Mass-production of Four Specific Proteins Originated from Deformed Wing Virus, Honeybee-viral Pathogen Joo-seong Lee, Giang Thi Huong Luong and Byoung-Su Yoon* Department of Life Science, College of Natural Science, Kyonggi University, Suwon 16227, Korea (Received 20 November 2015; Revised 27 November 2015; Accepted 27 November 2015) Abstract Deformed Wing Virus (DWV) is one of viral pathogens in honeybee and caused a wing deformity and a premature death of honeybee. In this study, capsid protein VP1, capsid protein VP1-VP3 complex, RNA dependent RNA Polymerase (RdRP) and C3G peptidase (C3G) originated from DWV were successfully over-expressed using E. coli expression system, respectively. Each recombinant proteins using pet32a(+) or pmal-c2 system was purified using affinity-column chromatography under optimum expression conditions, Four specific proteins in this study would be use as antigens to generate specific antibodies against DWV. Especially, recombinant RdRP and recombinant C3G might be useful materials to studies on enzymatic analysis and inhibitory assay of DWV. Key words: Deformed wing virus, DWV, RdRP, C3G Peptidase, VP1, VP3 Deformed Wing Virus(DWV) (Apis mellifera L.),, (Varroa destructor) (Anderson, D.L. and J.W.H. Trueman, 2002; Bailey, L. and B.V. Ball, 1991; Ball, B.V. and M.F. Allen, 1989; Ball et al., 1988). DWV,, RNA(positive single strand RNA), Retrovirus, (DNA) DNA ("no DNA-stage"),, RNA (negative single strand RNA), ( RNA). RNA RNA (RdRP; RNA dependent RNA Polymerase) RNA "no DNA- *Corresponding author. E-mail: bsyoon@kyonggi.ac.kr 359
360 stage", DWV RNA RNA, RNA RNA( ). DNA DNA ( ), DNA RNA ( ), RNA DNA ( ), RdRP., C3G Peptidase RNA, mrna polypeptide,. polypeptide (VP1, VP3 ), (Non-structural proteins; RdRP, C3G), C3G /, polypeptide 6 polypeptide. DWV DWV, Ultra-rapid Real-time PCR(Lim et al., 2013), Ultra-Fast High-Performance PCR(Lim, 2013), Real Time PCR(Lee et al., 2005), Loop-mediated Isothermal Amplification (LAMP; No et al., 2010).,. Immunochromatography, /. DWV 2 (VP1 VP3) 2 (RdRP C3G). 4, DWV. 2, DWV. DWV (Apis mellifera L.), DWV RT-PCR. RNA 3 Total RNA Extraction kit(intron Bio Inc., Korea) 1ml lysis buffer 200µl Chloroform (Daejung Inc., Korea), MagNA Lyser Green Beads (Roche, Switzerland) 6,000RPM 60. Total RNA Extraction kit(intron bio, Korea), RNA OD 260nm, Reverse Transcription, RNA ( 70 C ). RNA 3,000ng cdna. 3,000ng RNA 100pmol oligo-dt 65 C 10., ice 5, 100mM DDT, 10mM dntp( 2.5mM), RNase inhibitor, Rocket Script Reverse Transcriptase (10,000U), 5X reaction buffer 42 C 60. GenBank DWV (Accession
Table 1. Information of deformed wing virus (DWV) specific protein primer set Target Primer name Sequence Reference DWV VP1 F GGGGGATCCTTAATAGTAGGTTATGTGCCT DWV VP1 R GGGGTCGACATTCAAAATCTTGAACATGCG DWV VP1 vp3 F GCGGGATCCGGATCTGYTTCCGAYCAAAT DWV DWV VP1 vp3 R DWV RdRp F AGAGTCGACCGCAATAGGGCCCTCAGGCA GGGGGATCCCAGTTAATGAGGAAAAAGGG This study DWV RdRp F TCGGTCGACTGAGTCCAATTCGTCGTTCC DWV polyc3g F GCGGGATCCACTAAGCCTCAGGGATCAA DWV polyc3g R AGAGTCGACAGCTAGCTTTGCATCCACT Fig. 1. The genetic map of Deformed Wing Virus and basic strategy of molecular cloning for DWV VP1 / DWV VP1 VP3 using pmal C2 vector. Fig. 2. The genetic map of DWV and strategy of molecular cloning for DWV Peptidase C3G / RdRP using pet32a or pmal vectors. No. JX878305.1) (http://www.ncbi.nlm.nih.gov/blast), BLAST. 361
362 oligonucleotide (Bionics, Korea) (Table 1). cdna, primer DWV PCR. PCR, 2.5U Taq DNA Polymerase(GeneClone, Korea), 2.5mM dntps, 10 PCR buffer(25mm MgCl 2 ), 10pmol primer set, PCR 94 C 5 pre-denaturation, 94 C 30, 58 C 30, 72 C 1 1cycle, 35cycle, 72 C 10 post-extension. PCR, PCR pbluexcm vector(gene Clone, Korea) T-vector cloning. DNA DNA (SolGent, Korea), DNA,, vector pet32a(+) (Novagen, Germany) pmal- C2(NEB, UK) Expression vector (Fig. 1, Fig. 2).. 37 C 150RPM 6. 50ml, 3,000RPM 15min, 4 C, S750-4B rotor (Union 32R, Hanil Inc., Korea), tube 40ml PBS 2 washing,, 10ml PBS. VCX 500 (Sonic & Materials Inc., USA) S&M 1000 rode, 40% Amplitude, pulse on 0.5 sec, pulse off 0.5 sec, running time 1min 30sec,. 4 C 3,000RPM 15 S750-4B rotor (Union 32R, Hanil Inc., Korea),., 5 probe buffer, 99 C 10, 12% SDS-polyacrylamide gel electrophoresis (SDS-PAGE). DWV DNA GenBank DWV (Accession No. JX878305.1), DWV-VP1, DWV-VP1-VP3, DWV-polyC3G, DWV- RdRP. pmal-c2 vector pet32a vector,. Escherichia coli BL21(DE3). (5ml) 1/25 Sub-culture OD-600 0.6 isopropyl-1-thio-β-d-galactopyranoside (IPTG) 0.6mM SDS-PAGE (pmal-dwv-vp1, pmal-dwv-vp1-vp3, pmal- DWV-polyC3G, pmal-dwv-rdrp, pet32a-dwvpolyc3g). pet32a-dwv-polyc3g, N- C- His tagging, Ni + column(his trap HP, 1ml, GE Healthcare, USA). His trap HP AKTA Start system(ge Healthcare, USA), 20ml His-washing solution(20mm sodium phosphate, 0.5M NaCl, 40mM imidazole, ph 7.4) flow rate 0.5ml/min system, His trap HP His-washing solution UV-detector
. 10ml flow rate 0.5ml/min system (His trap HP ), 10ml His-washing solution. 10ml His-Elution solution(20mm sodium phosphate, 0.5M NaCl, 500mM imidazole, ph 7.4), UV detector, 1ml fraction collector. fraction UV detector, 3ml(3 fraction) 5ml(5 fraction),. pmal-dwv-vp1, pmal-dwv-vp1-vp3, pmal- DWV-polyC3G, pmal-dwv-rdrp, N- Maltose binding protein(mbp),, Maltose MBP Column(MBP trap HP, 1ml, GE Healthcare, USA). MBP trap HP AKTA Start system(ge Healthcare, USA), 20ml MBP-washing solution(20mm Tris-HCl, 200mM NaCl, 1mM EDTA, ph 7.4) flow rate 0.5ml/min system, MBP trap HP MBP-washing solution UV-detector. 10ml flow rate 0.5ml/min system (MBP trap HP ), 10ml MBP-washing solution. 10ml MBP-Elution solution(20mm Tris- HCl, 200mM NaCl, 1mM EDTA, 10mM maltose, ph 7.4), UV detector, 1ml fraction collector. MBP-trap fraction UV detector, 3ml(3 fraction) 5ml(5 fraction),. DWV cdna primer (Table 1) PCR. PCR T-vector cloning, pbx-dwv,. pbx-dwv clone primer DWV Complete sequence(accession No. JX878305.1), DWV Capsid protein VP1 (GenBank accession No. KP739938.1) GB- JX878305.1 97%(791/818), 100% (Fig. 3, Fig. 7). Capsid protein VP1+VP3 (GenBank accession No. KP751410.1), GB-JX878305.1 98%(1145/1167), 99% (Fig. 4, Fig. 8)., DWV RdRP (RNA dependent RNA polymerase) (GenBank accession No. KP739937.1) GB-JX878305.1 96%(832/863), 99% (Fig. 5, Fig. 9)., DWV C3G(C3G peptidase), GB-JX878305.1 100% (828/828), 99% (Fig. 6, Fig. 10). 363
364 Fig. 3. DNA sequence homology between JX878305.1 and pbx DWV VP1. JX878305.1 is complete nucleotides of DWV deposited in GenBank. Alignment analysis was revealed 97% (791/818) homology between nucleotide sequences of pbx DWV VP1 (GenBank accession No. KP739938.1) and 2993 3810 of JX878305.1.
Fig. 4. DNA sequence homology between JX878305.1 and pbx DWV VP1 VP3. JX878305.1 is complete nucleotides of DWV deposited in GenBank. Alignment analysis was revealed 98% (1145/1167) homology between nucleotide sequences of pbx DWV VP1 VP3 (GenBank accession No. KP751410.1) and 5420 4618 of JX878305.1. 365
366 Fig. 5. DNA sequence homology between JX878305.1 and pbx DWV RdRP. JX878305.1 is complete nucleotides of DWV deposited in GenBank. Alignment analysis was revealed 96% (832/863) homology between nucleotide sequences of pbx DWV RdRP (GenBank accession No. KP739937.1) and 8756 9618 of JX878305.1.
Fig. 6. DNA sequence homology between JX878305.1 and pbx DWV polyc3g. JX878305.1 is complete nucleotides of DWV deposited in GenBank. Alignment analysis was revealed 100% (828/828) homology between nucleotide sequences of pbx DWV polyc3g and 7472 8299 of JX878305.1. 367
368 Fig. 7. Amino acid sequence homology between JX878305.1 and pbx DWV VP1. The deduced amino acid sequences based on pbx DWV VP1 (GenBank accession No. KP739938.1) was aligned with the deduced amino acid sequences on 2993 3810 of JX878305.1 The homology between both amino acid sequences was calculated as 100% (273/273). Fig. 8. Amino acid sequence homology between JX878305.1 and pbx DWV VP1 VP3. The deduced amino acid sequences based on pbx DWV VP1 VP3 (GenBank accession No. KP751410.1) was aligned with the deduced amino acid sequences on 5420 4618 of JX878305.1 The homology between both amino acid sequences was calculated as 99% (388/389).
Fig. 9. Amino acid sequence homology between JX878305.1 and pbx DWV RdRP clone. The deduced amino acid sequences based on pbx DWV RdRP (GenBank accession No. KP739937.1) was aligned with the deduced amino acid sequences on 8756 9618 of JX878305.1 The homology between both amino acid sequences was calculated as 99% (286/287). Fig. 10. Amino acid sequence homology between JX878305.1 and pbx DWV polyc3g clone. The deduced amino acid sequences based on pbx DWV polyc3g was aligned with the deduced amino acid sequences on 7472 8299 of JX878305.1 The homology between both amino acid sequences was calculated as 99% (273/276). DNA DWV, 4 vector system pet32a(+) pmal-c2 subcloning. 5, DNA (pdraw32) 369
370 M N 1 2 3 4 5 M N 1 2 3 4 5 M N 1 2 3 4 5 M N 1 2 3 4 5 M 1 2 M 1 2 M 1 2 M N 1 2 3 4 5 M 1 2 M 1 2 Fig. 11. Expression of DWV proteins depends on IPTG concentr ation. All recombinant DNA in E. coli BL21 was cultured until OD600 reach to 0.6 and induced by IPTG to express recombinant DWV proteins. Bacterial cell was collected at 6 hours after induction, respectively. Panel A. pmal DWV VP1, Panel B. pmal DWV VP1 VP3, Panel C. pmal DWV RdRp, Panel D. pmal DWV polyc3g, and Panel E. pet32a DWV polyc3g. Lane M was protein size marker (T&I). Lane N were cultures without IPTG induction. Lanes 1 to 5 were induced culture with 0.1, 0.3, 0.6, 1.0 and 2 mm of IPTG, final concentration, respec tively. pmal-dwv-vp1, 75kDa; pmal-dwv- VP1-VP3, 93kDa; pmal-dwv-polyc3g, 81kDa; pmal-dwv-rdrp, 81kDa;, pet32a-dwv-polyc3g, 50kDa (Fig. 11). IPTG 0.1~0.3mM, (DWV-VP1, -VP1-VP3, RdRP, C3G) pmal vector MBP., pet vector C3G (Fig. 11E). pet32a-dwv-polyc3g Ni + column, pmal-dwv-vp1, pmal-dwv- VP1-VP3, pmal-dwv-rdrp pmal-dwv-polyc3g MBP column. 12% SDS-PAGE Fig. 12. The purifications of recombinant DWV proteins. Panel A. pmal DWV VP1, Panel B. pmal DWV VP1 VP3, Panel C. pmal DWV RdRp, Panel D. pmal DWV polyc3g, Panel E. pet32a DWV polyc3g. Lane M in each panel was protein size marker (T&I). Lane 1 of each panel were total proteins from each culture induced IPTG, lane 2 of each panel were affinity column purif ied recombinant proteins from each culture. (Fig. 12). Bradford assay, pmal-dwv-vp1, pmal- DWV-VP1-VP3, pmal-dwv-polyc3g, pmal-dwv- RdRP, pet32a-dwv-polyc3g 2.71mg/ml(total 8.13mg of recombinant protein /125ml culture), 4.71mg/ml(total 14.13mg of recombinant protein/125ml culture), 2.07mg/ml(total 6.21mg of recombinant protein/125ml culture), 2.57mg/ml(total 7.71mg of recombinant protein/125ml culture), 1.04mg/ml(total 3.12mg of recombinant protein/125ml culture). DWV(Deformed Wing Virus), 2013 (Center for Honeybee disease control) 3 (Yoo et al., 2014). DWV,,.,
,. DWV, VP1, VP3, RdRP, C3G DNA,. RdRP(RNA dependent RNA polymerase) DWV,,,, positive-rna( ) negative RNA( ), negative RNA( ) positive RNA( ). RdRP, RNA (interference; RNAi), (FMDV; Foot-and-Mouth Disease Virus) (MERS-CoV; Middle East Respiratory Syndrome Coronavirus) RdRP,.. DWV-RdRP RdRP., C3G(C3G peptidase) polyprotein 1 DWV,,. DWV,., VP1 VP3, /, (epitope). immunochromatography,. VP1 VP3,. 2014 ( ). Anderson, D. L. and J. W. H. Trueman. 2002. Varroa jacobsoni (Acari:Varroidae) is more than one species. Exp. Appl. Acarol. 24: 165 189. Bailey, L. and B. V. Ball. 1991. Honey bee pathology, 2nd ed. Academic Press, London, England. Ball, B. V. and M. F. Allen. 1988. The prevalence of pathogens in honey bee (Apis mellifera) colonies infested with the parasitic mite Varroa jacobsoni. Ann. Appl. Biol. 113: 237 244. Ball, B. V. 1989. Varroa jacobsoni as a virus vector. In: Cavalloro, R. (Ed.), Present Status of Varroa tosis in Europe and Progress in the Varroa Mite Control. OYce for OYcial Publications of the European Communities, Luxembourg pp. 241 244. Lee, H. M, D. B. Lee, S. H. Han, M. L. Lee, Y. K. Lim, B. S. Yoon. 2005. Identification of Deformed Wing Virus from the Honeybee in Korea and Establishment of PCR Detection Method. J. Apicul 20: 85 94. Lim, H. Y. 2013. Development of Novel Rapid Detection Method for Deformed Wing Virus (DWV) using Ultra Fast High Performance PCR (UF HP PCR). J. Apicul. 28: 237 244. Lim, H. Y., B. S. Yoon. 2013. Rapid and Sensitive detection of 371
372 Deformed Wing Virus (DWV) in Honeybee using Ultra rapid Real time PCR. J. Apicul 28: 121 129. No, J. N., Nguyen Van Phu, M. S. Yoo, Y. H. Park, B. S. Yoon. 2010. Simple and Rapid Method for Detection of Deformed Wing Virus (DWV) by Loop mediated Isoth ermal Amplification (LAMP). J. Apicul. 25: 211 216. Yoo, M. S., Y. H. Kim, N. H. Kim, H. N. Jung, Thi B., Reddy K., S. C. Jung, S. W. Kang. 2014. Molecular Detection of Honeybee Disease in Apis mellifera and Apis cerana in Korean apiaries, 2013. The 29th Conference of the Apicultural Society of Korea, 2013, page 66.