The Korean Journal of Microbiology (2011) Vol. 47, No. 2, pp. 103-109 Copyright c 2011, The Microbiological Society of Korea Loop-Mediated Isothermal Amplification (LAMP) 법을이용한 Pectobacterium carotovorum subsp. carotovorum 의신속진단법개발 김정구 1 노지나 2 박동석 1 윤병수 2 * 1 국립농업과학원유전자분석개발과, 2 경기대학교일반대학원생명과학과 Development of a Rapid Detection Method for Pectobacterium carotovorum subsp. carotovorum Using the Loop-Mediated Isothermal Amplification (LAMP) Jeong-Gu Kim 1, Ji-Na No 2, Dong Suk Park 1, and Byoung Su Yoon 2 * 1 Genomics Division, National Academy of Agricultural Science, Rural Development Adiministration, Suwon 441-707, Republic of Korea 2 Department of Life Science, College of Natural Science, Kyonggi University, Suwon 443-760, Republic of Korea (Received April 28, 2011 / Accepted June 15, 2011) Pectobacterium carotovorum subsp. carotovorum is the causative agent of soft rot in crops such as potato and cabbages. Loop-mediated isothermal amplification (LAMP) is a simple DNA amplification method, as well as isothermal PCR technique. In this study, a new method for the rapid detection of Pectobacterium carotovorum subsp. carotovorum was developed using LAMP that named PCC- LAMP. Based on lytic murein transglycolase gene of Pectobacterium carotovorum subsp. carotovorum, a set of four primers for LAMP was designed. The optimal PCC-LAMP reaction temperature was established at 61 C. Under standard conditions, PCC-LAMP amplified 1 10 3 copies of clone PCCpBX437 per reaction. Further, this method can also assay directly by SYBR Green I without electrophoresis. Amplification was not detected for five other bacterial species. In conclusion, PCC-LAMP may be a useful method for the detection Pectobacterium carotovorum subsp. carotovorum in the field. Keywords: Pectobacterium carotovorum subsp. carotovorum, cabbage, detection, LAMP, soft rot Pectobacterium carotovorum subsp. carotovorum (PCC) 은그람음성세균으로 Pectobacterium carotovorum 종의다른아종에비하여숙주범위가매우넓어경제작물이라일컬어지는배추, 양파, 감자등의광범위한식물체에펙틴질을분해하는효소를대량분비하여무름병을일으킨다 (5). 특히재배면적기준으로우리나라제 2작물인배추의경우무름병에의한피해규모가매년 130여 ha에이를정도로그피해가심각하며, 특히전국배추생산량의 72% 를점유하고있는강원도고랭지배추의피해는매우심각하다. 뿐만아니라무름병의피해는재배과정에서뿐만아니라, 저장, 유통중에서도고온다습한환경만주어진다면그피해가기하급수적으로커지는 * For correspondence. E-mail: bsyoon@kyonggi.ac.kr; Tel: +82-31- 249-9645; Fax: +82-31-243-1707 경우도있어그심각성이더해진다. PCC는다른아종에비해균주간에유전적변이가매우다양한것으로알려져있고, 유전체염기서열도최근에야밝혀져염기서열을기반으로한검출방법은많이연구되어있지않다. 특이염기서열을이용한 PCC의검출법으로는 PCR 다형성밴드유래 DNA probe로써배추무름병균을검출하는방법 (3) 과, PCR 진단법 (7) 이보고된바있으나, Southern blot을실시해야한다는번거로움이있을뿐만아니라, 실험실내에서는검출이가능하지만고가의장비와전문적인기술을요하므로현장에직접적용하기에는어려움이많다는제약을가지고있다. Notomi 등 (6) 은등온에서특정유전자를증폭시키는 Loopmediated isothermal amplification (LAMP) 법을고안하였다. 이방법은 strand displacement activity가높은 Bst polymerase
104 Kim et al. Table 1. Bacterial strains used in this study Scientific name Strain No. Pectobacterium carotovorum subsp. carotovorum KACC10371 a Pectobacterium carotovorum subsp. carotovorum KACC10401 Pectobacterium carotovorum subsp. carotovorum KACC10408 Pectobacterium carotovorum subsp. carotovorum KACC10566 Pectobacterium carotovorum subsp. carotovorum KACC13960 Xanthomonas oryzae pv. oryzae MAFF311018 b Shigella dysenteriae ATCC9361 c Salmonella enterica subsp. enterica ATCC13076 Paenibacillus larvae subsp. larvae ATCC25748 Escherichia coli ATCC29552 a b c KACC, Korean Agricultural Culture Collection MAFF, Ministry of Agriculture, Fisheries and Food ATCC, American Type Culture Collection 를이용함으로써 4개의프라이머에의해이루어진다. 먼저내부프라이머가 DNA에결합하여신장되고, 이어그바깥쪽으로외부프라이머가결합되어신장되면서 strand displacement 가발생하며먼저형성된가닥은떨어져나오게된다. 떨어져나온단일가닥의 5 -말단에서부터 loop 구조가형성되며이는 3 -말단에서도같은과정이반복되고 loop 구조가신장되게된다. LAMP를수행하기위해서는증폭시킬유전자의 6개의위치를인식하도록특별히고안된 4개의프라이머를사용하게된다 (2, 10, 13). 이는일반 PCR이 2개의위치를인식하는것과비교했을때, LAMP는 target DNA에대한특이성이매우높아짐을의미한다 (11). LAMP의가장큰특징은등온에서유전자의증폭이이루어진다는점으로, 온도의구배가필요한 PCR에비해서등온조건은몇가지이점을가지고있다. 먼저온도조절이필요없기때문에상대적으로반응시간이짧아진다. 따라서좀더빠른시간내에유전자증폭을가능하게한다. LAMP를이용한다면전기영동시간을제외하고한시간내에유전자증폭이가능함을기존여러논문에서이미보고되었다 (8, 12). 더구나온도변화에따른 DNA 손실및손상이없기때문에증폭효율이매우높다 (4). 또한등온조건에서의증폭은 LAMP가다른검출방법들과달리현장성을가질수있다는근거가된다 (1). 일정한온도만유지하면되기때문에고가의장비가필요없이항온수조등간단한장비만을가지고도반응이가능하다. 따라서 LAMP를이용한다면굳이실험실내에서의환경이아니더라도현장에서특정유전자의검출이가능해진다. 본연구에서는현장적용성이높은 LAMP법을이용하여, 보다신속하고간편하게배추의세균성무름병을유발하는 PCC를검출할수있는진단법을새로이개발하고자하였다. 재료및방법사용균주및배양본연구에서는한국농업미생물자원센터 (Korean Agricultural Culture Collection, KACC) 로부터분양받은 PCC 5균주와특이성검사를위하여 Xanthomonas oryzae pv. oryzae, Shigella dysenteriae, Salmonella enterica subsp. enterica, Paenibacillus larvae subsp. larvae, Escherichia coli 이상 5균주를사용하였다 (Table 1). 사용된균주는영양배지에서유지하였으며, 영양배양액에접종하고 28 C에서 16시간동안진탕배양하였다. Genomic DNA 분리균주의 genomic DNA 추출은 Accuprep R Genomic DNA Extraction kit (Bioneer Inc., Korea) 를사용하였다. 추출방법은제조사의지시를따라수행하였으며, 추출된 Genomic DNA 시료는분광광도계 (Eppendorf, Germany) 를이용하여정량하였다. PCC 클론준비 PCC-LAMP의최적조건을확인하기위하여 ERB3 F/R 프라이머를 (9) 이용하여 PCR을수행하였고 (Table 2), 이 PCR 생성물을삽입시킨 PCC 클론을제작하였다. 본클론은 PCC 의 lytic murein transglycolase 유전자의일부인 437 bp가 pbx vector에포함되어있도록제작되었으며, PCC-pBX437라명명하였고, 클론 PCC-pBX437는최적조건확인, 민감도확인등의실험에 PCR 주형으로사용되었다. LAMP 프라이머제작 LAMP 프라이머디자인소프트웨어인 Primer Explorer (http://primerexplorer.jp/e/index.html) 를이용하여 PCC 특이 LAMP용프라이머를제작하였다. PCC-LAMP의 forward 프라이머인 Inner F는 PCC anti-sense sequence의상보적인염기서열 (inner-sense) 과 TTTT spacer 그리고 loop를형성하는염기서열 (loop-sense) 의부분을합한것으로설계되었으며, 이에따라 44 nt의 long-nucleotide로제작되었다. Reverse 프라이머인 Inner R도마찬가지로 PCC sense sequence의상보적인염기서열 (inner-antisense) 과 TTTT spacer, loop를형성하는 sequence (loop-antisense) 의부분으로설계되었으며, 이에따라역시 44 nt의 long-nucleotide로제작되었다. 또한 Outer F와 Outer R 프라이머는각각 inner 프라이머의바깥쪽에위치하도록설계하였으며각기 19 nt의크기로제작하였다. 이프라이머들은 Bionics 사 (Korea) 에주문의뢰하여제작하였으며 inner 프라이머들에대해서는 PAGE 정제된것을사용하였다 (Fig. 1 and Table 3). Table 2. Specific primers for PCR detection of the PCC gene Target gene Sequence (5 3 ) Product (bp) Lytic murein Transglycolase ERB3-F TGCGACACCTCCTCATCACG ERB3-R CTTATCACGCTGTAACCAGC 437
Pectobacterium carotovorum subsp. carotovorum 의 LAMP 검출법 105 TGCGACACCTCCTCATCACGCTGTTTGTTAGCCCGCTGCTTTTTAGCGCTACGGT CTGTGCCGACACGATCCCTCGTGCCGCGCAGGCGTATCGCAGTGATGTGATCCG outer-f CAGCGCACGGTTGGATTGGGGCATGAATGCCCCGATTGCTGACTTTGCGGCGC inner-sense AGTTGCATCAGGAAAGCGGCTGGAATCCTCGGGCCGTTTCACCCGTCGGTGCG loop-sense CAAGGGCTGGCTCAGTTTATGCCGACCACCGCCGACTGGTTTAGCGGTATCGT loop-antisense inner-antisense TCCTGAACTTCGCGCTAATCAACCGTTTAATCCTGCCTGGGCTATCCGTGCTC outer-r TGACGGGCTACGATCGCTGGCTGTGGACGCGAATCAGCGCCAGCAACGACTGCG AACGTATGGCGATGACCTTGTCGTCCTACAACGGCGGGCTTGGCTGGTTACAGC GTGATAAG Fig. 1. Sequences and locations of four primers for PCC-LAMP. This sequences are show PCC-pBX437 clone. Upper six parts are need for designing four primers to LAMP method. LAMP 법의최적조건확립 PCC-LAMP의특이적검출을위하여반응최적온도를확인하고자하였다. 조성은 PCC-pBX437 클론 1 ng/μl과 20 pm 내부프라이머 (inner primers), 10 pm 외부프라이머 (outer primers), 8 U Bst DNA polymerse large fragment (New England Biolabs, USA), 1 ThermoPol Reaction Buffer [20 mm Tris-HCl, 10 mm KCl, 10 mm (NH 4) 2SO 4, 2 mm MgSO 4, 0.1% Triton X-100, New England Biolabs, USA], 10 mm dntp, 5% DMSO, DW로총 25 μl의반응액을조성하였다. Bst polymerase large fragment는 80 C 이상의온도에서는불활성을나타내므로먼저 94 C에서 5분간해리후바로얼음에옮긴후, 따로첨가하였다. 이후 1시간동안 DNA 변형합성을진행하였고, 80 C에서 10분간반응시킨후종료하였다. DNA 변형합성의최적온도측정은 50.0 C- 65.0 C 사이에서각기등온조건하에서실시하였으며, 각 LAMP 반응이끝난후증폭산물들은 1.5% agarose gel을이용하여 100 V에서 25분간전기영동 (Mupid-one, Advance, Japan) 하였다. Agarose gel은 ethidium bromide (Sigma Chemical Co.) 로염색하여 UV상에서관찰하였다. PCC-LAMP 의프라이머의특이성확인 PCC-LAMP에서는네개의특이프라이머에의한염기서열특이성이요구되므로 4개의프라이머중하나혹은두개이상을제외시켜조성하고정상적인증폭산물과비교하여프라이머의특이성을확인하였다. LAMP 조건은본연구에서확립된표준조건으로수행하였다. PCC-LAMP 의민감도확인 PCC를검출함에있어 PCC-LAMP의검출한계를측정하기위하여초기기질양에따른 PCC-LAMP를각기수행하였다. PCC-pBX437 클론을 1 10 6 부터 1 10 2 까지단계적으로희석하여주형으로사용하였으며, LAMP 조건은본연구에서확립된표준조건으로수행하였다. 주형가닥의 copy수는아래의계산식을따랐다. 23 6 10 ( copies / mol) concentration( g / μl) = amount( copies / μl) MW ( g / mol) PCC-LAMP 의기질특이성확인 PCC-LAMP가 PCC에특이적인지확인하기위하여, PCC 가아닌다른균주들의 Genomic DNA를주형으로사용하여각기 PCC-LAMP를수행하였다. 사용된균주는 Xanthomonas oryzae pv. oryzae (MAFF311018), Shigella dysenteriae (ATCC9361), Salmonella enterica subsp. enterica (ATCC13076), Paenibacillus larvae subsp. larvae (ATCC25748), Escherichia coli (ATCC29552) 이며 Genomic DNA를추출하여같은조건하에 1 ng/μl로각각주형가닥으로하여실험을수행하였고, 이를 positive control과비교하였다. 또한 PCC의 5균주 (KACC10371, KACC10401, KACC10408, KACC10566, KACC13960) 의 Genomic DNA 1 ng/μl를각각주형으로하여실험을수행하여 PCC에대한 PCC-LAMP의반응성을확인하였다. Table 3. The four specific primers for PCC-LAMP Name Sequence (5 3 ) mer Tm ( C) GC (%) Outer F GCAGTGATGTGATCCGCAG 19 59 57 Outer R CCAGGCAGGATTAAACGGT 19 57 52 Inner F GGATTCCAGCCGCTTTCCTGATTTTTGGCATGAATGCCCCGATT 44 71 50 Inner R CGCAAGGGCTGGCTCAGTTTTTTTAGTTCAGGAACGATACCGCT 44 71 l50
106 Kim et al. Fig. 2. Optimal reaction temperature of PCC-LAMP. LAMP was performed under range of 50.0 C to 65.0 C as reaction temperature. Lanes: M, 1 kb ladder (Fermentas); N, negative control without template at 50.0 C; 1 to 9, are LAMP products at 50.4 C, 51.3 C, 52.5 C, 54.2 C, 56.4 C, 58.9 C, 61.0 C, 63.9 C, and 65.0 C, respectively. LAMP products are shown in lanes 1 to 8. Optimal reaction temperature was determined as 61 C in lane 7. SYBR Green I 을이용한 PCC 의형광검출 Exicycler TM Quantitative Thermal Block (Bioneer) 을이용하여 Real-time LAMP를수행하였다. 이는이중가닥에결합하여형광을나타내는 SYBR Green I을이용함으로써증폭산물을형광을통해서쉽게확인하기위함이다. LAMP 조건은확립된표준조건을따르며, 60분의반응동안 1분간격으로형광값을측정하였다. 또한반응이끝난 tube를 UV하에서관찰하여육안으로도형광을확인하였다. 현장시료에서의 PCC 검출 실험실에서배양된균주가아닌, 실제시료에서도 PCC- LAMP가적용가능한지확인하기위하여, 무름병증상을보이는배추의 genomic DNA를추출하여 PCC-LAMP를수행하였다. 동시에무름병에걸리지않은배추와감자의 genomic DNA를주형으로하여 PCC-LAMP를수행함으로써실험결 Fig. 4. Detection limit of PCC-LAMP. Each LAMP was performed under standard condition with different quantities of initial template DNA; lane 1, 1 10 6 ; lane 2, 1 10 5 ; lane 3, 1 10 4 ; lane 4, 1 10 3 ; lane 5, 1 10 2 copies. LAMP products were shown in lanes 1 to 4, so the detection limit of PCC-LAMP was determined as 1 10 3 copies. Lane M is 1 kb ladder (Fermentas). 과를비교 분석하였다. LAMP 법의최적조건확립 결과및고찰 PCC-LAMP의최적반응온도를확인하기위하여반응온도를 50.0 C-65.0 C으로각기등온조건을유지하고실험을수행하였다. 50.4 C부터 63.9 C의범위에서증폭이가능함을확인되었다. 특히 50.4 C에서 58.9 C까지는점점증폭정도가높아지다가 61.0 C가지나면서낮아짐이확인되었고, 따라서 PCC-LAMP의최적온도는약 61 C로판단하였다 (Fig. 2). PCC-LAMP 의프라이머의특이성확인 4개의프라이머에대한 PCC-LAMP의특이성을확인하기위하여프라이머를하나또는두개를제외하여조성한후실험을수행하였다. 4개의프라이머가모두포함된 positive control을제외하고는모두증폭이이루어지지않았다 (Fig. 3). 따라서 PCC-LAMP는프라이머에특이성이높아반응을위해서는 4개의프라이머가모두필요함을확인하였다. Fig. 3. Requirements for four PCC-LAMP primers. LAMP was performed using combinations of primers minus one or two primer(s). Lanes: M, 1 kb ladder (Fermentas); N, negative control without any primers; P, positive control with all primers; 1 to 4, LAMP products lacking inner-f (lane 1), outer-r (lane 2), inner-f and inner-r (lane 3), inner-f and outer-f (lane 4). PCC-LAMP 의민감도확인 PCC-LAMP의검출한계를확인하기위하여 PCC-pBX437 클론을 1 10 6 부터 1 10 2 copy수까지단계적으로희석하여실험을수행하였다. 그결과, copy수가적어질수록반응성이단계적으로낮아지는것을확인하였으며 1 10 6 부터 1 10 3 copy수까지증폭이이루어졌음을확인하였다 (Fig. 4). 따라서 PCC- LAMP는반응당 1 10 3 copy수까지검출이가능한것으로판단하였다. PCC-LAMP 의기질특이성확인 PCC-LAMP의기질특이성을분석하기위하여 PCC 외의병원균의 genomic DNA를주형으로하여실험을수행하였다. Positive control을제외하고다른병원균에서는 PCC-LAMP
Pectobacterium carotovorum subsp. carotovorum 의 LAMP 검출법 107 Fig. 5. Specificity of LAMP primers for PCC specific amplification. LAMP was performed under standard condition. Lane M is 1 kb ladder (Fermentas). Lane N is negative control without template. Lane P is positive control with the clone PCC-pBX437. (A) Template DNAs were from Xanthomonas oryzae pv. oryzae (MAFF311018, lane 1), Shigella dysenteriae (ATCC9361, lane 2), Salmonella enterica subsp. enterica (ATCC13076, lane 3), Paenibacillus larvae subsp. larvae (ATCC25748, lane 4) and Escherichia coli (ATCC29552, lane 5), respectively. Amplification occurred only in the positive control. (B) Template DNA for lanes 1 to 5 were KACC10371, KACC10401, KACC10408, KACC10566, and KACC13960, respectively. All lanes were amplified successfully except the negative control. 가반응하지않은것을확인하였다 (Fig. 5A). 또한 PCC의 5 균주의 genomic DNA를주형으로하여실험을수행함으로써 PCC에대한 PCC-LAMP의반응성을확인하였다. PCC-pBX437 클론으로실험을수행했을때와마찬가지로 PCC genomic DNA에서도높은반응성을보이는것을확인하였다 (Fig. 5B). SYBR Green I을이용한 PCC 의형광검출 PCC-LAMP의증폭산물을전기영동과정없이형광으로확인하기위하여 SYBR Green I을포함하여 real-time LAMP 를수행하여형광도를측정하였고, 반응이끝난 tube는 UV하에서육안으로형광검출여부를확인하였다 (Fig. 6A). Real- (A) (B) (C) Fig. 6. Observation of LAMP product by SYBR Green I. LAMP was performed under standard conditions with SYBR Green I. Tube 1 is negative control without template. Tube 2 is negative control without primers. Tube 3 is positive control. (A) fluorescence under UV light; (B) Electrophoresis of real-time LAMP. Lane M is 1 kb ladder (Fermentas). (C) Fluorescence of real-time LAMP. Polymerization occurred only in the positive control (tube 3).
108 Kim et al. time LAMP의형광증가그래프상에서는 positive control, 즉프라이머와 template가모두존재할때증폭이이루어짐이확인되었다 (Fig. 6C). 이는전기영동상에서도동일한결과를나타내었다 (Fig. 6B). 또한육안으로확인했을때, template를포함하지않은 negative control (tube1) 에서약간의형광이나타나는것이확인되었지만프라이머를포함하지않은 negative control (tube2) 의경우에서봤을때프라이머의비특이적 dimer 형성으로인한형광으로판단하였다. 특히 SYBR Green I에의한육안판별은굳이 real-time LAMP를위해고가의장비를사용하지않더라도 LAMP 반응후, tube에직접 SYBR Green I을첨가해주는것만으로도확인이가능함을확인하였다 ( 자료미제시 ). 프라이머이합체 (primer dimer) 에의한형광은증폭산물에의한형광에비교했을때비교적약하기때문에, SYBR Green I을이용한다면전기영동과정없이쉽게 LAMP 증폭산물을확인할수있을것으로사료된다. 현장시료에서의 PCC 검출실험실에서배양된균주가아닌실제시료에서도 PCC- LAMP 적용이가능한지알아보기위하여무름병증상을보이는배추의 genomic DNA를 PCC-LAMP로진단하였고, 무름병에걸리지않은배추와감자의 genomic DNA를 PCC-LAMP 로진단한결과와비교하였다. 무름병에걸리지않은배추와감자는증폭되지않은반면, 무름병증상을보이는배추는 PCC-LAMP에의해증폭됨을확인하였다 (Fig. 7). 따라서실제시료에서도 PCC-LAMP가적용가능함이확인되었다. 본연구는배추에무름병을일으키는 PCC를보다간단한방법으로검출하기위하여 loop-mediated isothermal amplification (LAMP) 를이용한진단법을개발하였다. PCC-LAMP 로명명된본진단법은 PCC의 lytic murein transglycolase 유전자의일부를포함하는클론을제작하여최적조건이확립되었으며 61 C에서최적반응을보이는것으로확인되었다. 또한최적조건하에서 PCC-pBX437 클론의 1 10 3 copy수의검출한계를확인하였다. Xanthomonas oryzae pv. oryzae, Shigella dysenteriae, Salmonella enterica subsp. enterica, Paenibacillus larvae subsp. larvae, Escherichia coli의 5균주에음성반응이확인된 PCC-LAMP는 PCC 배양균주의 genomic DNA를추출하였을때와실제무름병증상을보이는배추시료에서의양성반응을확인하여 PCC에대한특이성과높은반응성이증명되었다. 무엇보다도 PCC-LAMP은실험실내의환경에서검출뿐만아니라현장적용에초점을맞추었다. 등온증폭이라는특징을가지는 LAMP법을도입함으로써고가의장비가필요없어항온수조등의간단한장비만을가지고 PCC 검출이가능함을확인하였다. 또한 SYBR Green I을이용함으로써형광발현을통하여증폭산물을확인할수있어, 전기영동과정을생략할수있어더욱간단한진단이가능함이입증되었다. 다만 SYBR Green I은 UV 하에서만관찰이가능하므로, 만일육안으로증폭산물을확인할수있는방법이좀더개발된다면 PCC-LAMP는현장에서의 PCC 검출에매우유용한진단법으로응용될수있을것으로기대된다. 적요 Pectobacterium carotovorum subsp. carotovorum (PCC) 는세균성무름병균으로주로감자, 양배추등의식물에서질병을일으킨다. 본연구에서는현장에서신속하게진단하기위해 loop-mediated isothermal amplification법을이용하여 1시간내에등온에서검출가능한진단법을개발하였으며, 이를 PCC-LAMP법이라명명하였다. PCC의 lytic murein transglycolase 유전자를특이적으로증폭시키는 4개의프라이머를제작하였으며최적온도가 61 C임을확인하고최적조건을확립하였다. 최적조건을바탕으로 4개의프라이머가 1 10 3 copies까지검출하는민감성을확인할수있었다. 본연구에서개발된 PCC-LAMP법은특이성검사를통해 PCC만이특이적으로검출됨을확인하였으며, 이는실제시료에서도적용가능함을확인하였다. PCC-LAMP법을통하여 PCC를신속하고정확하게검출함으로써현장에서유용하게적용될수있을것으로사료된다. 감사의말 Fig. 7. Application of PCC-LAMP to field samples. Lanes: M, 1 kb ladder (Fermentas); N, negative control without template; 1 to 4, the LAMP products produced using genomic DNA of healthy potato (lane 1), healthy cabbage (lane 2) and cabbage samples with soft rot (lane 3 and 4) as templates, respectively. Lane 3 and 4 were amplified successfully. PCC-LAMP can apply in field sample. 본연구는농촌진흥청어젠다과제 나노바이오기술융합식물병원균신속다량진단키트개발 의제 5세부과제 초고속및정량 PCR에의한식물병원성세균의정량적예찰 ( 과제번호 200901OFT072251077) 의지원을받아수행되었으며, 저자일동은이에감사하는바입니다.
Pectobacterium carotovorum subsp. carotovorum 의 LAMP 검출법 109 참고문헌 1. Aoi, Y., M. Hosogai, and S. Tsuneda. 2006. Real-time quantitative LAMP (loop-mediated isothermal amplification of DNA) as a simple method for monitoring ammonia-oxidizing bacteria. J. Biotechnol. 125, 484-491. 2. Blomstrom, A.L., M. Hakhverdyan, S.M. Reid, J.P. Dukes, D.P. King, S. Belak, and M. Berg. 2008. A one-step reverse transcriptase loop-mediated isothermal amplification assay for simple and rapid detection of swine vesicular disease virus. J. Virol. Methods 147, 188-193. 3. Kang, H.W., S.J. Go, and S.W. Kwon. 1998. PCR specific detection of Erwinia carotovora subsp. carotovora by DNA probe selected from PCR polymorphic bands. Plant Pathol. J. 14, 164-170. 4. Kiatpathomchai, W., W. Jareonram, S. Jitrapakdee, and T.W. Flegel. 2007. Rapid and sensitive detection of Taura syndrome virus by reverse transcription loop-mediated isothermal amplification. J. Virol. Methods 146, 125-128. 5. Kim, Y.C., D.U. Song, B.H. Cho, and K.C. Kim. 1993. Cloning of the DNA fragment involved in the pathogenicity of Erwinia carotovora subsp. carotovora, plant soft rot bacterium. Plant Pathol. J. 9, 213-217. 6. Nagamine, K., T. Hase, and T. Notomi. 2002. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol. Cell. Probes 16, 223-229. 7. No, J.N., M.S. Yoo, D.S. Park, J.G. Kim, and B.S. Yoon. 2009. Development of a new PCR method for detection of Pectobacterium carotovorum. Kor. J. Microbiol. 45, 306-311. 8. Ohori, A., S. Endo, A. Sano, K. Yokoyama, K. Yarita, M. Yamaguchi, K. Kamei, M. Miyaji, and K. Nishimura. 2006. Rapid identification of Ochroconis gallopava by a loop-mediated isothermal amplification (LAMP) method. Vet. Microbiol. 114, 359-365. 9. Roh, E., S. Lee, D. Fa, J. Choi, E. Moon, and S. Heu. 2009. Diverse antibacterial activity of Pectobacterium carotovorum subsp. carotovorum isolated in Korea. J. Microbiol. Biotechnol. 19, 42-50. 10. Tsugunori, N., H. Okayama, H. Masubuchi, T. Yonekawa, K. Watanabe, N. Amino, and T. Hase. 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, e63. 11. Tsugunori, N. 2007. Loop-mediated isothermal amplification. Nippon Rincho. 65, 957-961. 12. Xu, H.D., J. Feng, Z.X. Guo, Y.J. Ou, and J.Y. Wang. 2009. Detection of red-spotted grouper nervous necrosis virus by loop-mediated isothermal amplification. J. Virol. Methods 163, 123-128. 13. Zhang, F., L. Ma, X. Xu, J. Zheng, Y. Shi, Y. Lu, and Y. Miao. 2009. Sensitive and rapid detection of Karenia mikimotoi (Dinophyceae) by loop-mediated isothermal amplification. Harmful Algae 8, 839-842.