KJFP Jeongsook Yoon. bla VIM-2 of Pseudomonas aeruginosa in primary hospitals in Korea Vitek(Biomerieux, Marcy 1 Etoile, France) 으로균을동정하였다. 항균제감수성검사는디

Size: px
Start display at page:

Download "KJFP Jeongsook Yoon. bla VIM-2 of Pseudomonas aeruginosa in primary hospitals in Korea Vitek(Biomerieux, Marcy 1 Etoile, France) 으로균을동정하였다. 항균제감수성검사는디"

Transcription

1 KJFPpISSN eissn Original Article 한국 1 차병원의 Pseudomonas aeruginosa 에서 blavim-2 유전자관찰 윤정숙 서울베스티안병원 bla VIM-2 of Pseudomonas aeruginosa in primary hospitals in Korea Jeong-sook Yoon Director of laboratory medicine, Bestian Seoul Hospital. Background: In 2007, the resistance rate of Pseudomonas aeruginosa to imipenem was 29% in Korean tertiary hospitals. The main cause of imipenem resistance is the metalloβ-lactamase. A few studies about metallo-β-lactamase are found in tertiary hospitals, however, there are few studies in primary hospitals. Therefore, we studied whether genes encoding metallo-β-lactamase were present in P. aeruginosa isolates from primary hospitals, and studied bla VIM-2 using molecular methods. Materials and methods: A total of 960 blood, body fluid, open and closed pus, sputum, and urine specimens obtained from 27 primary hospitals of Bundang district were used this study. A screening test of metallo-β-lactamase was performed. The primers for bla VIM-2, and bla NDM-1 were used. DNA was extracted using the AccuPrep Nano-plus Plasmid mini Extraction Kit(Bioneer, Cheongwon, Korea). PCR was performed using AccuPower PCR PreMix(Bioneer). Results: P. aeruginosa was isolated from 42 of the 960 specimens. After PCR was performed for all 42 isolates using the three sets of metallo-β-lactamase gene-specific primers, bla VIM-2 Was detected in one sputum isolate. Conclusion: This study gives us warning that the metallo-β-lactamase could spread in the community. Keywords: Pseudomonas aeruginosa, VIM-2, resistance 서론 저자들은 1 차병원들에서전향적연구로서 P. aeruginosa 균주의 imipenem 내성을살펴보고, 국내에서흔한 metallo β-lactamase 유 Pseudomonas aeruginosa 는주요한병원감염균이다. 1, 2) P. 전자인 bla VIM-2 을관찰하고자하였다. aeruginosa 병원균은대부분의항균제에내성으로 carbapenem 외 에는쓸수있는항균제가없는경우가많다. 3, 4) 그러나 carbapenem 에까지내성인 P. aeruginosa와 Acinetobacter균이증가하고있다. 2006년 12개의 3차병원 5) 을대상으로한연구결과, P. aeruginosa 의 imipenem 내성율은 29% 나되었다. Imipenem의내성기전들로는막변형, 항균제유출, 분해효소등이있으며, 분해효소는주로 metallo-β-lactamase가많고대부분이 bla VIM-2 나 bla IMP-1 이다. 6, 7) metallo β-lactamase와유전자에관한연구는 3차병원분리주를대상으로드물게이루어져왔다. 그러나지역사회를대표하는 1 차병원들에서 metallo β-lactamase에관한연구는거의없다. 8) 재료및방법 1. 배양및항균제감수성검사 1차병원 27병원들로부터의뢰온폐쇄성, 개방성농, 혈액, 체액, 객담, 소변 960 검체를대상으로배양및항균제감수성검사를실시했다. 1차병원의정의는외래환자만보며, 의사수 3인이내인경우로하였다. 3차병원에입원경력이있거나항균제사용력이있는환자는대상에서제외하였다. 반복분리주는제외하였다. 생화학적방법과 API 20NE system(biomerieux, Marcy 1 Etoile, France) 및 Received June 18, 2015 Revised August 21, 2015 Accepted August 31, 2015 Corresponding Author Jeong-sook Yoon Tel: , Fax: js1345@medigate.net Copyright 2015 The Korean Academy of Family Medicine This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited

2 KJFP Jeongsook Yoon. bla VIM-2 of Pseudomonas aeruginosa in primary hospitals in Korea Vitek(Biomerieux, Marcy 1 Etoile, France) 으로균을동정하였다. 항균제감수성검사는디스크확산법및 Vitek 2 system (Biomerieux, Marcy 1 Etoile, France) 으로두가지모두검사하였다. 항균제는 piperacillin, tobramycin, piperacillin/tazobactam, cefotaxime, ceftazidime, cefepime, aztreonam, gentamicin, amikacin, ciprofloxacin, trimethoprim/sulfamethoxazole, imipenem, colistin 을포함했다. 대조균주는 P. aeruginosa ATCC 으로 하였다. 2. 선별검사 metallo-β-lactamase 를검출하고자 Hodge 변법과 imipenem- EDTA 상승시험을실시하였다. Hodge 변법은 E. coli ATCC 를 McFarland 0.5 관탁도로 Mueller-Hinton 한천에면 봉으로접종한후배지중앙에 imipenem 디스크를놓고시험세 균을 imipenem 디스크로부터획선하였다. 24 시간배양후억제 대가시험세균의증식선에따라들어가면양성으로판독하였다. Imipenem-EDTA 상승시험은시험세균을 McFarland 0.5 관탁 도로 Mueller-Hinton 한천에면봉으로접종후 10μg imipenem 디 스크와 0.5 M EDTA 디스크를 10mm 간격으로놓고, 35 에서 24 시간배양한후디스크사이에억제대가생기면양성으로판독했 9, 10) 다. 3. metallo-β-lactamase 유전자의중합효소연쇄반응 (PCR) 1) 시발체 bla VIM-2 에대한시발체의염기서열은다음과 7, 11, 12) 같다. VIM2(1) bla VIM-2 5 ATGTTCAAACTTTTGAGTAAG 3 VIM2(2) bla VIM-2 5 CTACTCAACGACTGAGCG 3 IMP1(1) IMP1(2) bla IMP-1 5 -CATGGTTTGGTGGTTCTTGT-3 bla IMP-1 5 -ATAATTTGGCGGACTTTGGC-3 NDM1(1) bla NDM-1 5 ATGGAATTGCCCAATATTATGC 3 NDM1(2) bla NDM-1 5 TCAGCGCAGCTTGTCGGCCAT 3 bla IMP-1 은 485 bp, bla VIM-2 는 801 bp 은 300 bp 의띠가 예상되었다. 2) 중합효소연쇄반응 AccuPrep Nano-plus Plasmid mini Extraction Kit (bioneer, cheongwon, Korea) 를사용하여 DNA 를추출하였다. PCR 은 AccuPower PCR PreMix(bioneer, cheongwon, Korea) 를이용하여 수행하였다. 20pmol 짜리 primer 각각 1μg, DNA 1μg 씩을첨가하 여최종부피 20μL 가되게하였다. cycle 은 94 에서 5 분간둔후, 94 에서 30 초간 denaturation, 56 에서 30 초간 annealing, 72 에서 45 초간 extension 을 25 회하였다. 7) Gene Amp PCR System 9600(Perkin-Elmer Centus Corp., Norwalk, CT, USA) 을이용 하여수행하였다. bla IMP-1 은 485 bp, bla VIM-2 는 801 bp 은 300 bp 에서띠를관찰하였다. 양성대조균주는 KONSAR(Korean Nationwide Surveilance of Antimicrobial Resistance) 에서 bla VIM-2 와 bla IMP-1 P. aeruginosa 를구하였고, 음성대조균주는 P. aeruginosa ATCC 균주를사용하였다. 3) 전기영동 증폭된 DNA 산물 10μL 를 ethidium bromide(10μl/ml) 가첨가 된 2% agarose gel(promega, Madison, WI, USA) 에서 150 volt, 30 분간전기영동하였다. 7) Size marker 는 0~1,500 base pair 구간 의 100 bp DNA ladder standard (Gibco Bethesda Research Lab., Bethesda, MA, USA) 를이용하였다. 결과 960 검체중 P. aeruginosa 는 42 균주검출되었다 (4.4%). 항 균제감수성율을살펴보면, ceftazidime 87%, cefotaxime 33%, cefepime 73%, aztreonam 80%, piperacillin 60%, piperacillin/ tazobactam 82%, tobramycin 60%, gentamicin 79%, amikacin 83%, ciprofloxacin 69%, trimethoprim/sulfamethoxazole 78%, imipenem 100%, colistin 100% 의감수성율을나타냈다 (Table 1). Table 1. Antimicrobial susceptibility of P. aeruginosa in primary hospitals 항균제 1 차병원감수성율 (%) 3 차병원감수성율 (%)[14] CAZ CTX 33 CEP IPM ATM CPF TRI 78 PIP/Tazo AMK GM PIP COL 100 abbreviations; IPM: imipenem, ATM: aztreonam, CEP: cefepime, CAZ:ceftazidime, CTX:cefotaxime. CPF: ciprofloxacin, TRI: trimethoprim/ sulfamethoxazole, PIP/Tazo: piperacillin/tazobactam, AMK: amikacin, GM gentamicin, PIP: piperacillin, TOB: tobarmycin, COL: colistin no results 118

3 윤정숙. 한국 1 차병원의 Pseudomonas aeruginosa 에서 bla VIM-2 유전자관찰 KJFP Figure 1. bla VIM-2 detected on 801 bp. band by PCR The primers for bla VIM-2, and bla NDM-1 were used. DNA was extracted using the AccuPrep Nano-plus Plasmid mini Extraction Kit (Bioneer, Cheongwon, Korea). PCR was performed using AccuPower PCR PreMix (Bioneer) 대조군과비교할때, 1 차병원에서의항균제감수성율이더높았 다 (ceftazidime 87% vs 78%, imipenem 100% vs 71%, aztreonam 80% vs 69%, ciprofloxacin 69% vs 61%, piperacillin/tazobactam 82% vs 75%, amikacin 83% vs 75%, gentamicin 79% vs 65%). metallo-β-lactamase 선별검사에서양성균은관찰되지않았다. 모든 P. aeruginosa 42 검체를가지고 bla VIM-2 에 대하여 PCR 을시행한결과, 객담에서분리된균주에서 metalloβ-lactamase gene bla VIM-2 가검출되어 801 bp 에서띠가관찰되었 다 (Figure 1). 고찰 P. aeruginosa 는기회감염균으로서주로병원환경과중환자 에게많이감염된다. 1, 2) 병원균은 penicillin, aminoglycoside, ciprofloxacin, broad spectrum cephalosporin, monobactam 모 두에내성이고 imipenem 외에는쓸수있는항균제가거의없 다. 3, 4) imipenem 은 penicillin-binding protein 과의친화력이우 수하며, ESBL 을포함한대부분의 β-lactamase 를가수분해하여 betalactam 내성세균에의한감염증치료에유용하게사용된다. 근 래 imipenem 에까지내성인 P. aeruginosa 와 Acinetobacter spp. 가증가하였고, Enterobacteriaceae 중에도내성균주가보고되고 있다. 13) 3 차병원 12 병원을대상으로한연구에서 imipenem 내성 율은 29% 였다. 14) 다른연구에서도 imipenem 내성율을 31.2% 로 보고하여, 15) 3 차병원의 imipenem 내성율은거의 3 분의 1 에달함 을알수있다. 더구나내성율이 2005 년도에는 21%, 2006 년도에는 29% 로급속히증가되고있다고하였다. 다른 3 차병원에서도 2000 년 23%, 2001 년 24%, 2002 년 28%, 2003 년 30% 로서점점증가추 세였다. 14, 19) Enterobacteriaceae 에도 carbapenem 내성이전달되어 CRE(carbapenem resistant Enterobacteriaceae) 로발표되고있다. 16) Imipenem 내성균의치료로는 colistin 과 tigecycline 이비교적효 과적이라고한다. 6, 17) Imipenem 의내성기전으로는막변형으로인 한항균제축적의감소나유출펌프때문으로사료되고, imipenem 분해효소도있다. Carbapenem 분해효소는기능성분류로 Ambler class A 인 serine 형, class B 인 metallo-β-lactamase, class D 인 oxacillinase 가있다. Imipenem 내성은주로 class B 인 metalloβ-lactamase 에의하고, 6, 18) metallo-β-lactamase 는 monobactam 을제외한 β-lactam 제제에내성이며, clavulanic acid 에의해서는 효소활성이억제되지않으나, 금속이온 chelator 인 EDTA 에의 해서는억제된다. 19) 국내에 bla IMP 가발견된이후여러종이발견 13, 19) 되었고그중 VIM-2, IMP-1이가장많이보고되어있다. 581 P. aeruginosa 균주중 bla VIM-2 유전자를나타낸것은 34 균주, bla IMP-1 유전자를나타낸것은 2 균주였다. 7) metallo-β-lactamase 는 plasmid 나 transposon 내에다른항균제내성유전자와함께 integron 상태로공존하므로 17) 쉽게획득되어전파가가능하고다제 내성균으로발전할수있다. Integron 의구조와크기는각각다르 며, 이들은플라즈미드나염색체내에서수평이동으로써다른균에 전달될수있다. transconjugant 실험에서 integron 이 E. coli J53 으 로전달되는것을확인한바있다. bla VIM-2 의구조는 3-6kb 로다양 하고, 위치와서열이다양하다. 13) 이런상황에서국내 1 차병원에서 metallo-β-lactamase 와유 전자를연구한것은거의없다. 3 차병원에서 imipenem 내성균이 급증하는현실에서지역사회의감염감시업무를소홀히할수없 을것이다. 그러나현재 1 차병원의연구는거의없어, 저자들은 1 차병원에서의 metallo-β-lactamase 와유전자를살펴보기로하였 다. 더욱이최근에는미국과여러나라에서 metallo-β-lactamase 인 bla NDM-1 의유행이보고되고있다. NDM-1 형은 2008 년도인도를 여행한스웨덴인에서처음보고되었으며, 최근국내질병관리본부 에서도 bla NDM-1 이보고되었다. 20, 21) bla NDM-1 은주로 Klebsiella 나 E. 16, 22, 23) coli 균주및 P. aeruginosa에서보고된다. 이번연구에서 1 차병원들로부터의뢰온 960 검체들중 42 검체 가 P. aeruginosa 로판명되어 12 개 3 차병원연구보다낮은빈도 로검출되었다. 14) 역시 1 차병원에서 3 차병원의빈도보다낮은빈 도를나타냈다. 이번연구의항균제감수성율은 ceftazidime 87%, cefotaxime 33%, cefepime 73%, aztreonam 80%, piperacillin 60%, piperacillin/tazobactam 82%, tobramycin 60%, gentamicin 119

4 KJFP Jeongsook Yoon. bla VIM-2 of Pseudomonas aeruginosa in primary hospitals in Korea 79%, amikacin 83%, ciprofloxacin 69%, trimethoprim/ sulfamethoxazole 78%, imipenem 100%, colistin 100% 의감수성율을나타냈다 (Table 1). 항균제감수성율은시흥지역을대상으로한이전연구와매우유사하였다. 8) 3차병원의연구에서는 ceftazidime 78%, cefepime 73%, aztreonam 69%, piperacillin/ tazobactam 75%, amikacin 75%, gentamicin 65% 를나타냈고, 따라서 1차병원의연구가더높은항균제감수성율을나타냈다. 14) 이번연구에서검출된 42주의 P. aeruginosa중에 imipenem내성은없었다. 1차병원에 imipenem 내성균이거의없고, 아직 imipenem 이유효한치료효과가있음을알수있다. 3차병원이나대학병원에서 imipenem 내성율이거의 30% 에육박함과비교하여지역사회를대표하는 1차병원에는 imipenem 내성균이발견되지않아 3차병원과큰차이를나타내었다. 그러나이번연구에서 bla VIM-2 가 1차병원에서검출되었다 (Figure 1). 객담검체에서분리된균주로 PCR을시행한결과, 801 bp에서정확한띠가관찰되었다. 스크리닝검사와의불일치의이유는유전자수준에서의 bla VIM-2 유전자가충분히 metallo-βlactamase 단백을형성하지않았기때문으로사료된다. 이환자는 community에서균을획득했고이전입원경력이나항균제사용력이없으므로 community onset infection 으로정의된다. 3차병원의국내보고에서도 20균주의 metallo-β-lactamase 생성균주중 19 균주가 bla VIM-2 를보유하고있어 metallo-βlactamase 유전자중대다수가 bla VIM-2 임을나타냈다. 19) 또, 한 3차병원에서도 bla VIM-2 유전자를가진 P. aeruginosa의빈도는 1997년 11.5%, 1998년 8.2%, 1999년 5.9% 로꾸준히보고되었다고하였다. 24) 본연구에서 imipenem 디스크확산법에서는 26mm로감수성, 액체배지희석법에서는 MIC 2μg/mL, 한천희석법은 2μg/mL 로감수성이었다. Imipenem 감수성균에서 metallo-β-lactamase 유전자 bla VIM-2 가검출되었는데, 어떤보고에서는 carbapenemase를생성하는 P. aeruginosa라고해도, 그중 3분의 1은항균제감수성범위내에들었다고하여, carbapenemase를생성하여도감수성균이상당수를차지함을나타냈다. 17) 내성유전자가있어도 carbapenem 제제의종류에따라내성정도가다른것으로보고되어있으므로 ertapenem, meropenem MIC을검사하였다. 그결과 ertapenem, meropenem MIC는 1µg/mL, 2µg/mL 이었다. 국내 3차병원에서도 imipenem 감수성균에서 bla VIM-2 빈도를살펴보면총빈도는지금보다높아질것이다. 따라서이현상은 metallo-β-lactamase를생성하지못하거나, 적게생성하므로아직내성표현형을나타내지않는 plasmid level의 gene transference 나다른 clone 간의 genetic exchange를나타내는것으로사료된다. Shenoy 등의연구에서도 PCR에서 bla NDM-1 을나타낸경우, screeing test에서 metallo-β-lactamase가검출된경우는일부였다고하였다. 25) 그리고현재 metallo-β-lactamase 유전자 bla VIM-2 가국내1차병원으로전파되어있는상황으로사료된다. 지역사회에서 metallo-β-lactamase 생성균의감시를더욱철저히하여야할것으로생각된다. 이를위해서는 Metalo-β-lactamase의빠른검출을위해서분자적검출이필요하다. 결론적으로국내 1차병원에서 P. aeruginosa 42 균주중한균주에서 bla VIM-2 를나타냈다. 아직 1차병원에 metallo-β-lactamase에의한 imipenem 내성균이만연하지는않으나분자적수준의유전자전이를나타내는것으로고려되어, 지역사회에 metallo-β-lactamase bla VIM-2 유전자가침투, 확산되어있다고생각된다. 분자유전수단을통한감염감시관리를철저히하여야할것이다. 요약연구배경 : 2007년, 한국 3차병원에서 Pseudomonas aeruginosa의 imipenem 내성율은 29% 였다. 내성의가장흔한원인은 Metalloβ-lactamase이다. 3차병원에서는 metallo-β-lactamases에관한보고들이있으나, 1차병원에서이에대한연구는거의없다. 이연구의목적은 1차병원들에서 metallo-β-lactamase가존재하는지와한국에서흔한bla VIM-2 유전자및 bla NDM-1 을분자적으로검출하고자한것이다. 재료및방법 : 연구대상은 27개의분당지역 1차병원들로부터의뢰온개방성또는폐쇄성창상, 혈액, 체액, 객담, 소변 960 검체였다. 이들에서분리된 P. aeruginosa에서 metallo-β-lactamase 선별검사를실시하였다. 시발체 bla VIM-2 를제조하였다. 검체에서 AccuPrep Nano-plus Plasmid mini Extraction Kit(bioneer, cheongwon, Korea) 를이용하여 DNA를추출한후, AccuPower PCR PreMix를이용하여 PCR을수행하였다. 결과 : 960 검체중 P. aeruginosa는 42 검체에서분리되었다 (4.4%). 42 검체모두를 PCR한결과 1 균주에서 bla VIM-2, 가검출되었다. 결론 : 한국의 1차병원들의 P. aeruginosa 균주에서 bla VIM-2 가검출되었다. metallo-β-lactamase 유전자를검출하기위한 surveillance 프로그램이필요할것이다

5 윤정숙. 한국 1 차병원의 Pseudomonas aeruginosa 에서 bla VIM-2 유전자관찰 KJFP 중심단어 : 녹농균, VIM-2, 내성균 REFERENCES 1. Inacio HS, Bomfim MR, França RO, Farias LM, Carvalho MA, Serufo JC et al.phenotypic and Genotypic Diversity of Multidrug- Resistant Pseudomonas aeruginosa Isolates from Bloodstream Infections Recovered in the Hospitals of Belo Horizonte, Brazil. Chemotherapy ;60(1): [Epub ahead of print] 2. Yan Y, Yao X, Li H, Zhou Z, Huang W, Stratton CW, et al. A Novel Pseudomonas aeruginosa Strain with an oprd Mutation in Relation to a Nosocomial Respiratory Infection Outbreak in an Intensive Care Unit. J Clin Microbiol ;52(12): Bell, S. M., J. N. Pham, and J. Y. M. Lanzarone. Mutation of Pseudomonas aeruginosa to piperacillin resistanc mediated by β -lactamase production. J. Antimicrob. Chemother. 1985;15: Scullly, B. E., M. F. Parry, H. C. Neu, and Mandell. Oral cyflofloxacin therapy of infections due to Pseudomonas aerginosa. Lancet 1986;1: Scullly, B. E., M. F. Parry, H. C. Neu, and Mandell. Oral cyflofloxacin therapy of infections due to Pseudomonas aerginosa. Lancet 1986;1: Hong SG, Yong DE, Lee KY, Kim EC, Lee WK, Jeong SH, et al. Antimicrobial resistance of clinically important bacteria isolated from hospitals located in representative provinces of Korea. Korean J Clin Microbiol 2003;6(1): Castanheira M, Sader HS, Deshpande LM, Fritsche TR, and Jones RN. Antimicrobial activities of tigecycline and other broad spectrum antimicrobials tested against serine carbapanemase and metallo-β -lactamase producing Enterobacteriaceae: Report from the Sentry antimicrobial surveillance program. Antimicrob Agents Chemother 2008;52(2): Lee KY, Yum JH, Yong DE, Lee HM, Kim HD, Jennis DD, et al. Novel acquired metallo-β-lactamase gene, blasim-1, on a class 1 integron from Acinetobacter baumannii clinical isolates from Korea. Antimicrob Agents Chemother 2005;49(11): Yoon JS. Antimicrobial resistance of urinary isolates in the urine collected from patients admitted into primary-care hospital in Shiheung district. Korean J Clin Microbiol 2013;16(2); Performance Standards for Antimicrobial Susceptibility Testing; Twentieth Informational Supplement. Table 2A-S Lee K, Chong Y, Shin HB, Kim YA, Yong D, Yum JH. Modified Hodge and EDTA-disk synerge tests to screen metallo-betalactamase-producine strains of Pseudomonas and Acinetobacter species. Clin Microbiol Infect 2001;7: Liu ZY, Li W, Wang J, Pan J, Sun SP, Yu YH. First NDM-1 producing E.coli strain in China. PLoS One Jun 10;8(6): Poirel L, Naas T, Nicolas D, Collet L, Bellais S, Cavallo JD et al. Characterization of VIM-2, a carbapenem-hydrolyzing metallobeta-lactamase and its plasmid- and integron-borne gene from a Pseudomonas aeruginosa clinical isolate in France. Antimicrob Agents Chemother 2000;44: Yum JH, Shin HB, Yong DE, Chong YS. Diversity of integrons carrying blavim-2 cassette in Pseudomonas spp. and Acinetobacter spp. Korean J Clin Microbiol 2012;15; Lee HM, Kim CK, Lee JW, Lee SH, Ahn JY, Hong SG et al. Antimicrobial resistance of clinically important bacteria isolated from 12 hospitals in Korea in 2005 and Korean J Clin Microbiol 2007;10: Yoon YS, Lee BY, Bae IK, Kwon SB, Jeong SH, Jeong TJ. Prevalence of Imipenem-Resistant Pseudomonas aeruginosa Isolates and Mechanisms of Resistance. Korean J Clin Microbiol 2005;8(1): Green DA, Srinivas N, Watz N, Tenover FC, Amieva M, Banaei N. A pediatric case of New Delhi metallo-β-lactamase(ndm-1)- producing Enterobacteriaceae in the United States. Pediatric Infect Dis J Jun 5. [Epub ahead of print] 17. Castanheira M, Sader HS, Deshpande LM, Fritsche TR, Jones RN. Antimicrobial activities of tigecycline and other broad-spectrum antimicrobials tested against serine carbapenemase- and metallo-β -lactamase-producing Enterobacteriaceae: Report from the SENTRY antimicrobial surveillance program. Antimicrob Agents Chemother 2008;52(2): Queenan, A. M., and K. Bush Carbapenemases: the versatile β-lactamases. Clin. Microbiol. Rev. 20: K IS, Oh WI, Song JH, Lee NY. Screening and Identification of metallo-β-lactamase gene in clinical isolates of imipenem-resistant Pseudomonas aeruginosa. Korean J Lab Med 2004;24(3) Rasheed JK, Kitchel B, Zhu W, Anderson KF, Clark NC, Ferraro MJ el al. New Delhi metallo-β-lactamase-producing Enterobacteriaceae, United States. Emerging Infect Dis 2013; Yoo JS, Kim HS, Yang JW, Yoo JI, Kim HS, Park HK et al. Nosocomial transmission of NDM-1-producing Escherichia coli ST101 in a Korean hospital. J Antimicrob Chemother. 2013; 68: Bushnell G, Mitrani-Gold F, Mundy LM. Emergence of New Dehli metallo-β-lactamase type 1-producing enterobacteriaceae and non-enterobacteriaceae: global case detection and bacterial surveillance. Int J Intect Dis 2013;17(5):e Cunningham SA, Noorie T, Meunier D, Woodford N, Patel R. Rapid and simultaneous detection of genes encoding Klebsiella pneumoniae carbapenemase (blakpc) and New Dehli metallo-β -lactamase(blandm) in Gram-negative bacilli. J Clin Microbiol 2013;51(4): Lee K, Lim JB, Yum JH, Yong D, Chong Y, Kim JM. blavim2 cassette-containing novel integrons in metallo-β-lactamaseproducing Pseudomonas aeruginosa and Pseudomonas putida isolated disseminated in Korean hospital. Antimicrob Agents Chemother 2002;46: Shenoy KA, Jyothi EK, Ravikumar R. Phenotypic identification & molecular detection of bla (ndm-1) gene in multidrug resistant Gram-negative bacilli in a tertiary care centre. Indian J Med Res. 2014;139(4):

< D34302D303420B1E8BCF6C1A42DC0FAC0DABCF6C1A4BABB2D312E687770>

< D34302D303420B1E8BCF6C1A42DC0FAC0DABCF6C1A4BABB2D312E687770> 대한임상검사학회지 : 40권제2호, 75-79, 2008 ISSN 1738-3544 대구지역병원에서분리된 Acinetobacter baumannii와 Pseudomonas aeruginosa의항생제내성현황 대구보건대학임상병리과 1, 세명대학교임상병리학과 2 김수정 1 이재식 2 Antibiotic Resistance Patterns of Acinetobacter

More information

untitled

untitled Ann Clin Microbiol Vol., No., September, http://dx.doi.org/./acm... ISSN - Loss of bla and bla IMP- during the Storage of Gram- Bacilli, Antimicrobial Susceptibility of the Gene-Lost Strain, and Location

More information

12_HM hwp

12_HM hwp The Korean Journal of Microbiology (2010) Vol. 46, No. 3, pp. 303-307 Copyright c 2010, The Microbiological Society of Korea 단보 국내에서분리된 Acinetobacter baumannii 의 Integron 과연관된다제내성분석 김성환 최지혜 박은진 서인원 손승렬

More information

ORIGINAL ARTICLE Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resist

ORIGINAL ARTICLE   Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resist ORIGINAL ARTICLE http://dx.doi.org/10.15263/jlmqa.2015.37.4.209 Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resistance: MicroScan versus Etest Goeun Kang, Hyun Soo Kim,

More information

untitled

untitled Korean J Clin Microbiol Vol. 12, No. 1, March, 2009 Characterization of Class 1 Integrons in Metallo-βlactamase-producing Pseudomonas aeruginosa Ji Youn Sung, Sun Hoe Koo, Kye Chul Kwon, Jong Woo Park,

More information

2 - ceftazidime-clavulanate 디스크를이용하여 ESBL 생성균주를확인하였다. 또한 2009년도에수집된균주인 P. aeruginosa(386주 ), A. baumannii(349주 ) 를대상으로 imipenem에대한감수성을확인하였고 imipenem-h

2 - ceftazidime-clavulanate 디스크를이용하여 ESBL 생성균주를확인하였다. 또한 2009년도에수집된균주인 P. aeruginosa(386주 ), A. baumannii(349주 ) 를대상으로 imipenem에대한감수성을확인하였고 imipenem-h 1 - 국내종합병원을대상으로한항균제내성모니터링 Monitoring of antimicrobial resistance on general hospitals in Korea 질병관리본부국립보건연구원감염병센터약제내성과 연세대학교의과대학진단검사의학교실, 세균내성연구소 Ⅰ. 들어가는말 항균제내성세균의출현과확산으로인하여세균감염증치료는점점어려워지고있다 [1-4]. 항균제내성률은흔히국가간,

More information

400 김정민 신경섭 집락을쉽게형성하여장기입원환자나비뇨기계질환이있는노인에서흔히감염을일으킬수있다 [2, 3]. P. rettgeri는 P. stuartii보다 aminoglycoside, cephalosporin 및페니실린계항균제에대한내성률이낮으며, 다제내성인경우도드물다

400 김정민 신경섭 집락을쉽게형성하여장기입원환자나비뇨기계질환이있는노인에서흔히감염을일으킬수있다 [2, 3]. P. rettgeri는 P. stuartii보다 aminoglycoside, cephalosporin 및페니실린계항균제에대한내성률이낮으며, 다제내성인경우도드물다 대한진단검사의학회지 : 제 25 권제 6 호 2005 Korean J Lab Med 2005; 25: 399-405 임상미생물학 요검체에서분리된 Providencia rettgeri 에서 VIM-2형 Metallo- -Lactamase의생성 김정민 신경섭 1 경북대학교의과대학미생물학교실, 충북대학교의과대학진단검사의학교실 1 Production of VIM-2

More information

03(12-65)p fm

03(12-65)p fm 한국임상약학회지제 23 권제 1 호 Kor. J. Clin. Pharm., Vol. 23, No. 1. 2013 화상감염소아환자에서분리된주요균종에대한항생제의내성률 강주연 신혜순 * 덕성여자대학교약학대학 (2012 년 12 월 28 일접수 2013 년 3 월 2 일수정 2013 년 3 월 4 일승인 ) Antimicrobial Resistance of Clinically

More information

untitled

untitled ORIGINAL ARTICLE Korean J Clin Lab Sci. Vol. 45, No. 1, Mar. 2013 21 Korean J Clin Lab Sci. 2013, 45(1):21-25 ISSN 1738-3544 Errors of Antibiotic Susceptibility Testing from Automated and Manual Systems

More information

A. baumannii 와 P. aeruginosa 의 ESBL 생성현황 15 인하여광범위 -lactam 제제일부를포함한여러항균제에내재적내성이지만, ceftazidime, piperacillin, ticarcillin 등은이들세균에비교적강한항균력을지닌다 [3]. Cla

A. baumannii 와 P. aeruginosa 의 ESBL 생성현황 15 인하여광범위 -lactam 제제일부를포함한여러항균제에내재적내성이지만, ceftazidime, piperacillin, ticarcillin 등은이들세균에비교적강한항균력을지닌다 [3]. Cla 대한진단검사의학회지제 26 권제 1 호 2006 Korean J Lab Med 2006;26:14-20 원저 임상미생물학 임상검체에서분리된 Acinetobacter baumannii와 Pseudomonas aeruginosa의 Class A Extended-Spectrum -Lactamase 생성현황 오세진 이상욱 황현용 1 배일권 1 조현수 1 이병호 1

More information

untitled

untitled Korean J Clin Microbiol Vol. 13, No. 1, March, 2010 DOI: 10.5145/KJCM.2010.13.1.27 Carbapenem Resistance Mechanisms and Molecular Epidemiology of Acinetobacter spp. from Four Hospitals in Seoul and Gyeonggi

More information

(59-69)Kjcm13.hwp

(59-69)Kjcm13.hwp Korean J Clin Microbiol Vol. 10, No. 1, April, 2007 Antimicrobial Resistance of Clinically Important Bacteria Isolated from 12 Hospitals in Korea in 2005 and 2006 Hyukmin Lee 1, Chang Ki Kim 2, Jongwook

More information

KJFP Jeongsook Yoon. Bacterial Strains and Antimicrobial Resistance in Burn Patients 심부화상인경우 Clostridium, Bacteroides 등을감별하기위해무산소성배양을시행해야한다고권장하고있다. 6)

KJFP Jeongsook Yoon. Bacterial Strains and Antimicrobial Resistance in Burn Patients 심부화상인경우 Clostridium, Bacteroides 등을감별하기위해무산소성배양을시행해야한다고권장하고있다. 6) KJFP Original Article http://dx.doi.org/10.21215/kjfp.2016.6.3.179 pissn 2233-9019 eissn 2233-9116 화상창 감염의 균종 및 항균제 감수성률 윤정숙* 서울베스티안병원 진단검사의학과 Bacterial Strains and Antimicrobial Resistance of Wound Infection

More information

untitled

untitled 210 Ji Youn Sung. PMQR Genes among CTX-M-14 Producing E. coli ORIGINAL ARTICLE Korean J Clin Lab Sci. 2016, 48(3):210-216 http://dx.doi.org/10.15324/kjcls.2016.48.3.210 pissn 1738-3544 eissn 2288-1662

More information

untitled

untitled Korean J Clin Microbiol Vol. 11, No. 2, October, 2008 Characteristics of Acquired β-lactamase Gene in Clinical solates of Multidrug-resistant Pseudomonas aeruginosa un Yang Chung 1, Ji Youn ung 2, Kye

More information

Kang CI 문제가되고있는주요병원균으로는소위 ESKAPE 균주들 이있는데, 이는 Enterococci, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aerugino

Kang CI 문제가되고있는주요병원균으로는소위 ESKAPE 균주들 이있는데, 이는 Enterococci, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aerugino DOI: 10.5124/jkma.2011.54.3.325 pissn: 1975-8456 eissn: 2093-5951 http://jkma.org Pharmacotherapeutics 다제내성그람음성균감염의치료전략 강철인 * 성균관대학교의과대학삼성서울병원감염내과 Therapeutic strategy for the management of multidrug-resistant

More information

<303220C6AFC1FD303220B0ADC3B6C0CE2E687770>

<303220C6AFC1FD303220B0ADC3B6C0CE2E687770> 대한내과학회지 : 제 88 권제 5 호 2015 http://dx.doi.org/10.3904/kjm.2015.88.5.502 특집 (Special Review) - 다제내성균감염의위협 다제내성그람음성균감염의항생제치료 성균관대학교의과대학삼성서울병원감염내과 강철인 Antimicrobial Therapy for Infections Caused by Multidrug-Resistant

More information

2101

2101 대한진단검사의학회지제 28 권제 3 호 2008 Korean J Lab Med 2008;28:185-90 DOI 10.3343/kjlm.2008.28.3.185 원저 임상미생물학 Escherichia coli, Klebsiella spp., Proteus mirabilis에서 Phoenix Automated Microbiology System의 Extended-Spectrum

More information

Microsoft PowerPoint - PDFCoTemp.PPT

Microsoft PowerPoint - PDFCoTemp.PPT 주요유방염세균의검출및 항생제감수성검사 임숙경 1. 검사시료 1. 시료채취 유방염우유 2. 체세포수측정 3. 대상세균 - Staphylococcus aureus - Coagulase negative staphylococci -Escherichia coli 3. 균분리방법 E. coli CHEC Agar 직접도말 (37 18-24h) 보라색집락 EMB Agar

More information

386-390.hwp

386-390.hwp 386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon

More information

<37375FB1E8C0E7C1DF2DC7F7BED7B9E8BEE7BFA1BCAD20BAD0B8AEB5C820C0D3BBF3C0FB2E687770>

<37375FB1E8C0E7C1DF2DC7F7BED7B9E8BEE7BFA1BCAD20BAD0B8AEB5C820C0D3BBF3C0FB2E687770> Journal of the Korea Academia-Industrial cooperation Society Vol. 17, No. 5 pp. 653-659, 2016 http://dx.doi.org/10.5762/kais.2016.17.5.653 ISSN 1975-4701 / eissn 2288-4688 혈액배양에서분리된임상적주요균주의항균제사용량에따른내성률변화

More information

untitled

untitled ORIGINAL ARTICLE Korean J Clin Lab Sci. 2016, 48(3):217-224 http://dx.doi.org/10.15324/kjcls.2016.48.3.217 pissn 1738-3544 eissn 2288-1662 Korean J Clin Lab Sci. Vol. 48, No. 3, September 2016 217 An Analysis

More information

Microsoft Word - 15-홍승복.doc

Microsoft Word - 15-홍승복.doc J. Exp. Biomed. Sci. 2012, 18(3): 299~306 pissn : 1738-3226 Original Article Molecular Characterization and Prevalence of 16S Ribosomal RNA Methylase Producing Bacteria in Amikacin Resistant Gram-negative

More information

untitled

untitled ORIGINAL ARTICLE Korean J Clin Lab Sci. 017;9():13-19 https://doi.org/10.153/kjcls.017.9..13 pissn 173-35 eissn -6 Korean J Clin Lab Sci. Vol. 9, No., December 017 13 The Characteristics of Imipenem-Resistant

More information

untitled

untitled Korean J Clin Microbiol Vol. 12, No. 3, September, 2009 Metallo-β-lactamase Producing Gram-negative Bacilli Dongeun Yong Department of Laboratory Medicine and Research Institute of Bacterial Resistance,

More information

< D34312D303628BEE7BAB4BCB12CC0B0B1D9B5B9292E687770>

< D34312D303628BEE7BAB4BCB12CC0B0B1D9B5B9292E687770> 대한임상검사학회지 : 41권제4호, 153-157, 2009 ISSN 1738-3544 SHV ESBL 생성 Klebsiella pneumoniae 균주의실시간중합효소반응분석 진주보건대학임상병리과 1, 대전보건대학임상병리과 2 양병선 1 육근돌 2 Real-Time PCR Analysis of SHV Extended-Spectrum beta-lactamases

More information

1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus

More information

untitled

untitled Korean J Clin Microbiol Vol., No., December, 20 http://dx.doi.org/0.55/kjcm.20...3 Chromosomal Mutations in oprd, gyra, and parc in Carbapenem Resistant Pseudomonas aeruginosa Ji Youn Sung, Hye Hyun Cho

More information

untitled

untitled 병원감염관리 : 제19권제1호 2014 Korean J Nosocomial Infect Control 2014;19(1):29-36 http://dx.doi.org/10.14192/kjnic.2014.19.1.29 원저 국내중환자실환자에서분리된세균의항균제내성 이양순 1 ㆍ김영아 2 ㆍ송원근 3 ㆍ이혁민 4 ㆍ이혜수 5 ㆍ장숙진 6 ㆍ정석훈 1 ㆍ홍성근 7 용동은

More information

untitled

untitled ORIGINAL ARTICLE Korean J Clin Lab Sci. 2017;49(4):427-434 https://doi.org/10.15324/kjcls.2017.49.4.427 pissn 1738-3544 eissn 2288-1662 Korean J Clin Lab Sci. Vol. 49, No. 4, December 2017 427 Distribution

More information

22 신경섭 손보라 oxyimino-cephalosporin은물론 monobactam계항생제도분해하는효소이다 [1-3]. 장내세균에서 ESBL 생성균주의증가에대한여러보고가있는데 [4-6], Escherichia coli와 Klebsiella pneumoniae는임상에서

22 신경섭 손보라 oxyimino-cephalosporin은물론 monobactam계항생제도분해하는효소이다 [1-3]. 장내세균에서 ESBL 생성균주의증가에대한여러보고가있는데 [4-6], Escherichia coli와 Klebsiella pneumoniae는임상에서 대한임상병리학회지 : 제 22 권제 1 호 2002 Korean J Clin Pathol 2002; 22: 21-6 임상미생물학 Escherichia coli와 Klebsiella Species에서 Extended-Spectrum -Lactamase 검출을위한 Vitek ESBL Test와그외방법의비교 신경섭 손보라 충북대학교의과대학임상병리학교실 Comparison

More information

<5BC0FAC0DABCF6C1A430355D434D30362D313320BEE7BAB4BCB12D E687770>

<5BC0FAC0DABCF6C1A430355D434D30362D313320BEE7BAB4BCB12D E687770> 대한임상검사학회지 : 38 권제 3 호, 173-178, 2006 Multiplex Polymerase Chain Reaction 을이용한 Extended-Spectrum β-lactamase 생성 Klebsiella pneumoniae 균주의검출 진주보건대학임상병리과 양병선 Detection of Extended-Spectrum β-lactamase Producing

More information

Drug-Resistant Bacteria: Tertiary Hospitals versus Smaller Medical Institutions resistant Pseudomonas aeruginosa (CRPA), carbapenem resistant Acinetob

Drug-Resistant Bacteria: Tertiary Hospitals versus Smaller Medical Institutions resistant Pseudomonas aeruginosa (CRPA), carbapenem resistant Acinetob Original Article Ewha Med J 2013;36(2):126-131 http://dx.doi.org/10.12771/emj.2013.36.2.126 pissn 2234-3180 eissn 2234-2591 전원온환자의의료기관별호흡기검체에서의균종류비교 김태형, 조경표, 이재성, 우용문, 성지석, 노창석 1 서울적십자병원내과, 1 서울특별시서남병원호흡기내과

More information

84 계명의대학술지제 31 권 1 호 2012 μg /ml). Isolation frequency of MDRAB strains was 97.7% (172 strains) and was highly prevalent. Fifty eight (33.0%) strains

84 계명의대학술지제 31 권 1 호 2012 μg /ml). Isolation frequency of MDRAB strains was 97.7% (172 strains) and was highly prevalent. Fifty eight (33.0%) strains 계명의대학술지제 31 권 1 호 Keimyung Med J Vol. 31, No. 1, June, 2012 다약제내성 Acinetobacter baumannii 의 유병율과항균제감수성 계명대학교의과대학미생물학교실, 의과학연구소 서성일 백원기 서민호 High Prevalence and Antimicrobial Drug Susceptibility of Multidrug

More information

A Case of Acute Cholecystitis Caused by Stenotrophomonas maltophilia Bacteremia,. 5,6 B S. maltophilia. 증례 B,, 3 2 (entecavir 0.5 mg) 7. 3,.

A Case of Acute Cholecystitis Caused by Stenotrophomonas maltophilia Bacteremia,. 5,6 B S. maltophilia. 증례 B,, 3 2 (entecavir 0.5 mg) 7. 3,. Case Report The Korean Journal of Pancreas and Biliary Tract 2014;19:189-193 http://dx.doi.org/10.15279/kpba.2014.19.4.189 pissn 1976-3573 eissn 2288-0941 Stenotrophomonas maltophilia 균혈증에의해발생한급성담낭염 1

More information

untitled

untitled 대한내과학회지 : 제 72 권제 1 호 27 Streptococcus pneumoniae와 Haemophilus influenzae 임상분리주에대한 Cefditoren의시험관내항균력 인제대학교의과대학일산백병원감염내과, 울산대학교의과대학서울아산병원감염내과 2, 울산대학교항균제내성ㆍ미생물유전학연구센터 3 곽이경 추은주 2, 3 박수진 3 이정은 3 정진용 2,

More information

Microsoft Word - 3-김정민.doc

Microsoft Word - 3-김정민.doc Journal of Bacteriology and Virology 2006. Vol. 36, No. 1 p.21 30 다약제내성 Acinetobacter 균의유전종결정및항균제내성의특성규명 경북대학교의과대학미생물학교실, 단국대학교의과대학미생물학교실 1 임유미 최태생 1 김정민 * Determination of Genomospecies and Characterization

More information

한수지 49(5), , 2016 Original Article Korean J Fish Aquat Sci 49(5), ,2016 창선해역의지중해담치 (Mytilus galloprovincialis) 양식장및육상오염원에서분리한대장균 (Escheri

한수지 49(5), , 2016 Original Article Korean J Fish Aquat Sci 49(5), ,2016 창선해역의지중해담치 (Mytilus galloprovincialis) 양식장및육상오염원에서분리한대장균 (Escheri 한수지 49(5), 564-572, 2016 Original Article Korean J Fish Aquat Sci 49(5),564-572,2016 창선해역의지중해담치 (Mytilus galloprovincialis) 양식장및육상오염원에서분리한대장균 (Escherichia coli) 의항생제내성 권순재 이가정 * 정연중 박상기 고경리 양지혜 목종수 국립수산과학원남동해수산연구소

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

296 Korean J Lab Med 2010;30: S. maltophila 감염증치료에는낮은항균제내성률을보이는 trimethoprim/sulfamethoxazole (TMP/SMX) 이일차치료제로사용되고있으며, quinolone, moxalactam,

296 Korean J Lab Med 2010;30: S. maltophila 감염증치료에는낮은항균제내성률을보이는 trimethoprim/sulfamethoxazole (TMP/SMX) 이일차치료제로사용되고있으며, quinolone, moxalactam, Korean J Lab Med 2010;30:295-300 DOI 10.3343/kjlm.2010.30.3.295 Original Article Clinical Microbiology Analysis of Acquired Resistance Genes in Stenotrophomonas maltophilia Jeong Hoon Song, M.D. 1, Ji

More information

< BFF8C0FA2D B9E8C7F6C1D62E687770>

< BFF8C0FA2D B9E8C7F6C1D62E687770> 대한내과학회지 : 제 권제 호 다약제내성 Pseudomonas aeruginosa 에대한항생제병합효과 한양대학교의과대학감염내과학교실 배현주 In Vitro Effects of Combined Antibiotics against Multidrug-resistant Pseudomonas aeruginosa HyunJoo Pai, M.D. Infectious Diseases,

More information

Aug 2012 Vol. 20, No. 3 Ser. No. 78, Quarterly ISSN Antimicrobial resistance of clinical isolates of bacteria during Apri

Aug 2012 Vol. 20, No. 3 Ser. No. 78, Quarterly ISSN Antimicrobial resistance of clinical isolates of bacteria during Apri Aug 2012 Vol. 20, No. 3 Ser. No. 78, Quarterly ISSN1226-1734 www.whonetkorea.org Antimicrobial resistance of clinical isolates of bacteria during April to June, 2012 Antimicrobial resistance rates in April-June,

More information

untitled

untitled Ann Clin Microbiol Vol. 16, No. 3, September, 213 http://dx.doi.org/1.5145/acm.213.16.3.126 ISSN 2288-585 Molecular Characteristics of bla OXA-23 -Producing Acinetobacter baumannii Isolated from a University

More information

( )Kju225.hwp

( )Kju225.hwp 비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin

More information

Çмúº¸°í6ÇÏÇý¹Î

Çмúº¸°í6ÇÏÇý¹Î 병원약사회지 (27), 제 34 권제 4 호 J. Kor. Soc. Health-syst. Pharm., Vol. 34, No. 4, 433 ~ 442 (27) Original Article 국내지역사회획득폐렴원인균의경험적항균제에대한내성현황 하혜민 a, 김윤숙 b, 안정미 c, 천부순 a, 인제대학교약학대학 a, 인제대학교해운대백병원약제부 b, 인제대학교상계백병원약제부

More information

Çмúº¸°í5¿À´ÙÇö

Çмúº¸°í5¿À´ÙÇö 병원약사회지 (28), 제 35 권제 호 J. Kor. Soc. Health-syst. Pharm., Vol. 35, No., 48 ~ 58 (28) Original Article 국내병원획득폐렴원인균의경험적항균제에대한내성현황 오다현 a, 김윤숙 a, 천부순 b, 인제대학교해운대백병원약제부 a, 인제대학교약학대학 b The Status of Resistance

More information

<5BC0FAC0DABCF6C1A430345D434D30362D313220C8ABBDC2BAB92D E687770>

<5BC0FAC0DABCF6C1A430345D434D30362D313220C8ABBDC2BAB92D E687770> 대한임상검사학회지 : 38 권제 3 호, 166-172, 2006 Metallo-β-lactamase 생성 Pseudomonas aeruginosa의시험관내항균제병합요법에대한연구 분당제생병원진단검사의학과 홍승복 In vitro Antimicrobial Combination Therapy in Metallo-β-lactamase Producing Pseudomonas

More information

untitled

untitled J Korean Soc Transplant 2013;27:81-86 http://dx.doi.org/10.4285/jkstn.2013.27.3.81 Review Article 다제내성세균의시대에세균성감염질환에대한항생제치료의최근발전들 성균관대학교의과대학삼성서울병원감염내과 강철인 What s New in the Management of Bacterial Infections

More information

112 성흥섭 최수진 유수진외 1 인 균제에내성이며다른여러항균제에도내재성혹은획득내성을지니고있기때문에치료항균제선택범위가매우좁다 [3, 4]. Imipenem은세포외막의 porin을잘투과하고, penicillin-binding protein (PBP) 과의친화도와 -lac

112 성흥섭 최수진 유수진외 1 인 균제에내성이며다른여러항균제에도내재성혹은획득내성을지니고있기때문에치료항균제선택범위가매우좁다 [3, 4]. Imipenem은세포외막의 porin을잘투과하고, penicillin-binding protein (PBP) 과의친화도와 -lac 대한진단검사의학회지제 27 권제 2 호 2007 Korean J Lab Med 2007;27:111-7 원저 임상미생물학 Imipenem 내성 Acinetobacter baumannii에서항균제병합요법의시험관내상승작용검사 성흥섭 최수진 유수진 김미나 울산의대서울아산병원진단검사의학과 In vitro Antimicrobial Synergy against Imipenem-Resistant

More information

February 2007

February 2007 November 2009 Vol. 17 No. 4 Ser. No. 67 Quarterly ISSN 1226-1734 www.whonetkorea.org Antimicrobial resistance of bacteria isolated during July to September in 2009 at a KONSAR program participating hospital

More information

안도희외 6 인 : ESBL 생성균주와비생성균주에의한지역사회획득요로감염비교 감염에서균주의항생제감수성에변화를가져왔고특히광범위세팔로스포린에대한내성균의감염이증가하고있다 2). 이러한내성균에의한요로감염은치료실패, 합병증증가및치료기간의연장등과의연관성이제기되고있어관심이증가하고있다

안도희외 6 인 : ESBL 생성균주와비생성균주에의한지역사회획득요로감염비교 감염에서균주의항생제감수성에변화를가져왔고특히광범위세팔로스포린에대한내성균의감염이증가하고있다 2). 이러한내성균에의한요로감염은치료실패, 합병증증가및치료기간의연장등과의연관성이제기되고있어관심이증가하고있다 ORIGINAL ARTICLE pissn 2384-1079 eissn 2384-1087 Pediatr Infect Vaccine 2015;22:29-35 DOI: http://dx.doi.org/10.14776/piv.2015.22.1.29 Extended-Spectrum β-lactamase 생성균주와비생성균주에의한지역사회획득요로감염비교 안도희ㆍ김규원ㆍ조혜경ㆍ차한ㆍ전인상ㆍ류일ㆍ선용한

More information

Trd022.hwp

Trd022.hwp 김신태, 이선녕, 이석정, 정필문, 박홍준, 신명상, 김종환, 이부길, 김상하, 리원연, 신계철, 용석중 Shin-Tae Kim, M.D., Shun Nyung Lee, M.D., Seok Jeong Lee, M.D., Pil Moon Jung, M.D., Hong Jun Park, M.D., Myung Sang Shin, M.D., Chong Whan Kim,

More information

..........5-45..

..........5-45.. K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals

More information

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770> Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한

More information

<303120C6AFC1FD20B9E8C7F6C1D62E687770>

<303120C6AFC1FD20B9E8C7F6C1D62E687770> 대한내과학회지: 제 81 권 제 6 호 2011 특 집(Special Review) - 흔한 감염질환에서의 항생제 내성 및 최신 치료 지역사회 단순 요로감염에서의 항생제 내성 및 최신 치료 한양대학교병원 감염내과 배 현 주 Treatment of Community-Acquired Uncomplicated Urinary Tract Infection Hyunjoo

More information

Table 2. Antimicrobial susceptibility (%) of P. aeruginosa a Antimicrobial agents Resistant Intermediate Susceptible Piperacillin 45/27 b 0/0 55/73 Pi

Table 2. Antimicrobial susceptibility (%) of P. aeruginosa a Antimicrobial agents Resistant Intermediate Susceptible Piperacillin 45/27 b 0/0 55/73 Pi May 2012 Vol. 20, No. 2 Ser. No. 77, Quarterly ISSN1226-1734 www.whonetkorea.org Antimicrobial resistance of clinical isolates of bacteria during January to March, 2012 Antimicrobial resistance rates determined

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social

More information

Microsoft Word - 20-김윤태.doc

Microsoft Word - 20-김윤태.doc J. Exp. Biomed. Sci. 12 (2006) 267 274 Random mplified Polymorphic DN (RPD) nalysis for Extended Spectrum β-lactamase Producing Klebsiella pneumonia Isolated from Clinical Specimens in Korea Yun-Tae Kim

More information

10 원저 hwp

10 원저 hwp 대한내과학회지 : 제 94 권제 1 호 2019 https://doi.org/10.3904/kjm.2019.94.1.107 비병원장기요양기관에서입원하는노인의다제내성그람음성균보유 서울특별시서울의료원내과 김민성ㆍ신진호ㆍ정연상ㆍ조진경ㆍ최재필 Multidrug-Resistant, Gram-Negative Bacteria in Hospitalized Elderly Patients

More information

untitled

untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information

674 권순재ㆍ정연중ㆍ윤현진ㆍ목종수ㆍ권지영,.., (Watts et al., 2017)., 70% (Kummerer, 2009). (Witte, 2000)., (Souli et al., 2008)., % ,113 (NIFS, 2017

674 권순재ㆍ정연중ㆍ윤현진ㆍ목종수ㆍ권지영,.., (Watts et al., 2017)., 70% (Kummerer, 2009). (Witte, 2000)., (Souli et al., 2008)., % ,113 (NIFS, 2017 한수지 51(6), 673-681, 2018 Original Article Korean J Fish Aquat Sci 51(6),673-681,2018 용남광도해역의굴 (Crassostrea gigas) 및육상오염원에서분리한대장균 (Escherichia coli) 의항생제내성 권순재 정연중 윤현진 목종수 1 권지영 * 국립수산과학원남동해수산연구소, 1 국립수산과학원식품위생가공과

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4) THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method

More information

°Ç°�°úÁúº´5-44È£ÃÖÁ¾

°Ç°�°úÁúº´5-44È£ÃÖÁ¾ K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis

More information

<B4EBC7D1BFE4B7CEBBFDBDC4B1E2B0A8BFB0C7D0C8B8C1F620C1A637B1C720C1A632C8A32E687770>

<B4EBC7D1BFE4B7CEBBFDBDC4B1E2B0A8BFB0C7D0C8B8C1F620C1A637B1C720C1A632C8A32E687770> 대한요로생식기감염학회지 : 제 7 권제 2 호 2012년 10월 Korean J UTII Vol. 7, No. 2, October 2012 종설 슈퍼버그 : Vancomycin-Resistant Enterococcus 와 Carbapenem 내성균 고려대학교의과대학비뇨기과학교실 채지윤 오미미 [Abstract] Superbug: Vancomycin-Resistant

More information

untitled

untitled Ann Clin Microbiol Vol. 6, No. 3, September, 03 http://dx.doi.org/0.55/acm.03.6.3. ISSN 055 Strategies for Interpretive Standards of βlactams Susceptibility Testing and Identification of ExtendedSpectrum

More information

6 JH Byun, et al. IRS-PCR on E. coli 성을나타낸다. CTX-M ESBL 유전자는 mobile genetic element 와연관되어지역사회에서 ESBL 이쉽게전파할수있다 [5, 6]. 병원균의역학적분석을하기위

6 JH Byun, et al. IRS-PCR on E. coli   성을나타낸다. CTX-M ESBL 유전자는 mobile genetic element 와연관되어지역사회에서 ESBL 이쉽게전파할수있다 [5, 6]. 병원균의역학적분석을하기위 Original Article http://dx.doi.org/10.3947/ic.2012.44.1.5 Infect Chemother 2012;44(1):5-10 pissn 2093-2340 eissn 2092-6448 Infection & Chemotherapy Infrequent-Restriction-Site 중합효소연쇄반응 (ISR-PCR) 을사용한지역사회발생

More information

February 2007

February 2007 May 2008 Vol. 16 No. 2 Ser. No. 61 Quarterly ISSN 1226-1734 www.whonet.org Antimicrobial resistance of bacteria isolated during January to March in 2008 at a KONSAR program participating hospital Antimicrobial

More information

K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis

More information

Contents I. 항생제내성 / 감수성기준및용어설명 II. III. 호흡기질병 5 종항생제내성검사결과 소화기질병 3 종항생제내성검사결과

Contents I. 항생제내성 / 감수성기준및용어설명 II. III. 호흡기질병 5 종항생제내성검사결과 소화기질병 3 종항생제내성검사결과 2017 년양돈질병세균 항생제내성검사결과 I Seul Oh ACE of Optipharm ois@optipharm.co.kr 043-249-7532 Contents I. 항생제내성 / 감수성기준및용어설명 II. III. 호흡기질병 5 종항생제내성검사결과 소화기질병 3 종항생제내성검사결과 2018-01-30 2 1. 항생제감수성 / 내성기준 2018-01-30

More information

February 2007

February 2007 Aug 2011 Vol. 19 No. 3 Ser. No. 74 Quarterly ISSN 1226-1734 www.whonetkorea.org Antimicrobial resistance of bacteria isolated during April to June in 2011 at a KONSAR program participating hospital Antimicrobial

More information

09권오설_ok.hwp

09권오설_ok.hwp (JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction

More information

untitled

untitled Pseudomonas aeruginosa 에의한요로감염의임상적특성 The Clinical Features of Complicated Urinary Tract Infections by Pseudomonas aeruginosa Jung Woo Lee, Kyung Jae Oh, Seung Chol Park, Joung Sik Rim From the Departments

More information

<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770>

<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770> J of Korean Tunn Undergr Sp Assoc 15(5)497-504(2013) eissn: 2287-4747 http://dx.doi.org/10.9711/ktaj.2013.15.5.497 pissn: 2233-8292 도로터널의 갱구부 경관설계가 터널 내부조명에 미치는 영향에 관한 연구 이미애 1 ㆍ이동희 2 * 1 아이라이트 대표이사 2

More information

( ) 이남용.hwp

( ) 이남용.hwp 임상검사와정도관리 : 제 32 권제 12 호 2010 J Lab Med Qual Assur 2010; 32:11-24 11 임상미생물학검사신빙도조사결과보고 (2009) 이남용 ( 집필대표 ) 김명숙 김미나 김민중 김선주 김성일 김의종 김재석 용동은 윤남섭 이장호 주세익 대한임상검사정도관리협회임상미생물학분과위원회 Annual Report on External

More information

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic

More information

대한진단검사의학회지제 26 권제 3 호 2006 Korean J Lab Med 2006;26: 원저 임상미생물학 충주지역에서집단발생한 Extended-spectrum -lactamase 생성 Shigella sonnei 감염의임상적특성 홍성진 1 이창훈 2

대한진단검사의학회지제 26 권제 3 호 2006 Korean J Lab Med 2006;26: 원저 임상미생물학 충주지역에서집단발생한 Extended-spectrum -lactamase 생성 Shigella sonnei 감염의임상적특성 홍성진 1 이창훈 2 대한진단검사의학회지제 26 권제 3 호 2006 Korean J Lab Med 2006;26:168-73 원저 임상미생물학 충주지역에서집단발생한 Extended-spectrum -lactamase 생성 Shigella sonnei 감염의임상적특성 홍성진 1 이창훈 2 왕준호 3 송원근 4 정석훈 5 건국대학교의과대학소아과학교실 1, 진단검사의학교실 2, 내과학교실

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing

More information

주간건강과질병 제 12 권제 16 호 연구단신, Brief report 년국내표본감시기관의료관련감염병 ( 항생제내성균 6 종 ) 발생현황 질병관리본부감염병관리센터의료감염관리과이승재, 이은주, 박현정, 이상은, 김성남, 이형민 * * 교신저자 : s

주간건강과질병 제 12 권제 16 호 연구단신, Brief report 년국내표본감시기관의료관련감염병 ( 항생제내성균 6 종 ) 발생현황 질병관리본부감염병관리센터의료감염관리과이승재, 이은주, 박현정, 이상은, 김성남, 이형민 * * 교신저자 : s 연구단신, Brief report 2 2013 2017 년국내표본감시기관의료관련감염병 ( 항생제내성균 6 종 ) 발생현황 질병관리본부감염병관리센터의료감염관리과이승재, 이은주, 박현정, 이상은, 김성남, 이형민 * * 교신저자 : sea2sky@korea.kr, 043-719-7580 Results of healthcare-associated infection

More information

(웹용)대한가정의학회지-5월호.indd

(웹용)대한가정의학회지-5월호.indd Korean J Fam Med. 2010;31:384-389 doi:10.4082/kjfm.2010.31.5.384 Extended-Spectrum β-lactamase 을생성하는 Escherichia Coli 감염에의한패혈증 1 예 Case Report 이승범, 김춘옥, 강희철 * 연세대학교의과대학가정의학교실 A Case Report of Sepsis by

More information

Table 2. Antimicrobial susceptibility (%) of P. aeruginosa a Antimicrobial agents Resistant Intermediate Susceptible Piperacillin 44/25 b 12/11 44/64

Table 2. Antimicrobial susceptibility (%) of P. aeruginosa a Antimicrobial agents Resistant Intermediate Susceptible Piperacillin 44/25 b 12/11 44/64 Nov 2012 Vol. 20, No. 4 Ser. No. 79, Quarterly ISSN1226-1734 www.whonetkorea.org Antimicrobial resistance of clinical isolates of bacteria during July to September, 2012 Antimicrobial resistance rates

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

14.531~539(08-037).fm

14.531~539(08-037).fm G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked

More information

Table 1. Antimicrobial resistance rates (%) of frequently isolated gram-negative bacilli a Antimicrobial agents ECO KPN KOX CFR ECL EAE SMA PMI PVU MM

Table 1. Antimicrobial resistance rates (%) of frequently isolated gram-negative bacilli a Antimicrobial agents ECO KPN KOX CFR ECL EAE SMA PMI PVU MM February 2012 Vol. 20, No. 1 Ser No. 76 Quarterly ISSN1226-1734 www.whonetkorea.org pathogens. The rates before 2006 included duplicate Antimicrobial resistance of clinical isolates of bacteria in 2011

More information

untitled

untitled Korean J Clin Microbiol Vol. 11, No. 2, October, 2008 Detection of CTX-M-Type Extended-Spectrum β-lactamase in Clinical Isolates of Chromosomal AmpC β-lactamase-producing Enterobacteriaceae from Korea

More information

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract

More information

03-서연옥.hwp

03-서연옥.hwp 농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥

More information

untitled

untitled 대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran

More information

jaeryomading review.pdf

jaeryomading review.pdf 4 5 6 7 8 9 10 11 12 13 1. S. Kim, H. Y. Jeong, S. K. Kim, S. Y. Choi and K. J. Lee, Nano Lett. 11, 5438 (2011). 2. E. Menard, K. J. Lee, D. Y. Khang, R. G. Nuzzo and J. A. Rogers, Appl. Phys. Lett. 84,

More information

l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related

More information

untitled

untitled Ann Clin Microbiol Vol. 19, No. 2, June, 2016 http://dx.doi.org/10.5145/acm.2016.19.2.48 pissn 2288-0585 eissn 2288-6850 Distribution and Antimicrobial Resistance of Streptococcus pneumoniae at Four University

More information

12이문규

12이문규 Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental

More information

< BFEBBFAAB0E1B0FABAB8B0EDBCAD2DBCF6C1A42028BCADBFEFB4EB292E687770>

< BFEBBFAAB0E1B0FABAB8B0EDBCAD2DBCF6C1A42028BCADBFEFB4EB292E687770> 제출문 질병관리본부장 귀하 이보고서를 균혈증과요로감염원인균의내성실태및내성기전연구 ( 서울대학교의과대 학 / 김의종 ) 과제의연구결과보고서로제출합니다. 2006. 1. 25 주관연구기관명 : 서울대학교의과대학 주관연구책임자 : 김의종 제 1세부과제명 : 균혈증및요로감염을일으키는주요원인균의내성실태 ( 제1세부연구기관 / 세부과제책임자 ): 서울대학교의과대학 /

More information

Table 2. Antimicrobial susceptibility (%) of P. aeruginosa a Antimicrobial agents Resistant Intermediate Susceptible Piperacillin 37/21 b 14/12 49/67

Table 2. Antimicrobial susceptibility (%) of P. aeruginosa a Antimicrobial agents Resistant Intermediate Susceptible Piperacillin 37/21 b 14/12 49/67 Aug 2014 Vol. 22, No. 3 Ser No. 86 Quarterly ISSN1226-1734 www.whonetkorea.org Antimicrobial resistance of clinical isolates of bacteria in April to June, 2014 Antimicrobial resistance rates determined

More information

< D34312D303228B0ADC1F6BBF32CC1D6BCBCC0CD2CB1E8C0C7C1BE292E687770>

< D34312D303228B0ADC1F6BBF32CC1D6BCBCC0CD2CB1E8C0C7C1BE292E687770> 대한임상검사학회지 : 41권제2호, 47-51, 2009 ISSN 1738-3544 소변검체에서분리된 Cysteine 요구성 Escherichia coli 1 예 서울대학교병원진단검사의학과 1, 서울대학교의과대학검사의학교실 2 강지상 1 주세익 1 김의종 1,2 A Case of Cysteine-Requiring Escherichia coli Isolated

More information

untitled

untitled Korean J Clin Microbiol Vol. 5, No., March, http://dx.doi.org/.545/kjcm..5.. Carbapenem-Resistant Acinetobacter baumannii Il Kwon Bae, Seok Hoon Jeong, Kyungwon Lee Department of Laboratory Medicine and

More information

<303920BFF8C0FA203033313720B1E8C7FDC0CE2DB1E8BDC5BFEC203137332D3138312E687770>

<303920BFF8C0FA203033313720B1E8C7FDC0CE2DB1E8BDC5BFEC203137332D3138312E687770> 대한내과학회지: 제 87 권 제 2 호 2014 http://dx.doi.org/10.3904/kjm.2014.87.2.173 항생제 스튜어드십 프로그램에 대한 설문조사 1 경북대학교 의학전문대학원 내과학교실, 2 서울대학교 의과대학 내과학교실 2 김혜인 1 김신우 1 장현하 1 김홍빈 A Survey of Antimicrobial Stewardship Programs

More information

( )Kju269.hwp

( )Kju269.hwp 만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University

More information

<B8F1C2F72E687770>

<B8F1C2F72E687770> 제1장 제17장 성홍열 및 사슬알균 감염증 사슬알균 (Streptococci)은 증식 중의 특징적으로 쌍 또는 사슬모양의 그람양성 알균 으로 catalase 음성, 통성혐기성균이며, 보통 한천배지에서는 발육이 어렵고 혈액이나 혈청 등을 첨가한 배지에서 잘 발육한다. 포도당이나 다른 탄수화물을 분해하나 포도당 을 분해하여 가스를 생성하지 않는다. 이들은 최소

More information

(Microsoft Word - 09-Genetic Diversity of Metallo-\245\342-lactamase Genes of Chryseobacterium indologenes Isolates from Korea)

(Microsoft Word - 09-Genetic Diversity of Metallo-\245\342-lactamase Genes of Chryseobacterium indologenes Isolates from Korea) Biomedical Science Letters 2019, 25(3): 275~281 https://doi.org/10.15616/bsl.2019.25.3.275 eissn : 2288-7415 Original Article Genetic Diversity of Metallo-β-lactamase Genes of Chryseobacterium indologenes

More information