Microsoft Word - 09-권오식.doc
|
|
- 수나 한
- 5 years ago
- Views:
Transcription
1 J. Biomed. Lab. Sci. 10 (2004) A Study on DNA Sequences and Mutation of Integrase Region of Korean-type Bovine Leukemia Virus (BLV) pol Gene Oh-Sik Kwon 1, Jung-Soon Kang 2, Hyun-Jin Park 3 and Min Yoo 4 1 Department of Microbiology, Keimyung University, Daegu , Korea 2 Molecular Structure Unit, KRIBB, Daejeon, , Korea 3 Radiation Cytogenetics Team, Radiological & Medical Sciences Research Center Korea Insititute of Radiological & Medical Sciences, Seoul, Korea, 4 Department of Biology, Keimyung University, Daegu , Korea Bovine leukemia virus (BLV) is a causative agent for lymphoma disease in cattle including cows worldwide. BLV shares similar virion structure and characteristics with other retroviruses. The pol gene of the BLV genome produced reverse transcriptase (RT) and integrase (IN) for important roles for BLV genome integration into host cell chromosomes that is known to be coded in the 3' side of the BLV pol gene (one third portion). In this study, we have sequenced 978 bp in the 3' side of the BLV pol gene from BLV 10C3 in order to determine the BLV IN region of it. And we compared it to the nucleotide sequences of an Australian BLV isolate. As a result, nucleotide sequences of the IN region of the Korean-type BLV pol gene were mutated at a rate of 3.7%. We can confirm that the typical mutations are such as Arg (AGG) Lys (AAG), Thr (ACG) Met (ATG), Ile (ATT) Val (GTT), Asn (ACC) His (CAC), Phe (TTT) Leu (TTG) and Asn (ACC) Asp (GAC). From the analysis of the sequencing data, we were able to determine the zinc-finger-like "HHCC" motif in the amino terminus of BLV IN, that was H-X 3 -H-X 25 -C-X 2 -C. It was also found the DD35E motif in the IN catalytic domain as D-X 56 -D-X 35 -E. It fits very well to the consensus sequences of retroviral IN as well as HHCC motif. Key Words: BLV, pol gene, Integrase, IN, Mutation, HHCC, DD35E 서 소백혈병은젖소를포함한소에서가장흔히발생하는임파구종양성질병이다. 이는성우의대표적인전염성질병으로 retrovirus인소백혈병바이러스 (bovine leukemia virus, BLV) 에의해야기되며 18) 전세계적으로발생하고있으나이의발생률은지역적으로차이가심한것으로알려져있다 11). BLV는구조적특성으로인하여 C-형 Oncornavirinae로분류되고있으나전형적인암유전자를가지고있지않으며인간의임파종역전사효소바이러스인 HTLV-I/II와분자적성격, 게놈의구조및형태가유사하다 15). BLV 는비리온내에 2개의동일한단쇄선형인약 8.4 kb 뉴클레오티드의 (+) * 논문접수 : 2004년 1월 20일수정재접수 : 2004년 2월 9일 별책요청저자 : 권오식, ( 우 ) 대구광역시달서구신당동 1000번지, 계명대학교자연과학대학미생물학과 Tel: , Fax: biv@kmu.ac.kr 론 sense RNA를갖지만, 이것이숙주세포내에서는염색체에통합되어 provirus 상태인복쇄 DNA로존재한다 1). BLV 게놈은 5'-LTR-gag-pol-env-LTR-3' 구성을갖는데 pol gene은 2,599 bp로역전사효소 (RT) 와통합효소 (IN) 를암호화하고있다. 역전사효소와통합효소는바이러스 mrna를 DNA로바꾸어주며바이러스감염후숙주세포에 provirus DNA 상태로통합할수있게하여지속적감염을가능케하는가장중요한 retroviral 효소들이다 6,17,19). 특히 RT는 primer를이용하여데옥시뉴클레오시드 5'-삼인산을연결시켜서이중가닥의 DNA- RNA를생성하기위해 RNA 분자를복사하며, DNA-RNA 혼성체에서 RNA를분해시켜서상보적인 DNA 가닥의합성을개시하는 RNA 내부핵산가수분해효소활성 (e.g., RNase H) 을가진다 19). 한편 pol gene의 3' 영역에는이유전자의 3분의 1의크기를점유하는 integrase (IN) 유전자가존재하는데 2,6), 이의산물은 viral ds DNA를세포의염색체 DNA에공유결합으로연결하여통합시킨다. 이것은 viral DNA의 3' 에대한내부핵산가수분해효소활성을포함하는것으로표적 DNA의절
2 단과세포성 DNA에바이러스를연결하는연결효소기능을갖고있다 4). 그리고, 숙주세포의 DNA에통합된바이러스는세포를파괴시키지않고증식형감염을나타내는데 virus DNA가숙주세포의 RNA 중합효소 II에의해서바이러스 RNA와 mrna로전사되어증식하게된다. 통합된바이러스의 DNA는 5' TG와 3' CA 말단을가지는것으로보아공통적인통합기작이있음을나타낸다 19). 바이러스유전자가숙주세포에통합되고나면 provirus DNA는세포분열에영향을끼치지않고딸세포로전달되며완전한바이러스입자를생산하게된다. 이렇듯 pol gene의산물은바이러스복제에있어서중심적인역할을하기때문에많은 retrovirus의 pol gene 염기서열이비교연구되어왔다. 특히 pol gene은아주보존적인불변부염기서열을갖고있으며이부분의 RT와 IN의아미노산서열은바이러스복제기전에중요한역할을하고있음 9,10) 이알려져있다. 본연구에서는한국형 BLV의정체를밝혀내는일환으로 pol gene의 3' 영역에위치하고있는 BLV IN 유전자의염기서열을결정하고그성질을규명하고자하였다. 특히 BLV 게놈의염기서열에대한연구는미국과호주를비롯한선진국에서만이루어지고국내에서는없기때문에, 우리나라에전파되고있는한국형 BLV의 IN에서의돌연변이정도를호주형 BLV의 IN과비교조사하였다. 재료및방법 1. PBMC 분리및 DNA extraction 본연구를위하여 BLV 에감염된것으로추정된 12마리의젖소에서혈액을채취해혈청과 peripheral blood mononuclear cells (PBMC) 를분리하였다. BLV 를포함한 Oncornavirinae는숙주세포에 provirus 상태로존재하기때문에 BLV 의감염여부를확인하는첫번째방법으로채취한혈액에서혈청과 PBMC를분리하였다. 먼저, sodium heparin 튜브에담긴 10 ml의 fresh blood에동량의 1X HBSS를넣고 50 ml 원심분리관에서잘섞은후, 이중 7 ml를 3 ml의 Histopaque-1077 (Sigma) 용액이든 15 ml 원심분리관에파스퇴르피펫을이용하여조심스럽게중층하였다. 이를냉장원심분리 (2,500 rpm/20 min) 하여튜브중간에있는 PBMC 층을 2 ml 걷어내고 1X HBSS로두번세척한후다시원심분리하여 PBMC 를침전시켰다. 2. PBMC chromosomal DNA 추출 Phenol/chloroform 추출방법 16) 을이용하여분리한 PBMC 에서 genomic DNA를추출하였다. 먼저, PBMC가들어있는 15 ml 원심분리관에 DNA lysis buffer (20 mm Tris-HCl, ph 7.6; 10 mm EDTA; 100 mm NaCl; 0.5% SDS; 200 µg/ml pro- teinase K) 를첨가하여실온에서밤새배양하였다. 다음날, 세포가용해된튜브에 phenol/chloroform (50:50) 용액을동량으로넣어잘섞은후 2,500 rpm에서 30분간냉장원심분리하여상청액을새 15 ml 튜브에모았다. 이상청액은다시 phenol/chloroform으로처리하고 chloroform (100%) 과혼합용액을만들어원심분리하였다. 얻어진상청액은 RNase (10 mg/ml) 로처리하고최종적으로얻어진 PBMC genomic DNA 의순도를 spectrophotometer로확인하였다. 각각의 genomic DNA는 T 10 E 1 buffer (10 mm Tris-HCl, 1 mm EDTA, ph 8.3) 에 500 µg/ml의농도로준비해 -20 에저장하여사용하였다. 3. Polymerase chain reaction PCR 반응에사용된 primer들은알려진일본형및서구형 BLV pol gene 불변부영역의염기서열로합성된일련의 primers (Table 1) 로서 100 pmol/µl 농도로사용하였다. 사용된 PCR 반응용액의구성성분은 10X Taq DNA polymerase buffer, 40 mm dntp, oligonucleotide primers (200 pmol씩 ), 2 unit Taq DNA polymerase, 25 mm MgCl 2, dh 2 O 및 DNA 용액를포함하여전체반응액을 50 µl로만든후 mineral oil (Sigma) 을더했다. PBMC genomic DNA는실험목적에따라그양을 1.0~4.0 µg/reaction으로조절하여준비된 PCR 반응용액과잘혼합하여 thermal cycler (Perkin-Elmer Model 480) 로반응시켰다. 반응 cycle은반응최적화를위해 95 에서 7분간 denaturation 시킨후 95 에서 30초, 55 에서 30초, 72 에서 1분으로모두 45회반복하였으며, PCR DNA의완성을돕기위해 72 에서 10분간반응을연장시켰다. Denaturation 과정은 Taq DNA polymerase를제외한나머지 PCR 반응액을넣고진행하였는데 5분이경과한후 PCR-tube를얼음에재빨리냉각시켜 renaturation을방지한후 Taq DNA polymerase를 2 unit을첨가하여 3분간 pre-denaturation을실행하였다. 반응이끝난 PCR product는 50 µl 중 10 µl를사용해 6X loading buffer를더한다음 2% Sigma (3:1) agarose gel에서전기영동하여 PCR product의크기를확인하였다. 전기영동은 100 ml agarose gel에 ethidium bromide (10 mg/ml) 5 µl를염색하였고 UV transilluminator에서밴드를확인한후폴라로이드필름 (667) 으로사진을찍었다. 4. DNA purification DNA를정제하는방법은 QIAEX II 젤추출 kit (Qiagen) 를이용하였고전반적인과정은 kit의설명서에따라실시하였다. Agarose 젤상에서얻어진 DNA 밴드는사무용칼을이용해조각내어얻었다. 이 DNA 밴드의무게를측정하여 250 mg 내의범위에서젤무게의 3배가되는 QIAEX I을넣었다. 여기에 QIAEX II suspension을 10 µl 첨가하고 50 heat block에서 20분간배양시켰다. 이때 2분간격으로 vortex
3 를실시하였다. 이를원심분리하여 (12,000 rpm/3 min) bead 와결합된 DNA를침전시키고, 얻어진침전물에 500 µl QIAEX I을넣어원심분리하고 pellet에 500 µl PE buffer를넣어 washing을반복하여수행하였다. 최종적으로얻어진침전물은공기건조하여일정량의 dh 2 O를넣어실온에서배양시켜 elution하였다. 5. DNA sequencing Automatic sequencer의사용을위한 labelling reaction은 thermal cycle 반응을이용하였다. 먼저 reaction pre-mix에 template DNA, dh 2 O, Big dye, buffer, primer (PCR 반응과동일한 primer, 4 pmol/µl) 를넣어 denaturation 을 94 /10초, annealing 을 50 /5초, extension을 60 /4분으로 25회반복하였으며 pre-denaturation을 96 /30초에서추가로처리하였다. 이방법은 unincorporated된 dye-dntp/ddntp를제거하는방법으로 sequencing ladder DNA만모아전기영동에사용하였다. 먼저, Sephadex G-50 (DNA grade) 을 dh 2 O에서정치하였고상온에 3시간둔후 15,000 rpm에서 3분간원심분리하였다. Sample은 column을사용해 DNA만 Sephadex를통과시켜 collection tube에모았다. Sequencing fragment 는 Speed Vac 으로건조하여 dh 2 O로농축하였다. 회수된 template DNA에비이온성계면활성제인 formamide를첨가하였고 95 에서 2분간 denaturation시켰다. 염기서열의해독과정은자동 DNA sequencer (Perkin-Elmer ABI Prism 3700 DNA analyzer) 를이용 Table 1. List of PCR primers used in this study Primers Sequences Length WBLV01 WBLV02 WBLV03 WBLV04 WBLV05 WBLV06 WBLV07 WBLV08 WBLV09 WBLV10 WBLV11 WBLV12 WBLV14S 5'- CCCGAGCCACATTGGATTAGAAC -3' 5'- CTGAAACCCTAGGTCCCGGAGG -3' 5'- CCCAGTCTCTTCTGGTGTCCTATATGG -3' 5'- CTGAACTCGAGGGTCCTCAGATG -3' 5'- CTTCTCCTGCTGGGATGCCAATA -3' 5'- GATTGCTGGATGTCGGAGGAGGC -3' 5'- AGCTTGGCTTCAACCTGACCC -3' 5'- GAAGGTGGGGTTCGTCTAAGTGAT -3' 5'- CCCTACAACCCCACAAGTTCGG -3' 5'- AGCATCTCCAAGTCTGGATGGGC -3' 5'- ACCCCCTTGACTGACAACC -3' 5'- CATGACCAACAACGATTGC -3' 5'- TTACCCATCTGATGATCGG -3' 22 mer 27 mer 21 mer 24 mer 22 mer 19 mer 19 mer 19 mer Fig. 1. Map of the BLV pol gene and the site of PCR for sequencing of Korean- type BLV integrase region. The diagram was made on a basis of the complete BLV nucleotide sequences reported by Sagata et al. (15)
4 Fig. 2. Preliminary PCR results with various primers for Korean-type BLV pol gene detection. The used primers were WBLV 01~02, WBLV 03~04, WBLV 07~08, WBLV 09~10, WBLV 11~12. Lane M represents DNA size marker (ΦX174 HaeIII digested). Lane 1 represents the PCR product using BLV 10C3 DNA sample. Lane 2 represents the PCR product using BLV 10C5 DNA sample. Lane 3 represents the PCR product using FLK-BLV DNA as a positive control. A 해실시하였다. 결과및고찰 1. 한국형 BLV 의 pol gene 검출을위한 PCR 최적화 Primer의염기서열은 BLV pol gene 전체영역 (2,559 bp, Fig. 1) 을대상으로 DNA 분석프로그램인 OMIGA 2.0 (Oxford Molecular, UK) 을이용하여결정하였다. 이로부터얻어진 primers들은 Table 1에나타난바와같다. BLV 가감염된 PBMC 의 DNA를 PCR할때사용된각각의 primer와얻어진밴드의크기는 WBLV 01~02 ( 밴드크기 618 bp), WBLV 03~04 (716 bp), WBLV 05~06 (555 bp), WBLV 07~08 (698 bp), WBLV 09~10 (529 bp) 등이며, 이중 WBLV 05~06은 WBLV 11~12 (607 bp) 로대체하였다. 또한실험이진행되는중 primer WBLV 10은 WBLV 14S로대체하였는데 primer WBLV 09와조합하여사용할시만들어지는 PCR DNA 밴드의크기는 435 bp가되었다 (Fig. 1). 본연구에서사용된한국형 BLV 는감염된젖소 PBMC sample 10C3의 BLV provirus ( 이하 BLV 10C3) 로서, IN 영역을포함하는 BLV pol gene은이 PBMC의 chromosomal DNA 에존재한다. 따라서한국형 BLV pol gene의존재여부는상기한 primer set을사용한 PCR로확인할수있었다 (Fig. 2). 한편한국형 BLV pol gene의 3' 영역에존재하며전체 pol gene의 3분의 1의크기를점유하는 IN 유전자를 PCR로검출하였다 (Fig. 3). 이를위해사용한 PCR primers는 WBLV Fig. 3. PCR results for Korean-type BLV integrase gene by applying primers WBLV 07~08 and WBLV 09~10. The band size of the target DNA were 698 bp and 529 bp, respectively (A). Reamplification results of the PCR DNA showed a single DNA band (B). Lane descriptions: M represents DNA size marker (ΦX- 174 HaeIII digested). Lanes 1~6 represent BLV 10C2, BLV 10C3, BLV 10C5, BLV 10C6, BLV 10C7 and BLV 10C8, respectively. 07~08과 WBLV 09~10으로, 이들이만들어내는 DNA 밴드의크기는각각 698 bp 및 529 bp이며 BLV pol gene 내의 IN 영역을충분히커버하고있다. Fig. 3A는여러가지 PBMC chromosomal DNA (10C2, 10C3, 10C5, 10C6, 10C7, 10C8) 를이용하여이들 primers를사용했을때얻어지는 PCR 결과이다. 여기서얻어진 2개의 DNA 단편을절단해 QIAEX II 젤추출 kit (Qiagen) 를사용하여 DNA를정제한후다시같은 primers를사용해 PCR을한결과, Fig. 3B에서보는것처럼 BLV IN 유전자의염기서열을포함하고있는 2가지의뚜렷한 B
5 5' - CATCCAGCAA TCTTTGTTGG TCATGTCCGG AGCCACTCTT CAGCATCCCA CCCTATTGCT TCCCTGAACA A TTATGTAGA TCAACTGCTT CCCTTAGAAA CTCCAGAGCA A TGGCATAAG CTCACCCACT GCAACCCTCG GGCCTTGTCT CGATGGCCGA ACCCACGTAT CTCTGCCTGG GACCCCCGTT CCCCCGCTAC GCTGTGTGAA ACCTGTCAAA AGCTCAATCC AACTGGAGGA GGAAAGATGC GAACTATTCA AAGAGGGTGG GCCCCGAATC ATATTTGGCA GGCCGATATA ACCCATTATA AATACAAACA GTTCACCTAC GCTCTGCATG TGTTTGTAGA TACTTACTCT GGAGCTACTC ATGCCTCGGC GAAGCGTGGG CTCACCACTC AAATGACCAT TGAGGGCCTT CTTGAGGCCA TAGTGCATTT GGGACGTCCA AAAAAGCTAA ACACTGACCA AGGTGCAAAC TACACCTCCA AAACCTTTGT CAGGTTTTGC CAGCAGTTCG GAGTTTCCCT TTCTCATCAT GTTCCCTACC ACCCCACAAG TTCGGGGTTA GTAGAACGGA CAAATGGACT GCTCAAACTT CTTCTATCTA AATATCACCT AGACGAACCC CACCTTCCCA TGACTCAGGC CCTTTCTCGA GCCCTTTGGA CTCACAATCA GATTAACCTC CTACCAAATC TAAAGACCAG ATGGGAGTTA CACCATTCAC CCCCACTTGC TGTCATTTCA GAGGGCGGAG AAACACCCAA GGGCTCTGAT AAACTGTTGT TGTACAAGCT TCCCGGGCAA AACAATCGTC GGTGGCTAGG ACCACTCCCG GCCCTAGTCG AAGCCTCGGG AGGCCCTCTC CTGGCTACTG ACCCCCCCGT GTGGGTTCCC TGGCGTTTGC TGAAGGCCTT CAAGTGCCTA AAAAACGACG GTCCCGAAGA CGCCCCGAAC CGATCATCAG A T G G G T A A -3' Fig. 4. DNA sequences of BLV 10C3 integrase region (3' side of the BLV pol gene). The first codon for BLV integrase should be located in the region of the boxed area. 단일 DNA 밴드를얻을수있었다. 이 DNA 밴드를 BLV IN 유전자의염기서열을결정하는데사용할수있었다. 2. 한국형 BLV integrase 유전자의 DNA 염기서열결정 BLV의 IN은 Gag-Pol polyprotein (pr145) 으로부터 retroviral protease의가수분해작용으로절단되어나오기때문에실제적으로이의 DNA 염기서열은 pol gene의 3' 영역에존재한다 2,6). 따라서우리는 BLV 10C3 pol gene의 3' 영역의염기서열을결정하여 IN 유전자에해당하는부분의염기서열을결정하였다. 즉, primer WBLV 07~08을이용하여 698 bp 크기의 DNA를얻을수있었으며 primer WBLV 09~10을이용하여 529 bp 크기의 DNA를얻을수있었다. 이들 DNA를각 각 sequencing 하였으며 IN 유전자라고추정되는 978 bp의염기서열을결정할수있었다. 이때한국형 BLV 10C3 IN의 C-terminal 부분의염기서열은 TAA (=UAA) 라는 stop codon 을발견함으로써정확히결정할수있었으나, 한국형 BLV IN의 N-terminal의시작부분은정확히결정하기가어려웠다. 왜냐하면 BLV IN의생성은 BLV 복제시 pol 유전자가 polyprotein 형태로번역된후만들어지기때문에, 일반적으로단백질을코딩하는유전자의시작이 ATG (start codon) 로시작되지않기때문이다. 그결과는 Fig. 4에정리되어있는바와같다. 현재까지 BLV IN region이정확히결정되어있지않기 2) 때문에 HIV의 IN이 288 AA (864 bp) 로이루어지고있음을 6)
6 점을착안해이크기를완전히 covering할수있는곳까지염기서열을결정하였다. 즉우리는 BLV pol gene의 3' region (IN gene을포함하는 ) 978 bp에해당하는염기서열을확인하 였으며, Fig. 4에제시된 DNA 염기서열의 5' 부분 ( 즉 IN 유전자의 3' end인 TAA에서 864 bp~978 bp 상류인 +1에서 +114 사이, Fig. 4의 box 부분임 ) 에 IN 유전자의시작점이존 Fig
7 Fig. 5. Comparison of BLV integrase DNA sequences between Korean-type BLV (denoted as BLV 10C3) and Australian BLV (denoted as AUS BLV). The first 4 boxes (double lines) is the location of "HHCC" motif in the BLV integrase amino terminus. The next 4 boxes (single lines) is the location of DD35E motif found in the region of carboxyl terminus of BLV integrase. Among them, a thin lined box represents putative D in DD35E motif. The integrase sequences of the Australian BLV was according to Coulston et al. (3) published as an Australian BLV isolate. 존재할수있다고추정하였다. 특히이부위에 retroviral pro-
8 재할수있다고추정하였다. 특히이부위에 retroviral protease의기질절단아미노산 2) 인소수성아미노산 (Phe, Tyr, Trp) 과글루타민 (Gln) 혹은염기성아미노산 (His, Lys, Arg) 들이많이분포해있는점을착안해본다면 +1 bp에서 +114 bp 사이에서 IN 유전자의염기서열이시작될것이라고사료되었다. 3. 한국형 BLV integrase 유전자염기서열과호주형 BLV integrase 유전자염기서열의비교한국형 BLV IN 유전자의염기서열특성과이의아미노산서열을알아보기위하여결정된염기서열수 (978 bp) 에해당되는 DNA 염기서열및이의아미노산서열을호주형 BLV pol gene (Coulston et al., 1990) 과비교하였다 (Fig. 5). 그결과한국형 BLV IN 유전자에서는점돌연변이를포함한총 36개의염기가치환되어, = 3.7% 돌연변이율을보여주었다. 즉, 한국형 BLV 10C3의 IN 유전자와호주형 BLV IN 유전자의염기서열은 96.3% 의높은상동성을보여주었다. 이러한수치는박등 12) 에의해보고된여러종의한국형 BLV의 pol gene 돌연변이율인 2.01%~4.02% ( 평균 2.9%) 와매우근접함을보여주었다. 또한몇개의점돌연변이는결과적으로 6개의아미노산을치환시켰기때문에한국형 BLV 10C3의 IN은호주형 BLV IN과비교해볼때총 6개의아미노산서열이달라져있었다. 즉, 호주형 BLV IN에서발견되는 Arg (AGG) Lys (AAG), Thr (ACG) Met (ATG), Ile (ATT) Val (GTT), Asn (ACC) His (CAC), Phe (TTT) Leu (TTG) 및 Asn (ACC) Asp (GAC) 로한국형 BLV IN 유전자에서는바뀌어있었음을확인할수있었다. 이들의변화를좀더조사해보면 Arg Lys는염기성 AA가염기성 AA로그리고 Ile Val로의변화는같은비극성지방족 AA로의변화이기때문에폴리펩티드자체에큰변화를주지는않았다. 하지만 Thr Met는극성 AA가비극성지방족 AA로의변화이며, Asn His는극성 AA가염기성 AA로, Asn Asp은극성 AA가산성 AA로변화되었으며 Phe Leu의경우방향족 AA가비극성지방족 AA 로바뀌게된것이다. 즉이러한결과는한국형 BLV가호주형 BLV와같은 BLV이지만돌연변이결과로우리나라의고유의 BLV로정착된것으로사료되었다. 4. 한국형 BLV integrase 의 HHCC motif 와 DD35E 의결정결정된염기서열을아미노산서열로변환시켜보았을때, 한국형 BLV IN에서도모든 retroviral IN에서보존되어있는불변부아미노산들인아미노말단부위의 zinc-finger-like "HHCC" motif가발견되었다 (Fig. 5, 이중 box). 이는모든 retroviruses와 transposon 및원핵세포 transposable elements에 강하게보존되어있는 motif로 IN의활성에필수적인요소이다 6,7). 만일이 motif에돌연변이가일어나면통합기전이불가능하여바이러스의 in vivo 복제가일어나지않는다 13). 이번에조사된한국형 BLV IN의 HHCC motif에서는히스티딘과히스티딘의사이에 3개의아미노산이존재하며시스테인과시스테인인사이에는 2개의아미노산이존재하고있었다. 그리고히스티딘과시스테인의거리는 25개의아미노산으로떨어져있었다. 이것은호주형 BLV의 IN에서도마찬가지였는데, 이로서우리는 BLV IN의 HHCC motif가 H-X 3 - H-X 25 -C-X 2 -C임을확인할수있었다. 일반적으로히스티틴과시스테인의거리는 23~32 AA인것으로 2,5) 알려져있는데한국형 BLV 및호주형 BLV에서는 25 AA임을알수있었다. 또한 IN과 transposases의보편적 motif인 "DD35E" 가발견되었다 (Fig. 5에표시된 solid box들 ). IN 촉매활성부위 8) 의핵심적인아미노산 (DDE) 들은인산전이반응을촉매하는것으로알려져있는데 4), 한국형 BLV의 IN에서의 DD35E domain은 D-X 56 -D-X 35 -E로나타났다. 하지만 BLV 경우 Asp 가 D2의상류부 39번째 AA 위치에또존재하기때문에 BLV integrase의 DD35E domain은 D-X 38 -D-X 35 -E일수도있다고사료되었다. 하지만일반적인 IN의 DD35E domain의구성은 D-X( 39~58 )-D-X 35 -E이기 4,14) 때문에이에대한조사는추후계속되어져야할것이다. 이상을종합해보면이번에조사된한국형 BLV IN의염기서열은호주형 BLV IN 염기서열과 96.3% 의 homology를보이면서어느정도의차이를나타내고있었으나 IN의효소활성에절대적인필수요소들 (HHCC motif 및 DD35E) 은두가지의 BLV ( 한국형및호주형 ) 모두에서잘보존되어있음을알수있었다. 감사의글본연구는 2000년도계명대학교비사연구기금으로이루어졌음. 참고문헌 1) Burny A, Cleuter Y, Kettmann R, Mammerickx M, Marbaix G, Portetelle D, Van Den Broeke A, Willems L and Thomas R (1988): Bovine leukemia: Facts and hypotheses derived from the study of an infectious cancer. Adv Vet Sci Comp Med, 32(1): ) Coffin JM, Hughes SH and Varmus HE (1997): Retroviruses, pp Cold Spring Harbor Laboratory Press, Cold Spring Harbor. 3) Coulston JC, Naif H, Brandon R, Kumar S, Khan S, Daniel RCW and Lavin MF (1990): Molecular cloning and sequencing of an Australian isolate of proviral bovine leukemia
9 virus DNA: Comparison with other isolates. J Gen Virol, 71(8): ) Engelman A and Craigie R (1992): Identification of conserved amino acid residues critical for human immunodeficiency virus type 1 integrase function in vitro. J Virol, 66(11): ) Jonsson CB and Roth MJ (1993): Role of the His-Cys finger of Moloney leukemia virus integrase protein in integration and disintegration. J Virol, 67(9): ) Katz RA and Skalka AM (1994): The retroviral enzymes. Ann Rev Biochem, 63: ) Khan E, Mack JPG, Katz RA, Kulkosky JL and Skalka AM (1991): Retroviral integrase domains: DNA binding and the recognition of LTR sequences. Nucleic Acids Res, 19(4): ) Kim DJ, Oh YT, Lee YK and Shin CG (1999): Analysis of integration activity of human immunodeficiency virus type-1 integrase. Mol Cells, 9(1): ) Kwon OS (1999): Molecular detection of Korean-type bovine immunodeficiency virus by polymerase chain reaction. Korean J Biomed Lab Sci, 5(1): ) Kwon OS (2000): Identification of pol gene mutation among BLV proviruses found in the Southern province of Korea. J Korean Soc Virology, 30(2): ) Kwon OS and Yoo M (1998): Molecular detection and an epidemiological study of bovine leukemia virus (BLV) among cows in the Daegu/Kyungpook area. J Inst Nat Sci, 17(1): ) Park HJ, Yoon KP and Kwon OS (2001): A study on the pol gene mutation rates of bovine leukemia virus BLV-10C. J Inst Nat Sci, 20(2): ) Roth MJ, Schwartzberg P, Tanese N and Goff SP (1990): Analysis of mutations in the integration function of Moloney murine leukemia virus: Effects on DNA binding and cutting. J Virol, 64(10): ) Rowland SJ and Dyke KG (1990): Tn552, a novel transposable element from Staphylococcus aureus. Mol Microbiol, 4(6): ) Sagata N, Yasunaga T, Tsuzuku-Kawamura J, Ohishi K, Ogawa Y and Ikawa Y (1985): Complete nucleotide sequence of the genome of bovine leukemia virus: Its evolutionary relationship to other retroviruses. Proc Natl Acad Sci USA, 82(3): ) Sambrook J, Fritsch EF and Maniatis T (1989): Molecular cloning: A laboratory manual. pp , 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor. 17) Sherman MP, Erlich GD, Ferrer JF, Sninsky JJ, Zandomeni R, Dock NL and Poiesz B (1992): Amplification and analysis of specific DNA and RNA sequences of bovine leukemia virus from infected cows by polymerase chain reaction. J Clin Microbiol, 30(1): ) Theilen GH and Madewell BR (1987): Veterinary cancer medicine, pp nd Ed., Lea and Febiger Press, Philadelphia. 19) Varmus H and Brown P (1989): Retroviruses. pp In Berg DE and Howe MM (eds.), "Mobile DNA", 2nd Ed., ASM Press, Washington DC
ƯÇãû
'' - 1 - - 2 - - 3 - - 4 - - 5 - ' - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - Super-Bio Co., Ltd. KWON, Suk-Tae Thermostable DNA Polymerase-encoding Gene from Thermus sp. X-1 an d Amino Acid Sequence
More informationcdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR
RT-PCR 법 II. 역전사효소반응 ( 주 ) 다인바이오연구소 현재분자생물학분야에서 RNA 수준의 gene expression ( 유전자발현 ) 과 cdna (complementary DNA) cloning에널리이용되고있는 RT-PCR (Reverse transcription ploymerase chain reaction) 은생명정보가 DNA에서 RNA로전달된다는분자생물학분야의
More informationAutomated high multiplex qPCR platform for simultaneous detection and quantification of multiple nucleic acid targets
PCR FlashGel System 2013. 04. 24 PCR 2013. 04. 24 순서 1. PCR 이란 2. PCR 실험의기본조건 3. PCR 효소선택가이드 4. Hot Start PCR의원리 5. PCR 실험시 Troubleshooting 6. PCR 장비 _TP350 소개 PCR(Polymerase Chain Reaction) PCR 이란? -
More information미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information제 1 장연구개발과제의개요 1 (2002 2003) 2 (2003 2004) 3 (2004 2005) 제 2 장국내외기술개발현황 제 3 장종보존을위한동결및해동조건의최적화 μ μ μ μ Survival rate (%) 100 80 60 40 20 0 50%S.W.+DMSO 100%S.W.+DMSO 0 5 10 15 DMSO concentration
More information슬라이드 1
EVENT 퀴아젠인기상품연말특별가전 200203 Top Taq DNA Polymerase (250U) 90,000 72,000 200205 Top Taq DNA Polymerase (1000U) 331,000 281,350 200403 Top Taq Master Mix Kit(250U) 104,000 83,200 201203 Taq DNA Polymerase
More informationDBPIA-NURIMEDIA
Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun
More informationCloning
Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군
More informationAbstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,
More information<31335FB1C7B0E6C7CABFDC2E687770>
에너지기후변화교육 4(2):203~211(2014) 203 초등학교 교과서 에너지 단원의 탐구활동과 시각자료 기능 분석 사례 연구 신명경 권경필 * 경인교육대학교 Abstract : This study aimed to analyze energy related inquiry activity and visual materials in elementary textbook.
More informationEZ-Cloning kit
EZ TM 5 /3 RACE PCR Kit Instruction Manual Korean Ver. Kit for 10 reactions Cat.# EZ025 EZ TM 5 /3 RACE PCR Kit Table of Contents I. 제품설명... 3 II. 원리... 4 III. 제품구성... 7 IV. 염기서열정보... 8 V. 주의사항... 8 VI.
More information뉴스레터6호F?2??訝
February 2009 No.06 Roche Diagnostics Korea Co., Ltd. Focus Tech EDITORIAL February 2009 No.06 Contents Editorial 03 Focus 04 Product 10 Talk 12 Tech 14 Activity 19 Style 22 February 2009 No.06 02 03 FOCUS
More informationDBPIA-NURIMEDIA
Mass-production of Four Specific Proteins Originated from Deformed Wing Virus, Honeybee-viral Pathogen Joo-seong Lee, Giang Thi Huong Luong and Byoung-Su Yoon* Department of Life Science, College of Natural
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More informationTechnical/Specs Sequencing 서비스안내 Standard Sequencing Plasmid/PCR product 를 primer 를이용하여고객이원하는 region 을분석하는서비스이며, 대부분의 normal 샘플에대해 최적화되어있습니다. Full Len
Technical/Specs Sequencing 서비스안내 Standard Sequencing Plasmid/PCR product 를 primer 를이용하여고객이원하는 region 을분석하는서비스이며, 대부분의 normal 샘플에대해 최적화되어있습니다. Full Length Sequencing (Primer walking) 길이가긴 insert 를포함한 plasmid
More information01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
More informationSMARTer 시리즈
SMARTer 시리즈 SMARTer Solutions 2014.12.17 다카라코리아바이오메디칼 SMART 하게실험하고 SMARTer 한결과를얻는방법 Clontech SMARTer 시리즈 Contents 1. Introduction 1. 역전사반응이란? 2. 기존역전사반응의한계 2. SMARTer 시리즈 1. SMARTer 란? 2. SMARTer 시리즈와적용
More informationPowerPoint 프레젠테이션
mrna (messenger RNA) : 양이가장적다 ( 전체 RNA 중 5-10% 이하 ) : mrna의염기서열은단백질의아미노산순서를지정 : 성장하는세포는수많은다른단백질을필요로함으로 mrna가만들어져단백질이합성되게한후 nucleotide가재생될수있도록분해된다 (trna, rrna도재생 ) : 5 말단의끝이 7-methyl guanosine triphosphate
More informationMicrosoft PowerPoint - 12-전기영동.pptx
전기영동 실험목적 기본적인분자실험장비인피펫, 저울, 원심분리 기, vortex mixer 사용법숙지 전기영동과정을통해서 DNA 크기비교 여러가지피펫종류들 Basic type P2 white tip P10 white tip P20 yellow tip P100 yellow tip P200 yellow tip P1000 blue tip Multi-channel pipette
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More informationChapter 6. Nucleotides and Nucleic Acids 세포대사에서뉴클레오타이드 (nucleotide) 의기능은무엇인가? Objective 유전체학 (genomics) 과단백체학 (proteomics) 기본개념이해 재조합 DNA 기술 (recombin
Chapter 6. Nucleotides and Nucleic Acids 세포대사에서뉴클레오타이드 (nucleotide) 의기능은무엇인가? Objective 유전체학 (genomics) 과단백체학 (proteomics) 기본개념이해 재조합 DNA 기술 (recombinant DNA technology) 란? - 효소의보조인자, 대사중간산물구성성분, 유전정보함유등
More information뉴스지14호-칼라
2 3 4 5 6 TaKaRa Taq TM / TaKaRa Ex Taq TM / TaKaRa LA Taq TM / Pyrobest TM DNA Polymerase/ TaKaRa Z -Taq TM TaKaRa Taq TM TaKaRa Ex Taq TM TaKaRa LA Taq TM TaKaRa Z-Taq TM Pyrobest TM DNA Polymerase 7
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More informationChapter 14 유전정보 (Genetic Information) A + G = C + T 일정 ( 샤가프룰 ] - Watson & Crick(1953년 ) : double helix model of DNA( 이중나선구조 ) 제시 1. 유전정보의전달경로 DNA 상의정
Chapter 14 유전정보 (Genetic Information) A + G = C + T 일정 ( 샤가프룰 ] - Watson & Crick(1953년 ) : double helix model of DNA( 이중나선구조 ) 제시 1. 유전정보의전달경로 DNA 상의정보를 RNA로옮겨주는과정 ex) retrovirus 2. DNA Replication ( 유전자복제
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More informationWeek01-workshop.hwp
Polymerase Chain Reaction 과반응산물의정제 김상태서울대학교천연물과학연구소 adanson@plaza.snu.ac.kr A. Polymerase Chain Reaction Polymerase chain reaction (PCR) 은 genome 상의특정 DNA 염기서열을 denaturation, primer annealing, DNA polymerase에의한
More information저작자표시 - 동일조건변경허락 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 이차적저작물을작성할수있습니다. 이저작물을영리목적으로이용할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원
저작자표시 - 동일조건변경허락 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 이차적저작물을작성할수있습니다. 이저작물을영리목적으로이용할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 동일조건변경허락. 귀하가이저작물을개작, 변형또는가공했을경우에는, 이저작물과동일한이용허락조건하에서만배포할수있습니다.
More information황지웅
Comparison of Laparoscopy and Exploration in the Distal Pancreatectomy BACKGROUND: To determine the benefits of laparoscopic surgery compared with exploration, the clinical outcomes of open and laparoscopic
More informationChapter 26
11 주 RNA 합성 11.1 DNA-dependent synthesis of RNA: Bacteria에서의 transcription l RNA polymerase (5 subunits로구성 : 2α, β, β, σ) l 효소에의한 RNA 합성의특징 - Complementary sequence to template DNA - RNA chain의합성방향 : 5
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More information석사논문.PDF
ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh
More information(Establishment and Management of Proteomics Core Facility)
(Establishment and Management of Proteomics Core Facility) 1 sample running on SDS-PAGE Gel (10well) 163570 10 16357 1D size marker 225500 100 2255 Buffer(20X, 500ml) 119900 20 5995 Staining
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More informationChapter 4. Bacteria (the first microbes)
- DNA 정제후클로닝을위한효소적절단과연결필요 -> restriction enzyme, ligase 가중요 1. DNA 조작효소범위 - 촉매반응에따라 5 분류 1. Nuclease : 핵산분자의절단, 단편화 2. Ligase : 핵산분자의연결 3. Polymerase : DNA 사슬합성 4. Modifying enzyme : 화학기능기의첨가, 제거 5. Topoisomerase
More information01-15(3)-12(최장경).fm
Res. Plant Dis. 15(3) : 165-169 (2009) Research in Plant Disease The Korean Society of Plant Pathology GM s ü š w Cucumber mosaic virus v y 1 Á y Á»x 1 Á * w w, 1 w y w Comparative Analysis of Coat Protein
More information05052유식안101.hwp
제 출 문 식품의약품안전청장 귀 하 이 보고서를 유전자재조합식품 모니터링(부산광역시보건환경연구원/정구영) 과제의 연구 결과보고서로 제출합니다. 2005. 11. 30 주관연구기관명 : 부산광역시보건환경연구원 주관연구책임자 : 정구영 목 차 Ⅰ. 연구개발결과 요약문----------------------------------- 1 (한글)------------------------------------------
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More information슬라이드 1
LC-MS 단백질분석을위한 SDS-PAGE staining protocol 및주의할점 Proteomics Core Facility 2017.12.28 Contents LC-MS 분석의뢰용 protein SDS-PAGE staining 시주의할점 Coomassie Blue R-250 을이용한 gel staining (general protocol) Coomassie
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More informationTOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme
PCR Enzyme 부터 qpcr 까지! PCR 실험은 TOYOBO 로해결하세요! 행사기간 : 7 월 15 일 ~ 9 월 13 일까지 TOYOBO Reagent PCR Enzyme High Quality PCR Enzyme cdna Synthesis Kit qpcr One-step RT Kit Immunoreaction Enhancer Solution 추가
More informationMicrosoft Word - KSR2012A038.doc
YWXY º º t rzyywxyhwz_ º zƒ A Study on the Relation of Railroad System and Energy Saving ö ä ø ã ä ãã In Moon, Han-Min Lee *, Jong-Eun Ha * * Abstract Now the world, such as the impact of fossil energy
More information1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
More informationPowerPoint 프레젠테이션
Glutathione Excellose handbook - Purification of GST fusion proteins - Looking for more detail Purification protocol? - Glutathione Excellose Spin Kit - Glutathione MiniExcellose - Glutathione Excellose
More information<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*
More informationSurpass the limit of Polymerase Chain Reaction (PCR) PCR Enzyme Guide High Fidelity PCR 효소 범용적인 PCR 효소 특수목적을위한 PCR 효소 - Epigenetics - Multiplex PCR -
Surpass the limit of Polymerase Chain Reaction (PCR) PCR Enzyme Guide High Fidelity PCR 효소 범용적인 PCR 효소 특수목적을위한 PCR 효소 - Epigenetics - Multiplex PCR - Direct PCR High Fidelity PCR 효소 - NGS targeted sequencing,
More information316 Research in Plant Disease Vol. 21 No. 4, (Seo, 2009). Enzyme-Linked Immuno Sorbent Assay(ELISA) Reverse Transcription- Polymerase Chain Reaction(R
식물병연구 Research Article Open Access Res. Plant Dis. 21(4) : 315-320(2015) http://dx.doi.org/10.5423/rpd.2015.21.4.315 Reverse transcription Loop-mediated isothermal amplification Soybean mosaic virus Detection
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social
More information저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More information대한한의학원전학회지26권4호-교정본(1125).hwp
http://www.wonjeon.org http://dx.doi.org/10.14369/skmc.2013.26.4.267 熱入血室證에 대한 小考 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 韓醫學古典硏究所 白裕相1, 2 *117) A Study on the Pattern of 'Heat Entering The Blood Chamber' 1, Baik 1
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More information<BBFDC8ADC7D02E687770>
대상본과 1 학년담당교수손정원 2014. 4. 1. 3/4 교시장소 1 의학관제 1 강의실 2. 수업주제 단백질 folding, targeting, 분해 1) 단백질 folding의기본동력에대해서이해한다. 2) chaperone의종류와작용기전에대하여설명한다. 3) proteasome의구조와 proteasome에의한단백질분해에대하여설명한다. 4) ER targeting
More informationDNA/RNA Amplification Overview AccuPower PreMix series 는세계적으로기술력을인정받은특허기술로보다경제적인가격과편리한방법으로실험할수있는제품입니다. Conventional PCR, Real-Time PCR 수행을위한 DNA ampli
DNA Amplification RNA Amplification Real-Time PCR Customized PCR DNA/RNA Amplification Phone: 1588-9788 (ext.4->2) Email: accupower-support @bioneer.co.kr DNA/RNA Amplification Overview AccuPower PreMix
More information09김정식.PDF
00-09 2000. 12 ,,,,.,.,.,,,,,,.,,..... . 1 1 7 2 9 1. 9 2. 13 3. 14 3 16 1. 16 2. 21 3. 39 4 43 1. 43 2. 52 3. 56 4. 66 5. 74 5 78 1. 78 2. 80 3. 86 6 88 90 Ex e cu t iv e Su m m a r y 92 < 3-1> 22 < 3-2>
More informationSpring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No ) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터
Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No. 50004) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터 (학술/제품문의) 02-2081 - 2510 www.takara.co.kr support@takara.co.kr
More information3월 온라인 교육
2013 년 2 분기대리점집체교육 - Protein - Takara Korea Biomedical Protein Workflow Chapter 1: 샘플준비 Chapter 2: Electrophoresis -Precast gel (Lonza/NuSep) -ProSieve EX running buffer -Protein marker Chapter 3: Staining
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: * Strenghening the Cap
Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.27-43 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.27 * Strenghening the Capacity of Cultural Arts Required in Special Education
More informationmau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More informationCrt114( ).hwp
cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1
More information실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양
실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양의시료를대량으로증폭할수있다는장점과그과정이간단하여 Cloning, Sequencing 등의기본기술로응용되었다.
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More information7.ƯÁýb71ÎÀ¯È« š
J KMA Special Issue Myelodysplastic Syndrome June Won Cheong, MD Yoo Hong Min, MD Department of Internal Medicine, Yonsei University College of Medicine E mail : jwcheong70@yumc.yonsei.ac.kr minbrmmd@yumc.yonsei.ac.kr
More informationJournal of Life Science 2011, Vol. 21. No μ μ
Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,
More informationETC Electrolytic Technologies Corporation Electrolytic Technologies Corporation (ETC) (High Strength Sodium Hypochlorite). ETC.,. ETC,,. - (Cl2) (NaOH
Innovator in Water Disinfection Solution 고농도차염 (NaOCl) 발생시스템 Klorigen K-Series Klorigen M-Series Generate Sodium Hypochlorite On-site and On-demand ETC Electrolytic Technologies Corporation Electrolytic
More informationProduct Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot
EZ-LDH Cell Cytotoxicity Assay Kit Cat. No. DG-LDH500 DG-LDH1000 FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. 1 ( 주 ) 대일랩서비스부설두젠생명공학연구소 Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More informationGlutathione Excellose handbook - Purification of GST fusion proteins - Looking for more detail Purification protocol? - Glutathione Excellose Spin Kit
Glutathione Excellose handbook - Purification of GST fusion proteins - Looking for more detail Purification protocol? - Glutathione Excellose Spin Kit - Glutathione MiniExcellose - Glutathione Excellose
More information01 Automated Protein Expression and Purification Using ExiProgen Selection Guide 267 ExiProgen EC Protein Synthesis Kit 268 ExiProgen EC-Maxi Protein
Automated Protein Expression and Purification Using ExiProgenTM Manual Protein Expression and Purification Preparation of Template DNA for Protein Expression Protein Service Protein Expression and Purification
More information#Ȳ¿ë¼®
http://www.kbc.go.kr/ A B yk u δ = 2u k 1 = yk u = 0. 659 2nu k = 1 k k 1 n yk k Abstract Web Repertoire and Concentration Rate : Analysing Web Traffic Data Yong - Suk Hwang (Research
More information슬라이드 1
유전공학 DNA 변형과조작 유전자클로닝 제한효소 (Restriction enzyme) 와연결효소 (DNA ligase) 역전사효소, 벡터 DNA 증폭 중합효소연쇄반응 (PCR) DNA 분리및분석 젤전기영동법 (Gel electrophoresis) DNA footprinting (DNA 지문 ) DNA 염기서열분석 Sanger method DNA 재조합기술 (Recombinant
More information<313630313032C6AFC1FD28B1C7C7F5C1DF292E687770>
양성자가속기연구센터 양성자가속기 개발 및 운영현황 DOI: 10.3938/PhiT.25.001 권혁중 김한성 Development and Operational Status of the Proton Linear Accelerator at the KOMAC Hyeok-Jung KWON and Han-Sung KIM A 100-MeV proton linear accelerator
More information...... .............hwp
- 1 - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - - 25 - - 26 - - 27 - - 28 - - 29 - 53)
More information44-4대지.07이영희532~
A Spatial Location Analysis of the First Shops of Foodservice Franchise in Seoul Metropolitan City Younghee Lee* 1 1 (R) 0 16 1 15 64 1 Abstract The foodservice franchise is preferred by the founders who
More information고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn
TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna
More information45 2, (2018) Korean J. Poult. Sci. Vol.45, No.2, (2018) 73 Calculation of Replacement Price for
45 2, 73 79 (2018) Korean J. Poult. Sci. Vol.45, No.2, 73 79 (2018) https://doi.org/10.5536/kjps.2018.45.2.73 73 Calculation of Replacement Price for Alternative Feed Ingredient in Consideration of Nutrient
More informationEffects of baseball expertise and stimulus speeds on coincidence-anticipation timing accuracy of batting Jong-Hwa Lee, Seok-Jin Kim, & Seon-Jin Kim* Seoul National University [Purpose] [Methods] [Results]
More information<B3EDB9AEC1FD5F3235C1FD2E687770>
경상북도 자연태음악의 소박집합, 장단유형, 전단후장 경상북도 자연태음악의 소박집합, 장단유형, 전단후장 - 전통 동요 및 부녀요를 중심으로 - 이 보 형 1) * 한국의 자연태 음악 특성 가운데 보편적인 특성은 대충 밝혀졌지만 소박집합에 의한 장단주기 박자유형, 장단유형, 같은 층위 전후 구성성분의 시가( 時 價 )형태 등 은 밝혀지지 않았으므로
More information2 大 韓 政 治 學 會 報 ( 第 18 輯 1 號 ) 과의 소통부재 속에 여당과 국회도 무시한 일방적인 밀어붙이기식 국정운영을 보여주고 있다. 민주주의가 무엇인지 다양하게 논의될 수 있지만, 민주주의 운영에 필요한 최소한의 제도적 조건은 권력 행사에서 국가기관 사이의
대한정치학회보 18집 1호, 2010년 6월:49~74 노무현 대통령과 이명박 대통령의 지도력과 국정운영 비교 : 임기 초 지도력 특성과 국민지지 * 1) 이 강 로 전주대학교 요 약 한국에서 민주주의가 뿌리를 내리기 위해서는 대통령의 지도력 행사에 제도만이 아 니라 여론과 같은 외부적 요인을 통해 체계적으로 견제할 수 있어야 한다. 대통령의 지도력 특성을
More information264 축되어 있으나, 과거의 경우 결측치가 있거나 폐기물 발생 량 집계방법이 용적기준에서 중량기준으로 변경되어 자료 를 활용하는데 제한이 있었다. 또한 1995년부터 쓰레기 종 량제가 도입되어 생활폐기물 발생량이 이를 기점으로 크 게 줄어들었다. 그러므로 1996년부
大 韓 環 境 工 學 會 誌 特 輯 - Special Feature - 263~268. 2008. 인구구조변화에 따른 생활폐기물 발생량 현황 및 전망 서울대학교 보건대학원 Status and Forecast of the Municipal Solid Waste Generation by the Change of Population Structure Sa-rah
More information항체 포털 서비스 Preparation Peptide 총 4주 소요 / 473,000 ~ 511,000 Free of charge 2~3 days 243,000 ~ 281,000 의뢰서 작성 Peptide epitope prediction 유전자 정보
Preparation Service AbFrontier Custom service 장점 실험 담당자와의 원활한 1:1 커뮤니케이션 (신속한 feedback을 통한 맞춤형 제작 서비스) 고객연구센터 - 개별 서비스의 진행 상황 및 결과 즉시 확인 http://center.abfrontier.com (e-mail & SMS 전송) 회원제 -연구자의 프로젝트 보안
More information` Companies need to play various roles as the network of supply chain gradually expands. Companies are required to form a supply chain with outsourcing or partnerships since a company can not
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More informationMicrosoft PowerPoint - d ppt [호환 모드]
전기영동 ( SDS-PAGE ) 개 요 전기영동과그목적 실험전준비 실험과정 실험결과및분석 전기영동과그목적 전기영동 단백질의순도나성질의분석및분리등에사용하는방법 -> 단백질의정성적인분석 SDS-PAGE ( Sodium Dodecyl Sulphate Polyacrylamide Gel Electrophoresis ) : SDS 와 Polyacrylamide 를사용한전기영동전기영동의목적
More information16(1)-3(국문)(p.40-45).fm
w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University
More informationDBPIA-NURIMEDIA
김진주 김수연. 초등학생대상장애이해교육에활용된동화에나타난장애인관분석. 특수교육, 2013, 제12권, 제2호, 135-160... 20.,,. 4.,,.,..... 주제어 : 장애이해교육, 동화, 장애인관 1. ( 1 ) Incheon Munhak Elementary School ( )(, E-mail: sooyoun@ginue.ac.kr) Dept. of
More information泰 東 古 典 硏 究 第 24 輯 이상적인 정치 사회의 구현 이라는 의미를 가지므로, 따라서 천인 합일론은 가장 적극적인 경세의 이론이 된다고 할 수 있다. 권근은 경서의 내용 중에서 현실 정치의 귀감으로 삼을 만한 천인합일의 원칙과 사례들을 발견하고, 이를 연구하여
權 近 의 五 經 인식 - 經 學 과 經 世 論 의 연결을 중심으로 - 姜 文 植 * 1. 머리말 2. 經 學 과 經 世 論 연결의 이론적 기반 3. 五 經 淺 見 錄 의 經 典 해석과 經 世 論 4. 맺음말 요약문 권근( 權 近 )은 체용론( 體 用 論 )에 입각하여 오경( 五 經 ) 간의 관계 및 각 경서의 근본 성격을 규정하였다. 체용론에서 용( 用 )
More information02À±¼ø¿Á
Geomorphic Development of Marine Terraces at Jeongdongjin-Daejin area on the East Coast, Central Part of Korean Peninsula Soon-Ock Yoon*, Sang-Ill Hwang** and Hak-Kyun Ban*** Abstract : In this paper we
More information