KJFPpISSN 2233-9019 eissn 2233-9116 Original Article 한국 1 차병원의 Pseudomonas aeruginosa 에서 blavim-2 유전자관찰 윤정숙 서울베스티안병원 bla VIM-2 of Pseudomonas aeruginosa in primary hospitals in Korea Jeong-sook Yoon Director of laboratory medicine, Bestian Seoul Hospital. Background: In 2007, the resistance rate of Pseudomonas aeruginosa to imipenem was 29% in Korean tertiary hospitals. The main cause of imipenem resistance is the metalloβ-lactamase. A few studies about metallo-β-lactamase are found in tertiary hospitals, however, there are few studies in primary hospitals. Therefore, we studied whether genes encoding metallo-β-lactamase were present in P. aeruginosa isolates from primary hospitals, and studied bla VIM-2 using molecular methods. Materials and methods: A total of 960 blood, body fluid, open and closed pus, sputum, and urine specimens obtained from 27 primary hospitals of Bundang district were used this study. A screening test of metallo-β-lactamase was performed. The primers for bla VIM-2, and bla NDM-1 were used. DNA was extracted using the AccuPrep Nano-plus Plasmid mini Extraction Kit(Bioneer, Cheongwon, Korea). PCR was performed using AccuPower PCR PreMix(Bioneer). Results: P. aeruginosa was isolated from 42 of the 960 specimens. After PCR was performed for all 42 isolates using the three sets of metallo-β-lactamase gene-specific primers, bla VIM-2 Was detected in one sputum isolate. Conclusion: This study gives us warning that the metallo-β-lactamase could spread in the community. Keywords: Pseudomonas aeruginosa, VIM-2, resistance 서론 저자들은 1 차병원들에서전향적연구로서 P. aeruginosa 균주의 imipenem 내성을살펴보고, 국내에서흔한 metallo β-lactamase 유 Pseudomonas aeruginosa 는주요한병원감염균이다. 1, 2) P. 전자인 bla VIM-2 을관찰하고자하였다. aeruginosa 병원균은대부분의항균제에내성으로 carbapenem 외 에는쓸수있는항균제가없는경우가많다. 3, 4) 그러나 carbapenem 에까지내성인 P. aeruginosa와 Acinetobacter균이증가하고있다. 2006년 12개의 3차병원 5) 을대상으로한연구결과, P. aeruginosa 의 imipenem 내성율은 29% 나되었다. Imipenem의내성기전들로는막변형, 항균제유출, 분해효소등이있으며, 분해효소는주로 metallo-β-lactamase가많고대부분이 bla VIM-2 나 bla IMP-1 이다. 6, 7) metallo β-lactamase와유전자에관한연구는 3차병원분리주를대상으로드물게이루어져왔다. 그러나지역사회를대표하는 1 차병원들에서 metallo β-lactamase에관한연구는거의없다. 8) 재료및방법 1. 배양및항균제감수성검사 1차병원 27병원들로부터의뢰온폐쇄성, 개방성농, 혈액, 체액, 객담, 소변 960 검체를대상으로배양및항균제감수성검사를실시했다. 1차병원의정의는외래환자만보며, 의사수 3인이내인경우로하였다. 3차병원에입원경력이있거나항균제사용력이있는환자는대상에서제외하였다. 반복분리주는제외하였다. 생화학적방법과 API 20NE system(biomerieux, Marcy 1 Etoile, France) 및 Received June 18, 2015 Revised August 21, 2015 Accepted August 31, 2015 Corresponding Author Jeong-sook Yoon Tel: +82-70-7609-9913, Fax: +82-70-7005-4230 E-mail: js1345@medigate.net Copyright 2015 The Korean Academy of Family Medicine This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. www.kafm.or.kr 117
KJFP Jeongsook Yoon. bla VIM-2 of Pseudomonas aeruginosa in primary hospitals in Korea Vitek(Biomerieux, Marcy 1 Etoile, France) 으로균을동정하였다. 항균제감수성검사는디스크확산법및 Vitek 2 system (Biomerieux, Marcy 1 Etoile, France) 으로두가지모두검사하였다. 항균제는 piperacillin, tobramycin, piperacillin/tazobactam, cefotaxime, ceftazidime, cefepime, aztreonam, gentamicin, amikacin, ciprofloxacin, trimethoprim/sulfamethoxazole, imipenem, colistin 을포함했다. 대조균주는 P. aeruginosa ATCC 27853 으로 하였다. 2. 선별검사 metallo-β-lactamase 를검출하고자 Hodge 변법과 imipenem- EDTA 상승시험을실시하였다. Hodge 변법은 E. coli ATCC 25922 를 McFarland 0.5 관탁도로 Mueller-Hinton 한천에면 봉으로접종한후배지중앙에 imipenem 디스크를놓고시험세 균을 imipenem 디스크로부터획선하였다. 24 시간배양후억제 대가시험세균의증식선에따라들어가면양성으로판독하였다. Imipenem-EDTA 상승시험은시험세균을 McFarland 0.5 관탁 도로 Mueller-Hinton 한천에면봉으로접종후 10μg imipenem 디 스크와 0.5 M EDTA 디스크를 10mm 간격으로놓고, 35 에서 24 시간배양한후디스크사이에억제대가생기면양성으로판독했 9, 10) 다. 3. metallo-β-lactamase 유전자의중합효소연쇄반응 (PCR) 1) 시발체 bla VIM-2 에대한시발체의염기서열은다음과 7, 11, 12) 같다. VIM2(1) bla VIM-2 5 ATGTTCAAACTTTTGAGTAAG 3 VIM2(2) bla VIM-2 5 CTACTCAACGACTGAGCG 3 IMP1(1) IMP1(2) bla IMP-1 5 -CATGGTTTGGTGGTTCTTGT-3 bla IMP-1 5 -ATAATTTGGCGGACTTTGGC-3 NDM1(1) bla NDM-1 5 ATGGAATTGCCCAATATTATGC 3 NDM1(2) bla NDM-1 5 TCAGCGCAGCTTGTCGGCCAT 3 bla IMP-1 은 485 bp, bla VIM-2 는 801 bp 은 300 bp 의띠가 예상되었다. 2) 중합효소연쇄반응 AccuPrep Nano-plus Plasmid mini Extraction Kit (bioneer, cheongwon, Korea) 를사용하여 DNA 를추출하였다. PCR 은 AccuPower PCR PreMix(bioneer, cheongwon, Korea) 를이용하여 수행하였다. 20pmol 짜리 primer 각각 1μg, DNA 1μg 씩을첨가하 여최종부피 20μL 가되게하였다. cycle 은 94 에서 5 분간둔후, 94 에서 30 초간 denaturation, 56 에서 30 초간 annealing, 72 에서 45 초간 extension 을 25 회하였다. 7) Gene Amp PCR System 9600(Perkin-Elmer Centus Corp., Norwalk, CT, USA) 을이용 하여수행하였다. bla IMP-1 은 485 bp, bla VIM-2 는 801 bp 은 300 bp 에서띠를관찰하였다. 양성대조균주는 KONSAR(Korean Nationwide Surveilance of Antimicrobial Resistance) 에서 bla VIM-2 와 bla IMP-1 P. aeruginosa 를구하였고, 음성대조균주는 P. aeruginosa ATCC 27853 균주를사용하였다. 3) 전기영동 증폭된 DNA 산물 10μL 를 ethidium bromide(10μl/ml) 가첨가 된 2% agarose gel(promega, Madison, WI, USA) 에서 150 volt, 30 분간전기영동하였다. 7) Size marker 는 0~1,500 base pair 구간 의 100 bp DNA ladder standard (Gibco Bethesda Research Lab., Bethesda, MA, USA) 를이용하였다. 결과 960 검체중 P. aeruginosa 는 42 균주검출되었다 (4.4%). 항 균제감수성율을살펴보면, ceftazidime 87%, cefotaxime 33%, cefepime 73%, aztreonam 80%, piperacillin 60%, piperacillin/ tazobactam 82%, tobramycin 60%, gentamicin 79%, amikacin 83%, ciprofloxacin 69%, trimethoprim/sulfamethoxazole 78%, imipenem 100%, colistin 100% 의감수성율을나타냈다 (Table 1). Table 1. Antimicrobial susceptibility of P. aeruginosa in primary hospitals 항균제 1 차병원감수성율 (%) 3 차병원감수성율 (%)[14] CAZ 87 78 CTX 33 CEP 73 73 IPM 100 71 ATM 80 69 CPF 69 61 TRI 78 PIP/Tazo 82 75 AMK 83 75 GM 79 65 PIP 60 63 COL 100 abbreviations; IPM: imipenem, ATM: aztreonam, CEP: cefepime, CAZ:ceftazidime, CTX:cefotaxime. CPF: ciprofloxacin, TRI: trimethoprim/ sulfamethoxazole, PIP/Tazo: piperacillin/tazobactam, AMK: amikacin, GM gentamicin, PIP: piperacillin, TOB: tobarmycin, COL: colistin no results 118 www.kafm.or.kr
윤정숙. 한국 1 차병원의 Pseudomonas aeruginosa 에서 bla VIM-2 유전자관찰 KJFP Figure 1. bla VIM-2 detected on 801 bp. band by PCR The primers for bla VIM-2, and bla NDM-1 were used. DNA was extracted using the AccuPrep Nano-plus Plasmid mini Extraction Kit (Bioneer, Cheongwon, Korea). PCR was performed using AccuPower PCR PreMix (Bioneer) 대조군과비교할때, 1 차병원에서의항균제감수성율이더높았 다 (ceftazidime 87% vs 78%, imipenem 100% vs 71%, aztreonam 80% vs 69%, ciprofloxacin 69% vs 61%, piperacillin/tazobactam 82% vs 75%, amikacin 83% vs 75%, gentamicin 79% vs 65%). metallo-β-lactamase 선별검사에서양성균은관찰되지않았다. 모든 P. aeruginosa 42 검체를가지고 bla VIM-2 에 대하여 PCR 을시행한결과, 객담에서분리된균주에서 metalloβ-lactamase gene bla VIM-2 가검출되어 801 bp 에서띠가관찰되었 다 (Figure 1). 고찰 P. aeruginosa 는기회감염균으로서주로병원환경과중환자 에게많이감염된다. 1, 2) 병원균은 penicillin, aminoglycoside, ciprofloxacin, broad spectrum cephalosporin, monobactam 모 두에내성이고 imipenem 외에는쓸수있는항균제가거의없 다. 3, 4) imipenem 은 penicillin-binding protein 과의친화력이우 수하며, ESBL 을포함한대부분의 β-lactamase 를가수분해하여 betalactam 내성세균에의한감염증치료에유용하게사용된다. 근 래 imipenem 에까지내성인 P. aeruginosa 와 Acinetobacter spp. 가증가하였고, Enterobacteriaceae 중에도내성균주가보고되고 있다. 13) 3 차병원 12 병원을대상으로한연구에서 imipenem 내성 율은 29% 였다. 14) 다른연구에서도 imipenem 내성율을 31.2% 로 보고하여, 15) 3 차병원의 imipenem 내성율은거의 3 분의 1 에달함 을알수있다. 더구나내성율이 2005 년도에는 21%, 2006 년도에는 29% 로급속히증가되고있다고하였다. 다른 3 차병원에서도 2000 년 23%, 2001 년 24%, 2002 년 28%, 2003 년 30% 로서점점증가추 세였다. 14, 19) Enterobacteriaceae 에도 carbapenem 내성이전달되어 CRE(carbapenem resistant Enterobacteriaceae) 로발표되고있다. 16) Imipenem 내성균의치료로는 colistin 과 tigecycline 이비교적효 과적이라고한다. 6, 17) Imipenem 의내성기전으로는막변형으로인 한항균제축적의감소나유출펌프때문으로사료되고, imipenem 분해효소도있다. Carbapenem 분해효소는기능성분류로 Ambler class A 인 serine 형, class B 인 metallo-β-lactamase, class D 인 oxacillinase 가있다. Imipenem 내성은주로 class B 인 metalloβ-lactamase 에의하고, 6, 18) metallo-β-lactamase 는 monobactam 을제외한 β-lactam 제제에내성이며, clavulanic acid 에의해서는 효소활성이억제되지않으나, 금속이온 chelator 인 EDTA 에의 해서는억제된다. 19) 국내에 bla IMP 가발견된이후여러종이발견 13, 19) 되었고그중 VIM-2, IMP-1이가장많이보고되어있다. 581 P. aeruginosa 균주중 bla VIM-2 유전자를나타낸것은 34 균주, bla IMP-1 유전자를나타낸것은 2 균주였다. 7) metallo-β-lactamase 는 plasmid 나 transposon 내에다른항균제내성유전자와함께 integron 상태로공존하므로 17) 쉽게획득되어전파가가능하고다제 내성균으로발전할수있다. Integron 의구조와크기는각각다르 며, 이들은플라즈미드나염색체내에서수평이동으로써다른균에 전달될수있다. transconjugant 실험에서 integron 이 E. coli J53 으 로전달되는것을확인한바있다. bla VIM-2 의구조는 3-6kb 로다양 하고, 위치와서열이다양하다. 13) 이런상황에서국내 1 차병원에서 metallo-β-lactamase 와유 전자를연구한것은거의없다. 3 차병원에서 imipenem 내성균이 급증하는현실에서지역사회의감염감시업무를소홀히할수없 을것이다. 그러나현재 1 차병원의연구는거의없어, 저자들은 1 차병원에서의 metallo-β-lactamase 와유전자를살펴보기로하였 다. 더욱이최근에는미국과여러나라에서 metallo-β-lactamase 인 bla NDM-1 의유행이보고되고있다. NDM-1 형은 2008 년도인도를 여행한스웨덴인에서처음보고되었으며, 최근국내질병관리본부 에서도 bla NDM-1 이보고되었다. 20, 21) bla NDM-1 은주로 Klebsiella 나 E. 16, 22, 23) coli 균주및 P. aeruginosa에서보고된다. 이번연구에서 1 차병원들로부터의뢰온 960 검체들중 42 검체 가 P. aeruginosa 로판명되어 12 개 3 차병원연구보다낮은빈도 로검출되었다. 14) 역시 1 차병원에서 3 차병원의빈도보다낮은빈 도를나타냈다. 이번연구의항균제감수성율은 ceftazidime 87%, cefotaxime 33%, cefepime 73%, aztreonam 80%, piperacillin 60%, piperacillin/tazobactam 82%, tobramycin 60%, gentamicin www.kafm.or.kr 119
KJFP Jeongsook Yoon. bla VIM-2 of Pseudomonas aeruginosa in primary hospitals in Korea 79%, amikacin 83%, ciprofloxacin 69%, trimethoprim/ sulfamethoxazole 78%, imipenem 100%, colistin 100% 의감수성율을나타냈다 (Table 1). 항균제감수성율은시흥지역을대상으로한이전연구와매우유사하였다. 8) 3차병원의연구에서는 ceftazidime 78%, cefepime 73%, aztreonam 69%, piperacillin/ tazobactam 75%, amikacin 75%, gentamicin 65% 를나타냈고, 따라서 1차병원의연구가더높은항균제감수성율을나타냈다. 14) 이번연구에서검출된 42주의 P. aeruginosa중에 imipenem내성은없었다. 1차병원에 imipenem 내성균이거의없고, 아직 imipenem 이유효한치료효과가있음을알수있다. 3차병원이나대학병원에서 imipenem 내성율이거의 30% 에육박함과비교하여지역사회를대표하는 1차병원에는 imipenem 내성균이발견되지않아 3차병원과큰차이를나타내었다. 그러나이번연구에서 bla VIM-2 가 1차병원에서검출되었다 (Figure 1). 객담검체에서분리된균주로 PCR을시행한결과, 801 bp에서정확한띠가관찰되었다. 스크리닝검사와의불일치의이유는유전자수준에서의 bla VIM-2 유전자가충분히 metallo-βlactamase 단백을형성하지않았기때문으로사료된다. 이환자는 community에서균을획득했고이전입원경력이나항균제사용력이없으므로 community onset infection 으로정의된다. 3차병원의국내보고에서도 20균주의 metallo-β-lactamase 생성균주중 19 균주가 bla VIM-2 를보유하고있어 metallo-βlactamase 유전자중대다수가 bla VIM-2 임을나타냈다. 19) 또, 한 3차병원에서도 bla VIM-2 유전자를가진 P. aeruginosa의빈도는 1997년 11.5%, 1998년 8.2%, 1999년 5.9% 로꾸준히보고되었다고하였다. 24) 본연구에서 imipenem 디스크확산법에서는 26mm로감수성, 액체배지희석법에서는 MIC 2μg/mL, 한천희석법은 2μg/mL 로감수성이었다. Imipenem 감수성균에서 metallo-β-lactamase 유전자 bla VIM-2 가검출되었는데, 어떤보고에서는 carbapenemase를생성하는 P. aeruginosa라고해도, 그중 3분의 1은항균제감수성범위내에들었다고하여, carbapenemase를생성하여도감수성균이상당수를차지함을나타냈다. 17) 내성유전자가있어도 carbapenem 제제의종류에따라내성정도가다른것으로보고되어있으므로 ertapenem, meropenem MIC을검사하였다. 그결과 ertapenem, meropenem MIC는 1µg/mL, 2µg/mL 이었다. 국내 3차병원에서도 imipenem 감수성균에서 bla VIM-2 빈도를살펴보면총빈도는지금보다높아질것이다. 따라서이현상은 metallo-β-lactamase를생성하지못하거나, 적게생성하므로아직내성표현형을나타내지않는 plasmid level의 gene transference 나다른 clone 간의 genetic exchange를나타내는것으로사료된다. Shenoy 등의연구에서도 PCR에서 bla NDM-1 을나타낸경우, screeing test에서 metallo-β-lactamase가검출된경우는일부였다고하였다. 25) 그리고현재 metallo-β-lactamase 유전자 bla VIM-2 가국내1차병원으로전파되어있는상황으로사료된다. 지역사회에서 metallo-β-lactamase 생성균의감시를더욱철저히하여야할것으로생각된다. 이를위해서는 Metalo-β-lactamase의빠른검출을위해서분자적검출이필요하다. 결론적으로국내 1차병원에서 P. aeruginosa 42 균주중한균주에서 bla VIM-2 를나타냈다. 아직 1차병원에 metallo-β-lactamase에의한 imipenem 내성균이만연하지는않으나분자적수준의유전자전이를나타내는것으로고려되어, 지역사회에 metallo-β-lactamase bla VIM-2 유전자가침투, 확산되어있다고생각된다. 분자유전수단을통한감염감시관리를철저히하여야할것이다. 요약연구배경 : 2007년, 한국 3차병원에서 Pseudomonas aeruginosa의 imipenem 내성율은 29% 였다. 내성의가장흔한원인은 Metalloβ-lactamase이다. 3차병원에서는 metallo-β-lactamases에관한보고들이있으나, 1차병원에서이에대한연구는거의없다. 이연구의목적은 1차병원들에서 metallo-β-lactamase가존재하는지와한국에서흔한bla VIM-2 유전자및 bla NDM-1 을분자적으로검출하고자한것이다. 재료및방법 : 연구대상은 27개의분당지역 1차병원들로부터의뢰온개방성또는폐쇄성창상, 혈액, 체액, 객담, 소변 960 검체였다. 이들에서분리된 P. aeruginosa에서 metallo-β-lactamase 선별검사를실시하였다. 시발체 bla VIM-2 를제조하였다. 검체에서 AccuPrep Nano-plus Plasmid mini Extraction Kit(bioneer, cheongwon, Korea) 를이용하여 DNA를추출한후, AccuPower PCR PreMix를이용하여 PCR을수행하였다. 결과 : 960 검체중 P. aeruginosa는 42 검체에서분리되었다 (4.4%). 42 검체모두를 PCR한결과 1 균주에서 bla VIM-2, 가검출되었다. 결론 : 한국의 1차병원들의 P. aeruginosa 균주에서 bla VIM-2 가검출되었다. metallo-β-lactamase 유전자를검출하기위한 surveillance 프로그램이필요할것이다. 120 www.kafm.or.kr
윤정숙. 한국 1 차병원의 Pseudomonas aeruginosa 에서 bla VIM-2 유전자관찰 KJFP 중심단어 : 녹농균, VIM-2, 내성균 REFERENCES 1. Inacio HS, Bomfim MR, França RO, Farias LM, Carvalho MA, Serufo JC et al.phenotypic and Genotypic Diversity of Multidrug- Resistant Pseudomonas aeruginosa Isolates from Bloodstream Infections Recovered in the Hospitals of Belo Horizonte, Brazil. Chemotherapy. 2014 ;60(1):54-62. [Epub ahead of print] 2. Yan Y, Yao X, Li H, Zhou Z, Huang W, Stratton CW, et al. A Novel Pseudomonas aeruginosa Strain with an oprd Mutation in Relation to a Nosocomial Respiratory Infection Outbreak in an Intensive Care Unit. J Clin Microbiol. 2014 ;52(12):4388-90. 3. Bell, S. M., J. N. Pham, and J. Y. M. Lanzarone. Mutation of Pseudomonas aeruginosa to piperacillin resistanc mediated by β -lactamase production. J. Antimicrob. Chemother. 1985;15:665-670. 4. Scullly, B. E., M. F. Parry, H. C. Neu, and Mandell. Oral cyflofloxacin therapy of infections due to Pseudomonas aerginosa. Lancet 1986;1:819-22.Scullly, B. E., M. F. Parry, H. C. Neu, and Mandell. Oral cyflofloxacin therapy of infections due to Pseudomonas aerginosa. Lancet 1986;1:819-22. 5. Hong SG, Yong DE, Lee KY, Kim EC, Lee WK, Jeong SH, et al. Antimicrobial resistance of clinically important bacteria isolated from hospitals located in representative provinces of Korea. Korean J Clin Microbiol 2003;6(1): 29-36. 6. Castanheira M, Sader HS, Deshpande LM, Fritsche TR, and Jones RN. Antimicrobial activities of tigecycline and other broad spectrum antimicrobials tested against serine carbapanemase and metallo-β -lactamase producing Enterobacteriaceae: Report from the Sentry antimicrobial surveillance program. Antimicrob Agents Chemother 2008;52(2):570-3. 7. Lee KY, Yum JH, Yong DE, Lee HM, Kim HD, Jennis DD, et al. Novel acquired metallo-β-lactamase gene, blasim-1, on a class 1 integron from Acinetobacter baumannii clinical isolates from Korea. Antimicrob Agents Chemother 2005;49(11):4485-91. 8. Yoon JS. Antimicrobial resistance of urinary isolates in the urine collected from patients admitted into primary-care hospital in Shiheung district. Korean J Clin Microbiol 2013;16(2);145-8. 9. Performance Standards for Antimicrobial Susceptibility Testing; Twentieth Informational Supplement. Table 2A-S2. 2010. 10. Lee K, Chong Y, Shin HB, Kim YA, Yong D, Yum JH. Modified Hodge and EDTA-disk synerge tests to screen metallo-betalactamase-producine strains of Pseudomonas and Acinetobacter species. Clin Microbiol Infect 2001;7:88-91. 11. Liu ZY, Li W, Wang J, Pan J, Sun SP, Yu YH. First NDM-1 producing E.coli strain in China. PLoS One. 2013 Jun 10;8(6):1-6. 12. Poirel L, Naas T, Nicolas D, Collet L, Bellais S, Cavallo JD et al. Characterization of VIM-2, a carbapenem-hydrolyzing metallobeta-lactamase and its plasmid- and integron-borne gene from a Pseudomonas aeruginosa clinical isolate in France. Antimicrob Agents Chemother 2000;44:891-7. 13. Yum JH, Shin HB, Yong DE, Chong YS. Diversity of integrons carrying blavim-2 cassette in Pseudomonas spp. and Acinetobacter spp. Korean J Clin Microbiol 2012;15;131-8. 14. Lee HM, Kim CK, Lee JW, Lee SH, Ahn JY, Hong SG et al. Antimicrobial resistance of clinically important bacteria isolated from 12 hospitals in Korea in 2005 and 2006. Korean J Clin Microbiol 2007;10:59-69. 15. Yoon YS, Lee BY, Bae IK, Kwon SB, Jeong SH, Jeong TJ. Prevalence of Imipenem-Resistant Pseudomonas aeruginosa Isolates and Mechanisms of Resistance. Korean J Clin Microbiol 2005;8(1):26-33. 16. Green DA, Srinivas N, Watz N, Tenover FC, Amieva M, Banaei N. A pediatric case of New Delhi metallo-β-lactamase(ndm-1)- producing Enterobacteriaceae in the United States. Pediatric Infect Dis J. 2013 Jun 5. [Epub ahead of print] 17. Castanheira M, Sader HS, Deshpande LM, Fritsche TR, Jones RN. Antimicrobial activities of tigecycline and other broad-spectrum antimicrobials tested against serine carbapenemase- and metallo-β -lactamase-producing Enterobacteriaceae: Report from the SENTRY antimicrobial surveillance program. Antimicrob Agents Chemother 2008;52(2):570-3. 18. Queenan, A. M., and K. Bush. 2007. Carbapenemases: the versatile β-lactamases. Clin. Microbiol. Rev. 20:440-458. 19. K IS, Oh WI, Song JH, Lee NY. Screening and Identification of metallo-β-lactamase gene in clinical isolates of imipenem-resistant Pseudomonas aeruginosa. Korean J Lab Med 2004;24(3)177-82. 20. Rasheed JK, Kitchel B, Zhu W, Anderson KF, Clark NC, Ferraro MJ el al. New Delhi metallo-β-lactamase-producing Enterobacteriaceae, United States. Emerging Infect Dis 2013;19870-8. 21. Yoo JS, Kim HS, Yang JW, Yoo JI, Kim HS, Park HK et al. Nosocomial transmission of NDM-1-producing Escherichia coli ST101 in a Korean hospital. J Antimicrob Chemother. 2013; 68:2170-2. 22. Bushnell G, Mitrani-Gold F, Mundy LM. Emergence of New Dehli metallo-β-lactamase type 1-producing enterobacteriaceae and non-enterobacteriaceae: global case detection and bacterial surveillance. Int J Intect Dis 2013;17(5):e325-33. 23. Cunningham SA, Noorie T, Meunier D, Woodford N, Patel R. Rapid and simultaneous detection of genes encoding Klebsiella pneumoniae carbapenemase (blakpc) and New Dehli metallo-β -lactamase(blandm) in Gram-negative bacilli. J Clin Microbiol 2013;51(4):1269-71. 24. Lee K, Lim JB, Yum JH, Yong D, Chong Y, Kim JM. blavim2 cassette-containing novel integrons in metallo-β-lactamaseproducing Pseudomonas aeruginosa and Pseudomonas putida isolated disseminated in Korean hospital. Antimicrob Agents Chemother 2002;46:1053-8. 25. Shenoy KA, Jyothi EK, Ravikumar R. Phenotypic identification & molecular detection of bla (ndm-1) gene in multidrug resistant Gram-negative bacilli in a tertiary care centre. Indian J Med Res. 2014;139(4):625-31. www.kafm.or.kr 121