대한진단검사의학회지제 26 권제 3 호 2006 Korean J Lab Med 2006;26:217-22 원저 진단분자유전학 실시간중합효소연쇄반응검사와아가로오스겔전기영동에의한중합효소연쇄반응물의정량검사비교 이미경 김혜련 중앙대학교의과대학진단검사의학교실 Comparison between Real-Time PCR and Agarose Gel Electrophoresis for DNA Quantification Mi-Kyung Lee, M.D. and Hye-Ryoun Kim, M.D. Department of Laboratory Medicine, College of Medicine, Chung-Ang University, Seoul, Korea Background : Real-time polymerase chain reaction (PCR) is generally regarded as a very accurate and time-saving method, but it is expensive to run. We evaluated the reliability of an inexpensive and a researcher-friendly gel electrophoresis-based PCR method for the quantification of mrna, and the results were compared with those obtained by real-time PCR. Methods : We compared the results of relative quantification for measured by real-time PCR and by ethidium bromide stained-agarose gel electrophoresis after end-point PCR. Results : There was significant but very weak correlation between real-time PCR and end-point PCR for relative quantification of (r=0.16, P<0.01). Conclusions : Our results suggest that the use of the gel electrophoresis-based end-point PCR is inappropriate for quantifying mrna. Therefore, in order to confirm the result of relative quantification by end-point PCR, the newly established real-time PCR method or northern hybridization should be applied. (Korean J Lab Med 2006;26:217-22) Key Words : mrna quantification, Real-time PCR, End-point PCR, Agarose gel electrophoresis 서 중합효소연쇄반응 (polymerase chain reaction, PCR) 은주형 DNA를 10 6 에서 10 7 배로증폭시켜민감하게검출할수있는방법으로, 1984년 Mullis와 Faloona에의해개발되어의학을포함한생명과학전분야와식품, 환경등의다양한분야에서널리활용되고있으며 [1], 역전사 (reverse transcription, RT) 반응과함께활용함으로유전자발현 (gene expression) 연구에도많이시도되 접 수 : 2005년 11월 22일 접수번호 : KJLM1907 수정본접수 : 2006년 3월 20일 게재승인일 : 2006년 4월 18일 교신저자 : 이미경 우 140-755 서울시용산구한강로 3가 65-207 중앙대학교용산병원진단검사의학과 전화 : 02-748-9837, Fax: 02-797-3471 E-mail : cpworld@cau.ac.kr 론 * 본논문은 2005 학년도중앙대학교학술연구비지원에의한것임. 고있다. 즉, 전사량을알기위한 mrna 측정에는일반적으로노던블로팅 (Northern blotting) 과인시튜잡종형성 (in situ hybridization)[2], RNase protection assay[3], cdna microarray[4] 및 RT-PCR 등의 5가지방법이사용되고있으며, 이중 RT-PCR 은세포수가적은검체나유전자발현이낮은경우에도측정이가능하여가장예민하고다양하게적용할수있는방법으로평가되고있다 [5, 6]. 따라서 PCR 산물의정확한정량과보다신속하고간편한결과확인에대한요구가증가하고있으나, PCR 반응의끝점 (end-point) 산물을검출하는기존의 PCR은정량시예민도가떨어지거나 PCR 후에많은시간과추가과정이요구되기도하며, 이로인한오염의가능성등으로인해제한이있었다 [7]. 최근 PCR의매주기마다실시간으로시행되는형광의검출과정량을통해 PCR시지수기 (exponential phase) 범위내에서증폭산물을측정하는실시간 (real-time) PCR 방법이도입되어, 기존 RT-PCR에서 PCR 후의복잡한검사과정을줄이고폐쇄관 217
218 이미경 김혜련 분석하에서실시간으로증폭산물을정확하게분석하게되었다 [5, 8]. 그러나아직까지는실시간중합효소연쇄반응검사의도입과검사수행시사용하여야하는전용시약과소모품의구입에많은비용이필요하므로, 실시간중합효소연쇄반응검사장비가없는실험실에서의사용이제한적이다. 이에본연구에서는실시간중합효소연쇄반응검사장비가없는실험실이나보유하고있더라도고가의전용시약사용에제한이있는경우, 기존 PCR을사용하여 PCR 후전기영동과브롬화에티듐 (ethidium bromide, EtBr) 염색만으로측정한유전자발현반정량결과를어느정도신뢰할수있는지를평가하고자하였다. 이를위하여 matrix metalloproteinase-1 () 유전자의 glyceraldehyde-3-phosphate dehydrogenase () 유전자에대한상대정량을실시간중합효소연쇄반응을시행하여얻은결과와실시간중합효소연쇄반응후의끝점 (end-point) PCR 산물을아가로오스겔 (agarose gel) 에전기영동한후농도계측 (densitometry) 의원리에의하여반정량하여얻은결과를비교분석하였다. 대상및방법 1. 시발체합성과표준곡선 (standard curve) 준비 성숙흰쥐 (rat) 의 과 유전자를증폭할수있는시발체는 Primer Express 2.0 (Applied Biosystems, Foster City, CA, USA) 프로그램을이용하여고안하였다 (Table 1). 표준곡선에필요한 genomic DNA는 Wizard Genomic DNA Purification Kit (Promega, Madison, WI, USA) 를사용하여추출한후, 각각의유전자들을 PCR로증폭하였다. 이때의 PCR 반응액은시발체각각 0.5 M, dntp 250 M, Tris-HCl (ph 8.3) 10 mm, KCl 50 mm, MgCl 2 1.5 mm, Taq DNA polymerase (Roche Diagnostic Corp., Indianapolis, IN, USA), 0.5 unit, DNA 주형 (template) 4 L에멸균증류수를첨가하여총 20 L로만들었다. PCR 은자동온도조절기 (GeneAmp PCR system 9700, Perkin Elmer, Foster City, CA, USA) 를이용하여 94 에서 5분간전변성시킨후, 94 에서 30초, 55 에서 30초및 72 에서 30초씩 35회증폭하고마지막으로 72 에서 10분동안연장반응시켰다. 각각의증폭산물은 2% 아가로오스겔에서전기영동한후 EtBr로염색하여자외선하에서증폭산물을확인하였 Table 1. Primers used for PCR Primers Oligonucleotide sequence (5-3 ) Forward TGGGATTTCCAAAAGAGGTG Reverse ACGTGGTTCCCTGAGAAGA Forward AATGTATCCGTTGTGGATCTGA Reverse AGCCCAGGATGCCCTTTA Abbreviations: See text. Product size (bp) 121 122 으며, QIAquick PCR purification kit (Qiagen, Valencia, CA, USA) 로정제한후 4 L씩분주하여 -75 에보관하다가 realtime PCR시 10배씩연속적으로희석하여 (; 7 10-6 -7 10-9, ; 9 10-6 -9 10-9 ) 표준곡선을위한주형으로사용하였다. 2. 총 RNA 분리총 RNA는 30마리의성숙흰쥐의대퇴골골절부가골부위로부터 RNAqueous TM -4PCR (Ambion, Austin, TX, USA) 을사용하여추출하였으며, 추출된 RNA 용액에남아있을 DNA 제거를위하여 DNase I (2 units/ L) 과완충액을가하여 37 에서 1시간동안반응시켰다. 3. cdna 합성 cdna 합성을위한역전사는 1st Strand cdna Synthesis Kit for RT-PCR (Roche Diagnostic Corp.) 을사용하여시행하였으며, 총 RNA 10 L와 10 반응완충액 (100 mm Tris, 500 mm KCl, ph 8.3) 5 L, 25 mm MgCl 2 10 L, dntp mix (datp, dctp, dttp, dgtp, 각각 10 mm) 5 L, random primer p(dn) 6 5 L, RNase inhibitor 2.5 L, AMV reverse transcriptase 2 L에 DEPC-처리멸균증류수를첨가하여총 50 L로만들었다. 역전사반응은자동온도조절기 (GeneAmp PCR system 9700) 에서 25 에서 10분, 50 에서 60분간반응시키고역전사효소의불활성화를위해 99 에서 5분간반응시켰다. 4. 실시간중합효소연쇄반응검사실시간중합효소연쇄반응검사는 ABI PRISM 7000 (Applied Biosystems) 을사용하여시행하였다. PCR 반응액은 2 SYBR Green PCR Master Mix (Applied Biosystems) 12.5 L, 시발체각각 320 nm, DNA 주형 2 L를넣고멸균증류수를첨가하여총 25 L가되게하였고, 50 에서 2분, 95 에서 10분간반응시킨후 95 에서 15초, 60 에서 1분씩 40회반응시키는조건으로증폭하였다. 이때 SYBR Green I은 PCR로합성된이중나선 DNA에결합하여형광을나타내게되므로, 반응이진행됨에따라발생하는형광신호를각주기마다감지하여유전자증폭양상을실시간으로분석함으로증폭산물의생성량을측정하게된다. 즉증폭의초기에는형광의증가가감지되지않으나일정주기가지나면축적된형광량이비로소기기에감지되기시작하는데, 이렇게형광량이감지될수있을정도로두드러지게증가하는시점의주기수를역치주기 (C T, threshold cycle) 로명명하고있다. 그러므로분석하고자하는검체에서대상유전자의 C T 값을측정하면, 농도를알고있는대상유전자의증폭산물을단계적으로희석하여 PCR 을시행한검체로부터그려진표준곡선을이용하여대
실시간중합효소연쇄반응검사와아가로오스겔전기영동에의한중합효소연쇄반응물의정량검사비교 219 28 26 Rn a b c d Ct 24 22 20 18 1 5 10 15 20 25 30 35 40 Cycle Number A 16 0 0.4 0.8 1.2 1.6 2 2.4 2.8 3.2 Log Co B Fig. 1. (A) Generation of an external standard curve for real-time PCR (a: 7 10-6, b: 7 10-7, c: 7 10-8, d: 7 10-9 ng/ L). The graph shows the interrelationship between log F (fluorescence) and the amplification cycle; background levels are indicated by the horizontal line. The cycle at which the sample fluorescence crosses the background line is set as the threshold cycle (C T ). (B) Standard curve of for real-time PCR. The graph shows the regression curve resulting from threshold determinations for the serially diluted PCR products. a b c d 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 NTC 한결과로부터그려진표준곡선을이용하여 PCR 증폭산물을정량검사하였다 (Fig. 2). 6. 유전자의상대정량실시간중합효소연쇄반응과아가로오스겔전기영동에의한대상유전자발현은 PCR 간의변이를보상하기위하여기준유전자 () 에대한대상유전자 () 의비율을계산하여상대정량하였다. Fig. 2. Quantification of mrna by RT-PCR and ethidium bromide-stained agarose gel electrophoresis. Quantification of and was accomplished using densitometry of the dye binding intensity of UV-irradiated PCR products. A standard curve was calculated with four values (a, b, c, d) ranging from 7 10-6 to 7 10-9 ng/ L () or 9 10-6 to 9 10-9 ng/ L () PCR product and serves for the quantification of other samples. Expression of was normalized to that of expression in the same sample. Abbreviation: NTC, no template control. 상유전자의 PCR 증폭산물의양을산출할수있었다 (Fig. 1). 또한증폭이끝난 PCR 산물의해리곡선 (dissociation curve) 분석을시행하여증폭산물의융해온도를확인함으로써유전자증폭시단일산물이증폭됨을확인하였다. 5. 아가로오스겔전기영동에서끝점 PCR 산물의정량 증폭이끝난 PCR 산물을 2% 아가로오스겔에전기영동한후 1 g/ml EtBr로염색하고, Image system (ChemiDoc XRS system, Bio-Rad Laboratories, Hercules, CA, USA) 의 Quantity One 프로그램을사용하여자외선 (UV) 투시하에서방출되는형광강도를측정하였다. 이때농도를알고있는각유전자의증폭산물을 10배씩연속적으로희석하여 (10-6 -10-9 ) PCR을시행 결과 과 정량을위한표준곡선의직선식은 realtime PCR에서는 y=-3.55x+28.36, r 2 =1.00 () 와 y= -3.27x+25.87, r 2 =0.99 () 이었고, end-point PCR에서는 y=0.129x-178, r 2 =0.86 () 과 y=0.239x-620, r 2 =0.89 () 이었다. 실시간중합효소연쇄반응과끝점 PCR 산물의아가로오스겔전기영동에의한 과 유전자에대한정량값은상관계수가각각 r=0.33과 r=0.35로낮은상관관계를보였다. 기준유전자로이용한 유전자에대한대상유전자의비율을계산하여얻은 유전자의상대정량값의두가지정량방법간의상관계수가 r=0.16으로매우낮은 (P<0.01) 상관관계를나타내었다 (Table 2, Fig. 3). 고찰 mrna 정량을통한유전자발현연구에서 RT-PCR에의한유전자정량은 mrna의작은변화까지검출할수있어유용한방
220 이미경 김혜련 Relative quantification of 1,400.00 2,000.00 2.000 1,200.00 1,000.00 1,500.00 1.500 800.00 r=0.35 (P<0.01) r=0.33 (P<0.01) 1,000.00 600.00 1.000 r=0.16 (P<0.01) 400.00 500.00 0.500 200.00 0.00 0 500 1,000 1,500 2,000 0.00 0 500 1,000 1,500 2,000 2,500 0.000 0.000 5.000 10.000 15.000 Real-time PCR A Real-time PCR B Real-time PCR C Fig. 3. Comparison between real-time PCR and end-point PCR in (A) mrna (B) mrna (C) relative quantification of ( mrna/ mrna). End-point PCR End-point PCR End-point PCR Table 2. Comparison between real-time PCR and end-point PCR for relative quantification of mrna Relative quantification Sample No. Realtime Endpoint Realtime Endpoint Realtime Endpoint 1 133.34 785.93 50.11 1,390.91 2.661 0.565 2 41.27 806.59 110.25 1,559.97 0.374 0.517 3 173.13 956.55 25.3 1,384.62 6.843 0.691 4 229.86 852.65 2167.76 1,509.51 0.106 0.565 5 21.95 450.22 10.93 1,333.75 2.008 0.338 6 16.94 581.85 7.12 1,295.86 2.379 0.449 7 42.05 731.35 46.99 1,204.99 0.895 0.607 8 4 366.79 5.74 1,021.11 0.697 0.359 9 58.85 751.50 21.29 884.75 2.764 0.849 10 628.74 1,157.66 777.14 1,455.70 0.809 0.795 11 142.39 858.29 88.25 1,545.09 1.613 0.555 12 21.56 548.06 56.76 1,169.34 0.380 0.469 13 19.55 591.42 14.88 1,211.33 1.314 0.488 14 1840.96 874.13 651.64 1,743.09 2.825 0.501 15 11.58 812.12 10.82 1,174.49 1.070 0.691 16 18.23 917.67 8.04 1,131.10 2.267 0.811 17 178.95 829.85 65.84 1,181.92 2.718 0.702 18 80.01 471.76 6.88 928.17 11.629 0.508 19 29.31 323.95 40.39 719.10 0.726 0.450 20 281.63 699.46 93.55 1,290.77 3.010 0.542 21 34.53 565.73 69.37 709.57 0.498 0.797 22 68.08 910.43 41.18 933.42 1.653 0.975 23 44.23 760.76 181.94 1,479.11 0.243 0.514 24 85.67 979.26 15.53 1,043.86 5.516 0.938 25 257.68 1,002.67 35.68 1,290.96 7.222 0.777 26 174.44 1,015.18 29.45 687.77 5.923 1.476 27 46.43 808.28 36.01 670.16 1.289 1.206 28 315.7 1,098.05 46.06 1,014.53 6.854 1.082 29 74.97 508.23 6.74 1,454.64 11.123 0.349 30 25.82 378.27 169.32 1,365.38 0.152 0.277 31 99.87 299.56 29.7 185.33 3.363 1.616 Abbreviations: See text. 법이지만재현성이낮은것이문제로알려져있어, 검체처리와 RNA 추출, cdna 합성을위한역전사반응, PCR 및 PCR 산물의정량등각단계별엄격한정도관리가요구되고있다 [9]. 본연구에서는 PCR 산물의정량시실시간중합효소연쇄반응검사 와끝점 PCR 후전기영동에의한유전자정량결과를비교하기위하여, 검체처리에서 PCR까지동일한검체로시행한후결과를비교하여보았다. 대상유전자인 과기준유전자인 GA- PDH 유전자에대한정량값이두방법간에모두낮은상관관계를보여, 이들유전자의정량값을이용한 유전자의상대정량값역시두방법간에매우낮은상관관계를보였다. 유전자상대정량시본연구결과에서얻은실시간중합효소연쇄반응과끝점 PCR 후전기영동에의한유전자정량값이차이를보일수있는가능성에대하여검토하여보았다. 첫째, PCR은대상유전자의증폭효율에따라반응단계를크게세부분으로나눌수있다. 즉, PCR의매주기마다정확하게 PCR 산물이배가되는반응초기로 100% 의반응효율을보여매우특이적이고정확한반응단계인지수기혹은로그기와반응성분들이소모되어반응이느려지거나일부증폭산물이분해되기시작하여반응의효율도가검체마다매우다양하게나타날수있는선형기 (linear phase), 그리고반응성분들의소모가진행되고반응부산물에의한합성반응의저해등으로반응의효율이감소하여증폭반응이중단되거나증폭산물의분해가나타날수있는편평기 (plateau phase) 또는끝점기 (end-point phase) 가있다 [10, 11]. 따라서끝점 PCR의경우편평기에서측정을하게됨으로 PCR 반응의효율이감소되어증폭반응이중단되거나증폭산물의분해가나타나 PCR 증폭산물이정확하게초기의주형량을반영하지않았을가능성이있다. 둘째, mrna 정량시검사내정밀도가기존의 RT- PCR에서끝점 PCR 산물을전기영동하여 EtBr로염색하고농도계측의원리로정량한경우 (CV=44.9%) 가 SYBR green I을사용하여실시간중합효소연쇄반응에의해얻은정량값 (CV=14.2%) 보다낮았다는보고도있어 [12], 끝점 PCR에의한정량이실시간중합효소연쇄반응에비해변이가크다는점이가능한원인으로생각된다. 셋째, DNA 정량시측정가능한동적범위 (dynamic range) 의차이를생각수있다. 일반적으로기존의끝점 PCR 후 EtBr로염색하여정량하는방법에비해실시간중합효소연쇄반응에의한정량방법이동적범위가크다고알려져있다 [12]. EtBr은두가닥 DNA의인접한염기쌍사이에삽입할수있는방향성의평면구조를가지고있고 [13], DNA 염기구성의차이에영향을받지않으면서 DNA에결합하면형광이증가되는능력이있어,
실시간중합효소연쇄반응검사와아가로오스겔전기영동에의한중합효소연쇄반응물의정량검사비교 221 DNA를확인하는방법으로많이사용되고있다. 그러나아가로오스겔에서의해상도는약 10배이상의차이가있어야감별이가능한정도이다. 끝점 PCR에의한증폭산물을측정하는방법에는 EtBr 이나 SYBR green과같은 DNA 삽입형광색소를사용하거나결합된방사능측정 [14], 써던블롯과같은보합반응을이용한방법, 형광이나발광을내는효소에결합시킨고체상을이용하는방법 [15, 16], 그리고고성능액체크로마토그래피 (HPLC)[17] 나모세관전기영동 [18] 등이있다. 이들방법중 PCR 후아가로오스겔에전기영동하여 EtBr로염색하는것은기존검사실에서친숙한방법으로간편하고경제적이어서 [19, 20], 현재 PCR 산물의정량을위한방법중가장신뢰할수있는방법으로생각되고있는실시간중합효소연쇄반응검사결과와상관성이좋으면실시간중합효소연쇄반응검사장비가없는검사실에서도이방법을이용하여어느정도신뢰성있는예비실험결과를얻을수있으므로 PCR 산물의정량을통한유전자발현연구에쉽게접근할수있을것으로기대되어본연구를시도하였다. 그러나본연구에서끝점 PCR 결과가초기주형량을정확하게반영하는것으로알려져있으며노던블롯법과도우수한상관을보인다고보고된 [21] 실시간중합효소연쇄반응검사정량값과매우낮은상관관계를보여, 끝점 PCR 후전기영동과 EtBr 염색을통한 mrna 정량은정확한결과를얻기어려울것으로생각되므로기존의끝점 PCR에의한유전자정량결과는실시간중합효소연쇄반응검사나노던블롯법으로검증하는과정이필요할것으로사료되었다. 또한유전자발현연구시 mrna의작은변화까지도검출할수있다고알려진 RT- PCR에서실시간중합효소연쇄반응검사결과의신뢰도를높이기위하여 PCR 효율이나표준곡선의제조등각단계별정도관리와실시간중합효소연쇄반응검사에의한상대정량값의통계학적인차이가유전자발현에미치는기능적차이를확인하는연구가지속적으로이루어져야할것으로사료되었다. 요약배경 : 최근 PCR의매주기마다증폭산물을측정하는실시간 (real-time) PCR 방법이도입되어, 증폭산물을정확하게분석하게되었다. 그러나실시간중합효소연쇄반응검사도입과검사수행시사용하여야하는전용시약과소모품의구입에많은비용이필요하므로, 실시간중합효소연쇄반응검사장비가없는실험실에서의사용이제한적이다. 이에본연구에서는기존의끝점 PCR을사용하여전기영동과브롬화에티듐 (EtBr) 염색만으로신뢰할수있는유전자발현연구를수행할수있는지를실시간중합효소연쇄반응검사법과의비교분석을통하여평가하고자하였다. 방법 : 실시간중합효소연쇄반응검사를시행하여얻은정량값과실시간중합효소연쇄반응검사후의끝점 PCR 산물을아가로오스겔에전기영동한후브롬화에티듐으로염색하고자외선투시 하에서방출되는형광강도를측정하여정량한결과로각각 MMP- 1 유전자의상대정량을시행하여비교하였다. 결과 : 실시간중합효소연쇄반응검사와끝점 PCR 산물의아가로오스겔전기영동에의한 유전자의상대정량값은상관계수가 r=0.16 (P<0.01) 으로매우낮은상관관계를나타내었다. 결론 : 끝점 PCR 후전기영동과브롬화에티듐염색을통한 mrna 정량은정확한결과를얻기어려울것으로생각되므로, 기존의끝점 PCR에의한유전자정량결과는실시간중합효소연쇄반응검사나노던블롯법으로검증하는과정이필요할것으로사료되었다. 참고문헌 1. Mullis KB and Faloona FA. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol 1987;155: 335-50. 2. Parker RM and Barnes NM. mrna: detection by in situ and northern hybridization. Methods Mol Biol 1999;106:247-83. 3. Hod Y. A simplified ribonuclease protection assay. Biotechniques 1992;13:852-4. 4. Clarke PA, te Poele R, Wooster R, Workman P. Gene expression microarray analysis in cancer biology, pharmacology, and drug development: progress and potential. Biochem Pharmacol 2001;62:1311-36. 5. Bustin SA. Absolute quantification of mrna using real-time reverse transcription polymerase chain reaction assays. J Mol Endocrinol 2000;25:169-93. 6. Wang T and Brown MJ. mrna quantification by real time TaqMan polymerase chain reaction: validation and comparison with RNase protection. Anal Biochem 1999;269:198-201. 7. Holland PM, Abramson RD, Watson R, Gelfand DH. Detection of specific polymerase chain reaction product by utilizing the 5 3 exonuclease activity of Thermus aquaticus DNA polymerase. Proc Natl Acad Sci USA 1991;88:7276-80. 8. Higuchi R, Fockler C, Dollinger G, Watson R. Kinetic PCR analysis: real-time monitoring of DNA amplification reactions. Biotechnology 1993;11:1026-30. 9. Ovstebo R, Haug KB, Lande K, Kierulf P. PCR-based calibration curves for studies of quantitative gene expression in human monocytes: development and evaluation. Clin Chem 2003;49:425-32. 10. Heid CA, Stevens J, Livak KJ, Williams PM. Real time quantitative PCR. Genome Res 1996;6:986-94. 11. Wittwer CT, Herrmann MG, Moss AA, Rasmussen RP. Continuous fluorescence monitoring of rapid cycle DNA amplification. Biotechniques 1997;22:130-1, 134-8. 12. Schmittgen TD, Zakrajsek BA, Mills AG, Gorn V, Singer MJ, Reed
222 이미경 김혜련 MW. Quantitative reverse transcription-polymerase chain reaction to study mrna decay: comparison of endpoint and real-time methods. Anal Biochem 2000;285:194-204. 13. Heath PJ, Clendenning JB, Fujimoto BS, Schurr JM. Effect of bending strain on the torsion elastic constant of DNA. J Mol Biol 1996;260: 718-30. 14. Schneeberger C, Speiser P, Kury F, Zeillinger R. Quantitative detection of reverse transcriptase-pcr products by means of a novel and sensitive DNA stain. PCR Method Appl 1995;4:234-8. 15. Hall LL, Bicknell GR, Primrose L, Pringle JH, Shaw JA, Furness PN. Reproducibility in the quantification of mrna levels by RT-PCR- ELISA and RT competitive-pcr-elisa. BioTechniques 1998;24: 652-8. 16. Siddiqi AM, Jennings VM, Kidd MR, Actor JK, Hunter RL. Evaluation of electrochemiluminescence- and bioluminescence-based assays for quantitating specific DNA. J Clin Lab Anal 1996;10:423-31. 17. Hayward-Lester A, Oefner PJ, Sabatini S, Doris PA. Accurate and absolute quantitative measurement of gene expression by single-tube RT-PCR and HPLC. Genome Res 1995;5:494-9. 18. Borson ND, Strausbauch MA, Wettstein PJ, Oda RP, Johnston SL, Landers JP. Direct quantitation of RNA transcripts by competitive single-tube RT-PCR and capillary electrophoresis. Biotechniques 1998;25:130-7. 19. Huber R, Kunisch E, Gluck B, Egerer R, Sickinger S, Kinne RW. Comparison of conventional and real-time RT-PCR for the quantitation of jun protooncogene mrna and analysis of junb mrna expression in synovial membranes and isolated synovial fibroblasts from rheumatoid arthritis patients. Z Rheumatol 2003;62:378-89. 20. Bradford WD, Cahoon L, Freel SR, Hoopes LL, Eckdahl TT. An inexpensive gel electrophoresis-based polymerase chain reaction method for quantifying mrna levels. Cell Biol Educ 2005;4:157-68. 21. Frade JP, Warnock DW, Arthington-Skaggs BA. Rapid quantification of drug resistance gene expression in Candida albicans by reverse transcriptase LightCycler PCR and fluorescent probe hybridization. J Clin Microbiol 2004;42:2085-93.