggestions of Ways to Improve Teaching Practicum Based on the Experiences
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Dec.; 27(12), 1036 1043. http://dx.doi.org/10.5515/kjkiees.2016.27.12.1036 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)
More information05052유식안101.hwp
제 출 문 식품의약품안전청장 귀 하 이 보고서를 유전자재조합식품 모니터링(부산광역시보건환경연구원/정구영) 과제의 연구 결과보고서로 제출합니다. 2005. 11. 30 주관연구기관명 : 부산광역시보건환경연구원 주관연구책임자 : 정구영 목 차 Ⅰ. 연구개발결과 요약문----------------------------------- 1 (한글)------------------------------------------
More information슬라이드 1
TAKARA 1. PCR 2. qpcr 2014. 02. 13. 최유미 DNA? DNA 생물체 > 기관 > 세포 >DNA DNA (Deoxyribonucleic acid) 세포내에서생물의유젂정보를보관하는물질 구성 : Adenine, Thymine, Cytosine, Guanine 종특이적, 개체특이적 PCR (Polymerase Chain Reaction)
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Feb.; 29(2), IS
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Feb.; 29(2), 93 98. http://dx.doi.org/10.5515/kjkiees.2018.29.2.93 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) UHF-HF
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: * Review of Research
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.79-102 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.79 * Review of Research Trends on Curriculum for Students with Severe and multiple
More information디지털포렌식학회 논문양식
ISSN : 1976-5304 http://www.kdfs.or.kr Virtual Online Game(VOG) 환경에서의 디지털 증거수집 방법 연구 이 흥 복, 정 관 모, 김 선 영 * 대전지방경찰청 Evidence Collection Process According to the Way VOG Configuration Heung-Bok Lee, Kwan-Mo
More information슬라이드 1
EVENT 퀴아젠인기상품연말특별가전 200203 Top Taq DNA Polymerase (250U) 90,000 72,000 200205 Top Taq DNA Polymerase (1000U) 331,000 281,350 200403 Top Taq Master Mix Kit(250U) 104,000 83,200 201203 Taq DNA Polymerase
More informationPowerPoint 프레젠테이션
mrna (messenger RNA) : 양이가장적다 ( 전체 RNA 중 5-10% 이하 ) : mrna의염기서열은단백질의아미노산순서를지정 : 성장하는세포는수많은다른단백질을필요로함으로 mrna가만들어져단백질이합성되게한후 nucleotide가재생될수있도록분해된다 (trna, rrna도재생 ) : 5 말단의끝이 7-methyl guanosine triphosphate
More information03±èÀçÈÖ¾ÈÁ¤ÅÂ
x x x x Abstract The Advertising Effects of PPL in TV Dramas - Identificaiton by Implicit Memory-based Measures Kim, Jae - hwi(associate professor, Dept. of psychology, Chung-Ang University) Ahn,
More informationAnalysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities
More information182 동북아역사논총 42호 금융정책이 조선에 어떤 영향을 미쳤는지를 살펴보고자 한다. 일제 대외금융 정책의 기본원칙은 각 식민지와 점령지마다 별도의 발권은행을 수립하여 일본 은행권이 아닌 각 지역 통화를 발행케 한 점에 있다. 이들 통화는 일본은행권 과 等 價 로 연
越 境 하는 화폐, 분열되는 제국 - 滿 洲 國 幣 의 조선 유입 실태를 중심으로 181 越 境 하는 화폐, 분열되는 제국 - 滿 洲 國 幣 의 조선 유입 실태를 중심으로 - 조명근 고려대학교 BK21+ 한국사학 미래인재 양성사업단 연구교수 Ⅰ. 머리말 근대 국민국가는 대내적으로는 특정하게 구획된 영토에 대한 배타적 지배와 대외적 자주성을 본질로 하는데, 그
More information현대패션의 로맨틱 이미지에 관한 연구
한지닥섬유제품의인체생리반응및쾌적성평가 임순 Evaluation of Thermal Physiological Responses and Comfort in Dox Fabric Soon Im Professor, Dept. of Fashion Industry, Incheon National University This study performed the evaluation
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More informationChapter 14 유전정보 (Genetic Information) A + G = C + T 일정 ( 샤가프룰 ] - Watson & Crick(1953년 ) : double helix model of DNA( 이중나선구조 ) 제시 1. 유전정보의전달경로 DNA 상의정
Chapter 14 유전정보 (Genetic Information) A + G = C + T 일정 ( 샤가프룰 ] - Watson & Crick(1953년 ) : double helix model of DNA( 이중나선구조 ) 제시 1. 유전정보의전달경로 DNA 상의정보를 RNA로옮겨주는과정 ex) retrovirus 2. DNA Replication ( 유전자복제
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More information<5B313132385D32303039B3E220C1A634B1C720C1A632C8A320B3EDB9AEC1F628C3D6C1BE292E687770>
디지털 영상에서의 자막추출을 이용한 자막 특성 분석에 관한 연구 이세열 * 요약 본 연구는 방송 프로그램 제작에 있어서 중요한 역할을 담당하고 있는 영상 자막의 특성과 영상 커 뮤니케이션 기능적인 관점에서 나타나고 있는 현상을 살펴본다. 다양한 방송 프로그램에서 활용되고 있는 디지털 영상 자막의 기능은 단순하게 간략한 정보를 전달하는 기능적인 역할을 수행하였다.
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A S
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.461-487 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.461 * - 2008 2018 - A Study on the Change of Issues with Adolescent Problem
More information<303720C7CFC1A4BCF86F6B2E687770>
1) < 論 文 > 라이프스타일 세분화를 통한 실버타운 수요자 분석 133 주택연구 제15권 4호 2007. 12/15(4) : 133~160 Housing Studies Review Vol. 15, No. 4 : 133~160 접수일 : 2007. 7. 9, 심사일 : 2007. 7. 16, 심사완료일 : 2007. 8. 29 라이프스타일 세분화를 통한 실버타운
More informationDBPIA-NURIMEDIA
무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 901 무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 (A Effective Sinkhole Attack Detection Mechanism for LQI based Routing in WSN) 최병구 조응준 (Byung
More informationTOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme
PCR Enzyme 부터 qpcr 까지! PCR 실험은 TOYOBO 로해결하세요! 행사기간 : 7 월 15 일 ~ 9 월 13 일까지 TOYOBO Reagent PCR Enzyme High Quality PCR Enzyme cdna Synthesis Kit qpcr One-step RT Kit Immunoreaction Enhancer Solution 추가
More information878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
More information29(2)-04(임시근).fm
Printed in the Republic of Korea ANALYTICAL SCIENCE & TECHNOLOGY Vol. 29, No. 2, 79-84, 2016 http://dx.doi.org/10.5806/ast.2016.29.2.79 Note ( 단신 ) Performance of MiniPCR TM mini8, a portable thermal cycler
More informationA Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran
More information#Ȳ¿ë¼®
http://www.kbc.go.kr/ A B yk u δ = 2u k 1 = yk u = 0. 659 2nu k = 1 k k 1 n yk k Abstract Web Repertoire and Concentration Rate : Analysing Web Traffic Data Yong - Suk Hwang (Research
More informationuntitled
Original Article Experiences of Unwed Mothers Choi, Yang-Ja 1) Kim, Kwuy-Bun 2) 1) Professor, Redcross College of Nursing, 2) Professor, Kyung Hee University, College of Nursing Science 1) 2) 1) 2) Purpose:
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales
More information학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici
학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: A Study on Organizi
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.441-460 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.441 A Study on Organizing Software Education of Special Education Curriculum
More information(Establishment and Management of Proteomics Core Facility)
(Establishment and Management of Proteomics Core Facility) 1 sample running on SDS-PAGE Gel (10well) 163570 10 16357 1D size marker 225500 100 2255 Buffer(20X, 500ml) 119900 20 5995 Staining
More informationAbstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie
Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung
More information<31335FB1C7B0E6C7CABFDC2E687770>
에너지기후변화교육 4(2):203~211(2014) 203 초등학교 교과서 에너지 단원의 탐구활동과 시각자료 기능 분석 사례 연구 신명경 권경필 * 경인교육대학교 Abstract : This study aimed to analyze energy related inquiry activity and visual materials in elementary textbook.
More information실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양
실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양의시료를대량으로증폭할수있다는장점과그과정이간단하여 Cloning, Sequencing 등의기본기술로응용되었다.
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con
Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency
More informationDNA/RNA Amplification Overview AccuPower PreMix series 는세계적으로기술력을인정받은특허기술로보다경제적인가격과편리한방법으로실험할수있는제품입니다. Conventional PCR, Real-Time PCR 수행을위한 DNA ampli
DNA Amplification RNA Amplification Real-Time PCR Customized PCR DNA/RNA Amplification Phone: 1588-9788 (ext.4->2) Email: accupower-support @bioneer.co.kr DNA/RNA Amplification Overview AccuPower PreMix
More informationProblem New Case RETRIEVE Learned Case Retrieved Cases New Case RETAIN Tested/ Repaired Case Case-Base REVISE Solved Case REUSE Aamodt, A. and Plaza, E. (1994). Case-based reasoning; Foundational
More information27 2, 17-31, , * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** ( :
27 2, 17-31, 2009. -, * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** (: dminkim@cau.ac.kr) 18 한국교육문제연구제 27 권 2 호, 2009. Ⅰ. (,,, 2004). (,, 2006).,,, (Myrick,
More information., (, 2000;, 1993;,,, 1994), () 65, 4 51, (,, ). 33, 4 30, 23 3 (, ) () () 25, (),,,, (,,, 2015b). 1 5,
* 4.,, 3,,, 3,, -., 3, 12, 27, 20. 9,,,,,,,,. 6,,,,,. 5,,,,.. * (2016),. (Corresponding Author): / / 303 Tel: 063-225-4496 / E-mail: jnj1015@jj.ac.kr ., (, 2000;, 1993;,,, 1994), 2000. 2015 () 65, 4 51,
More informationDBPIA-NURIMEDIA
Mass-production of Four Specific Proteins Originated from Deformed Wing Virus, Honeybee-viral Pathogen Joo-seong Lee, Giang Thi Huong Luong and Byoung-Su Yoon* Department of Life Science, College of Natural
More informationMean no. of female showing pheromonereleasing behavior 9 8 7 6 5 4 3 2 1 0 0.0 1.0 2.0 3.0 4.0 5.0 5.5 6.0 6.5 7.0 7.5 8.0 8.5 9.0 Hours after lights-off lights-on No. pairs mated 20 18 16 14 12 10 8 6
More information03-2ƯÁý -14š
Management on hazardous chemicals for production of safe produce Namjun Cho, Sumyeong Hong, Wonil Kim, Byungjun Park Chemical Safety Division, National Academy of Agricultural Science, RDA * Correspondence
More information2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.
2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.8.1. OIE 2012 ver. - EU ASF reference lab CISA-INIA(Spain)
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:3~20 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/27, Published: 2016/12/30 [ABSTRACT] This study aims to comprehensively analyze
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 6, Jun Rate). STAP(Space-Time Adaptive Processing)., -
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Jun.; 29(6), 457463. http://dx.doi.org/10.5515/kjkiees.2018.29.6.457 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Sigma-Delta
More information(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re
EMF Health Effect 2003 10 20 21-29 2-10 - - ( ) area spot measurement - - 1 (Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern
More information10(3)-12.fm
w y wz 10«3y 273~280 (2010.12.) Journal of Korean Society of Urban Environment p yá xá½k w y œw (2010 9 15, 2010 12 2 k) Analysis of Characteristics of Delivered Nonpoint Source Pollution at Forested Watershed
More information뉴스레터6호F?2??訝
February 2009 No.06 Roche Diagnostics Korea Co., Ltd. Focus Tech EDITORIAL February 2009 No.06 Contents Editorial 03 Focus 04 Product 10 Talk 12 Tech 14 Activity 19 Style 22 February 2009 No.06 02 03 FOCUS
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More informationJournal of Educational Innovation Research 2016, Vol. 26, No. 1, pp.1-19 DOI: *,..,,,.,.,,,,.,,,,, ( )
Journal of Educational Innovation Research 2016, Vol. 26, No. 1, pp.1-19 DOI: http://dx.doi.org/10.21024/pnuedi.26.1.201604.1 *,..,,,.,.,,,,.,,,,, ( ).,,,. * 2014. 2015. ** 1, : (E-mail: cajoo@pusan.ac.kr)
More information135 Jeong Ji-yeon 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 머리말 협저불상( 夾 紵 佛 像 )이라는 것은 불상을 제작하는 기법의 하나로써 삼베( 麻 ), 모시( 苧 ), 갈포( 葛 ) 등의 인피섬유( 靭 皮 纖 維 )와 칠( 漆 )을 주된 재료
MUNHWAJAE Korean Journal of Cultural Heritage Studies Vol. 47. No. 1, March 2014, pp.134~151. Copyright 2014, National Research Institute of Cultural Heritage 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 정지연 a 明 珍 素 也
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 16 Jul.; 27(7), 64662. http://dx.doi.org/./kjkiees.16.27.7.646 ISSN 1226-3133 (Print)ISSN 2288-226 (Online) 2D Microwave Image
More information09김정식.PDF
00-09 2000. 12 ,,,,.,.,.,,,,,,.,,..... . 1 1 7 2 9 1. 9 2. 13 3. 14 3 16 1. 16 2. 21 3. 39 4 43 1. 43 2. 52 3. 56 4. 66 5. 74 5 78 1. 78 2. 80 3. 86 6 88 90 Ex e cu t iv e Su m m a r y 92 < 3-1> 22 < 3-2>
More information732 서한길ㆍ서정수ㆍ류민경ㆍ이은혜ㆍ정승희ㆍ한현자 (Moravec and Harrison, 1989; Moravec and Wang, 2002; Wijová et al., 2006).,,,., Philometridae., (Edward, 1996). Seo et al.
한수지 48(5), 731-738, 2015 Original Article Korean J Fish Aquat Sci 48(5),731-738,2015 조피볼락 (Sebastes schlegeli) 선충 (Nematode: Philometridae) 에대한분자생물학적동정및 PCR 검출법개발 서한길 서정수 류민경 이은혜 정승희 한현자 * 국립수산과학원병리연구과
More information자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr
Original Article pissn 1738-2637 J Korean Soc Radiol 2012;67(2):129-134 The Survey of Magnetic Resonance Imaging Quality according to in Korea 1 자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 1 Hyun-Hae
More information<31362DB1E8C7FDBFF82DC0FABFB9BBEA20B5B6B8B3BFB5C8ADC0C720B1B8C0FC20B8B6C4C9C6C32E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 13, No. 4 pp. 1525-1531, 2012 http://dx.doi.org/10.5762/kais.2012.13.4.1525 저예산 독립영화의 구전 마케팅을 위한 스마트폰 모바일 애플리케이션 모델 개발 연구 김혜원 1* 1 청운대학교
More informationAbstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,
More informationThe characteristic analysis of winners and losers in curling: Focused on shot type, shot accuracy, blank end and average score SungGeon Park 1 & Soowo
The characteristic analysis of winners and losers in curling: Focused on shot type, shot accuracy, blank end and average score SungGeon Park 1 & Soowon Lee 2 * 1 Program of Software Convergence, Soongsil
More information<B3EDB9AEC1FD5F3235C1FD2E687770>
오용록의 작품세계 윤 혜 진 1) * 이 논문은 생전( 生 前 )에 학자로 주로 활동하였던 오용록(1955~2012)이 작곡한 작품들을 살펴보고 그의 작품세계를 파악하고자 하는 것이다. 한국음악이론이 원 래 작곡과 이론을 포함하였던 초기 작곡이론전공의 형태를 염두에 둔다면 그의 연 구에서 기존연구의 방법론을 넘어서 창의적인 분석 개념과 체계를 적용하려는
More informationDBPIA-NURIMEDIA
e- 비즈니스연구 (The e-business Studies) Volume 17, Number 3, June, 30, 2016:pp. 273~299 ISSN 1229-9936 (Print), ISSN 2466-1716 (Online) 원고접수일심사 ( 수정 ) 게재확정일 2016. 06. 11 2016. 06. 24 2016. 06. 26 ABSTRACT e-
More information44-3대지.08류주현c
A Comparative Study on the Commuting Regional Type According to the Features of Foreigner Commuting Ju-Hyun Ryu* Abstract The purposes of this study are to identify many implications of commuting regional
More information4ÃÖÁØ¿µ103-128
103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 ABSTRACT A Study on the Recruitment Process of the Parliamentary Councils Jun Young Choi Inha University
More information