03.fm

Size: px
Start display at page:

Download "03.fm"

Transcription

1 Journal of Korean Nature Vol. 1, No , 2008 Flora of Gyeongju National Park, Korea Sang-Myong Lee 1 *, Hwa-Yun Lee 1, Yu-Mi Lee 2, Soo-Hyun Park 2, Byoung-Chun Lee 2, and Won-Hyeon Lim 3 1 National Science Museum, Guseong-dong, Yuseong-gu, Daejeon , Korea 2 Korea National Arboretum, Jikdong-ri, Scheul-eub, Pocheon-si, Gyeonggi-do , Korea 3 Gyeongju University, Hyohyun-dong, Gyongju, Gyongbok , Korea Abstract : This study found 39 orders, 112 families, 354 genuses, 515 species, 1 sub-species, 78 varieties and 11 forma, totalling 605 classifications. Dominant vegetations were deciduous trees (oak trees) such as Quercus mongolica, Q. vuriubilis, Q. acutissima, Q. aliena, and Q. serrata in Tohamsan and Danseoksan areas while dominant species was Pinus thunbergii in the Daebon area and P. densiflora in the Gumisan, Namsan, Sogeumkang, Hwarang and Seoak areas. Pte-Q was It was higher than in mountainous inland areas, which was desirable succession. Key words : Flora, Gyeongju National Park Introduction The first research into the plants in Korea was the research conducted by the Russian Scientist, Schlippenbach, B. A. (1854), who collected 50 or so floral species in the East Sea and sent them to the western nations. Then, fathers Faurie, R. P. U. and Taquet, E. J. collected samples and sent them to the scientists in Europe, which was published in the academic circle. Palibin, J. W. (1898~1901) organized their research findings and published Conspectus Florae Koreae. After that, a Japanese scientist, Nakai (190, 1911) compiled and published Flora koreana (I, II). After the liberation of Korea from the Imperial Japan, Chuong (1956, 1957) published the picture book of Korean plants, which served as a breakthrough to the development of the botany of Korean peninsula, revitalizing botanical research by the Koreans. However, the western materialism that swept Korea with the liberation accelerated industrialization, which shifted the focus of national policies to industrialization and development. As a result, industrial complexes, residential areas and furthermore, entertainment areas made inroads into national land. With the destruction of national land, most of living creatures were placed in life-threatening danger. Although some areas are designated and protected as national parks, these areas barely escape from serious devastation. Unfortunately, the government cannot *To whom correspondence should be addressed. Tel: smlee0998@hanmail.net even come up with countermeasures. Most of species (about 70%) are inhabited in national parks and natural conservational areas, but with lack of scientific and academic research into these areas. It is realistically difficult to set up protection and preservation policies of the species. Though intensive research is recently conducted in some of national parks and conservation areas, it is extremely short-lived and limited. Thus, this research was intended to provide basic data for further research, preservation and maintenance by identifying the flora that grow in 8 areas of the national park. Materials and Methods Overview on research sites Gyeongju National Park stretches 8 areas in and around Gyeongju-si, Gyeongsangbukdo. Tohansan area (76.95 km 2 ), Namsan area (21.0 km 2 ), and Daebon area were designated as national parks in 1968, covering a total of km 2. With the addition (1.0 km 2 ) to Daebon area in 1971, Seoak area (4.30 km 2 ), Hwarang area (3.90 km 2 ), Sogeumgangsan area (6.8 km 2 ), and Danseoksan area (14.0 km 2 ) were included into the national park, making it a total of km 2. Currently, the Gyeongju National Park covers km 2 with the new inclusion of Gumisan area (6.11 km 2 ) in Of the park, an area of km 2 is designated as national conservation area, km 2 as national environmental area, and km 2 as communities. Research Method The research into the flora and vegetation conducted three

2 22 Sang-Myong Lee, Hwa-Yun Lee, Yu-Mi Lee, Soo-Hyun Park, Byoung-Chun Lee, and Won-Hyeon Lim Table 1. Composition of vascular plants in Sosan, Gyeongju National Park Equisetineae Filicineae Gymnospermae Angiospermae Monocotyledoneae Dicotyledoneae Total I; Previous research, II; Previous research + this research Order Family Genus Species Sub species Variety Breed Total I II I II I II I II I II I II times from May 23 to May 25, 2007, from Aug. 18 to Aug. 19, 2007 and from Sept. 29 to Sept. 30, Dry samples made for research of the flora is reserved in the National Museum of Science and the Korea National Arboretum and identification and classification of the species referred to picture books of Chuong (1956, 1957), Nakai (1909, 1911), Ohwi (1984), and Lee (1980). On the other hand, Pte-Q was obtained to fathom the degree of damage to forest vegetation. Results and Consideration The Flora For the flora, Kim (1994) reported 81 families, 208 genuses, 238 species, 1 sub-species, 37 varieties and 1 forma which totalled 277 taxons while Lee (1997) reported 39 orders, 109 families, 332 genuses, 458 species, 1 subspecies, 71 varieties and 10 forma which totalled 540 taxons. This research found 39 orders, 112 families, 354 genuses, 515 species, 1 subspecies, 78 varieties and 11 forma which totalled 605 taxons. Table 2. List on the Vascular plants in Gyeongju National Park Tracheophyta Œ Sphenopsida Œ Equisetineae ~ Equisetales Œ Equisetaceae Equisetum arvense Linne» o Pteropsida e Œ Filicineae š ~ Ophioglossales š Œ Ophioglossaceae š Botrychium ternatum (Thunberg) Sw. š o Filicales š Œ Osmundaceae š Osmunda japonica Thunberg š o Pteridaceae š Dennstaedtia wilfordii (Moore) Christ. yš o Dennstaedtia hirsuta (Sw.) Mett. ex Miq. š $ Pteridium aquilinum var. latiusculum (Desv.) Underw. š o Davalliaceae š Davallia mariesii Moore š o

3 Flora of Gyeongju National Park, Korea 23 Aspidiaceae Woodsia manchuriensis Hooker t o Woodsia polystichoides Eaton t o Polystichum tripteron (Kunze) Presl š o Dryopteris bissetiana (Bak.) C. Christ. š o Dryopteris sacrosancta Koidz.» š o Dryopteris chinensis (Bak.) Koidz. ƒ š $ Dryopteris erythrosora O. Kuntze y š Lastrea japonica (Bak.) Copel. š Athyrium vidalii (Fr. et Sav.) Nakai š o Athyrium yokoscense (Fr. et Sav.) H. Christ š $ Athyrium niponicum (Mett.) Hance š $ Athyrium dimorphophyllum (Koidz.) Tagawa j š $ Aspleniaceae Õ š Asplenium incisum Thunb. Õ š $ Polypodiaceae š Lepisorus onoei (Fr. et Sav.) Ching» o Gymnospermae ù ~ Coniferophytae Ginkgoales wù Œ Ginkgoaceae wù Ginkgo biloba Linne wù o Coniferales Œ Taxaceae Taxus cuspidata S. et Z. o Cephalotaxus koreana Nakai ù o Pinaceae ù Abies holophylla Maximowz ù o Larix leptolepis (S. et Z.) Gordon ù o Cedrus deodara (Roxb.) Loudon ù o Pinus koraiensis S. et Z. ù o Pinus rigida Mill.» ù o Pinus densiflora S. et Z. ù o Pinus thunbergii Parl. o Cupressaceae d ù Thuja orientalis Linne d ù o Juniperus rigida S. et Z. ù o Angiospermae v ~ Monocotyledoneae ~ Pandanales Œ Typhaceae Typha angustata Bory et Chaub» o Helobiales Œ Potamogetonaceae ƒ Potamogeton crispus Linne o Zosteraceae Zostera marina Linne o Phyllospadix iwatensis Makino o

4 24 Sang-Myong Lee, Hwa-Yun Lee, Yu-Mi Lee, Soo-Hyun Park, Byoung-Chun Lee, and Won-Hyeon Lim Alismataceae k Sagittaria pygmaea Miquel o Sagittaria aginashi Makino t o Hydrocharitaceae t Hydrilla verticillata Casp. o Graminales Œ Gramineae Phyllostachys nigra var. henonis Stapf o Sasa borearis (Hack.) Makino o Pseudosasa japonica Makino o Alopecurus aequalis var. amurensis (Kom.) Ohwi t $ Agrostis clavata Trin. o Calamagrostis arundinacea (Linne) Roth t o Cleistogenes hackelii (Honda) Honda t $ Avena sativa Linne o Agropyron ciliare (Trin.) Fr. l o var. transiens (Hack.) Ohwi o Bromus japonicus Thunberg o Festuca ovina Linne ½ l o Poa sphondylodes Trin. s t o Poa annua L. s t $ Melica onoei Fr. o Molinia japonica Hack. r $ Muhlenbergia japonica Steud. Õ $ Zizania latifolia Turcz. o Phragmites communis Trin. o Phragmites japonica Steud. t $ Eragrostis ferruginea (Thunberg) P. Beauv. o Eragrostis multicaulis Steud. o Eleusine indica (Linne) Gaertner o Cynodon dactylon (Linne) Pers. o Spodiopogon sibiricus Trin. j» $ Sporobolus elongatus R. Br. Õ t o Sporobolus japonicus (Steud.) Maxim. ex Rendle ù $ Themeda triandra var. japonica (Willd.) Makino $ Zoysia japonica Steud. o Arundinella hirta (Thunberg) Tanaka o Arundinella hirta var. ciliata Koidz. l $ Pennisetum alopecuroides (Linne) Spreng. j o Pennisetum alopecuroides (Linne) Spreng. for. viridescens Ohwi j o Sacciolepis indica (L.) Chase $ Setaria viridis (Linne) Beauv. t o Setaria faberii Herrm. ƒ t $ Setaria glauca (L.) P.Beauv. t $ Digitaria sanguinalis (Linne) Scop. o Digitaria violascens Link o Eriochloa villosa (Thunberg) Kunth ù v o Oplismenus undulatifolius (Ard.) Roem. et Schult. t o Oplismenus undulatifolius (Ard.) Roem. et Schult. var. japonicus Koidz. t o Echinochloa crus-galli (Linne) Beauv. v o Echinochloa crus-galli var. frumentacea (Roxb.) Wight v o Paspalum thunbergii Kunth ex Steud. v $ Miscanthus sacchariflorus Benth. o Miscanthus sinensis Anderss. o Miscanthus sinensis Anderss. var. purpurascens Rendle o Cymbopogon tortilis var. goeringii (Steud.) Hand.- Mazz. o

5 Flora of Gyeongju National Park, Korea 25 Cyperaceae Carex laevissima Nakai o Carex canescens Linne o Carex humilis Leyss. o Carex pediformis C. A. Meyer o Carex lanceolata A. Gray o Carex siderosticta Hance o Eleocharis acicularis for. longiseta (Svenson) T. Koyama l o Fimbristylis miliacea (Linne) Vahl w» o Bulbostylis densa (Wall.) Hand.-Mazz. w» $ Scirpus radicans Schk. o Scirpus karuizawensis Makino š o Scirpus fluviatilis (Torr.) A. Gray» o Scirpus wallichii Nees š o Scirpus triqueter Linne š o Cyperus orthostachyus Fr. et Sav. o Cyperus amuricus Maximowz o Cyperus difformis Linne o Cyperus iria L. $ Cyperus microiria Steud. $ Cyperus sanguinolentus Vahl ƒ $ Arales û Œ Araceae û Pinellia ternata (Thunberg) Breit. w o Arisaema angustatum var. peninsulae Nakai û o Arisaema amurense var. serratum Nakai û o Lemnaceae Spirodela polyrhiza (Linne) Schleid. o Lemna paucicostata Hegelm. o Farinales Œ Commelinaceae t Commelina communis Linne t o Commelina coreana Lév. t o Aneilema keisak Hassk. t o Liliales wœ Juncaceae t Luzula capitata (Miq.) Miq. ç o Luzula multiflora Lej. ç o Juncus effusus var. decipiens Buchen t o Liliaceae w Veratrum maackii var. japonicum T. Shimizu o Hosta minor (Bak.) Nakai o Hosta longipes (Fr. et Sav.) Matsumura o Hemerocallis fulva Linne o Hemerocallis minor Mill.» o Allium grayi Regel o Allium thunbergii G. Don o Allium monanthum Maximowz o Lilium tsingtauense Gilg w ù o Lilium distichum Nakai ù o Lilium concolor var. partheneion Bak. w ù o Lilium amabile Palibin l ù o Lilium leichtlinii var. tigrinum Nichols ù o Lilium tigrinum Ker - Gawl. ù o

6 26 Sang-Myong Lee, Hwa-Yun Lee, Yu-Mi Lee, Soo-Hyun Park, Byoung-Chun Lee, and Won-Hyeon Lim Asparagus schoberioides Kunth o Polygonatum humile Fisch. ƒ o Polygonatum odoratum var. pluriflorum Ohwi o Disporum sessile D. Don qù o Disporum smilacinum A. Gray»ù o Disporum viridescens (Maximowz) Nakai j»ù o Convallaria keiskei Miq. o Liriope platyphylla Wang et Tang o Smilax nipponica Miq. ù o Smilax riparia var. ussuriensis Hara et T. Koyama ù o Smilax china Linne o Smilax sieboldii Miq. ƒ o Smilax sieboldii Miq. var. inermis Nakai ƒ o Amarylidaceae y Lycoris squamigera Maximowz y o Dioscoreaceae Dioscorea japonica Thunberg o Dioscorea batatas Decne. o Dioscorea tokoro Makino Õ o Dioscorea nipponica Makino o Dioscorea quinqueloba Thunberg t o Dioscorea septemloba Thunberg y o Iridaceae Iris koreana Nakai o Iris pseudoacorus Linne s o Iris nertschinskia Lodd. o Iris rossii Bak. ƒ $ Orchidales ù Œ Orchidaceae ù Platanthera metabifolia F. Maekawa ù o Cephalanthera erecta (Thunberg) Bl. ù o Spiranthes sinensis (Pers.) Ames k ù o Dicotyledoneae ~ Archichlamydeae qyƒ Piperales z Œ Chloranthaceae y Chloranthus japonicus Sieb. y o Salicales ù Œ Salicaceae ù Populus deltoides Marsh. ù o Populus tomentiglandulosa T. Lee ù o Salix glandulosa Seem. o Salix koreensis Anderss. ù o Salix dependens Nakai. o Salix hulteni Floderus y o Salix purpurea var. japonica Nakai. j o Salix gracilistyla Miq. ˆ o Juglandales ƒ ù Œ Juglandaceae ƒ ù Platycarya strobilacea S. et Z. vù o Juglans mandshurica Maximowz ƒ ù o

7 Flora of Gyeongju National Park, Korea 27 Fagales ù Œ Betulaceae ù Betula schmidtii Regel. ù o Betula platyphylla var. japonica Hara ù o Alnus japonica Steud. ù o Alnus hirsuta (Spach) Rupr. ù o Alnus firma S. et Z. o Carpinus cordata Bl. ¾e o Carpinus tschonoskii Maximowz ù o Carpinus laxiflora Bl. ù o Carpinus coreana Nakai ù o Corylus heterophylla Fisch. Bl. ùp ù o Corylus heterophylla var. thunbergii Bl. ù o Corylus sieboldiana var. mandshurica (Maxim) C.K.Schn. ù $ Fagaceae ù Castanea crenata S. et Z. ù o Quercus acutissima Carruth. ù o Quercus variabilis Bl. ù o Quercus dentata Thunberg ù o Quercus aliena Bl. ù o Quercus mongolica Fisch. ù o Quercus serrata Thunberg ù o Urticales»tŒ Ulmaceae ù Ulmus davidiana Planch. ù o Hemiptelea davidii Planch. ù o Zelkova serrata Makino pù o Celtis sinensis Pers. qù o Moraceae ù Morus bombycis Koidz. ù o Morus alba Linne ù o Broussonetia kazinoki Sieb. ù o Cannabinaceae Humulus japonicus S. et Z. y o Urticaceae»t Urtica thunbergiana S. et Z.»t o Pilea peploides Hooker et Arnott m o Boehmeria nivea (Linne) Gaudich. t o Boehmeria spicata Thunberg Á ù o Boehmeria tricuspis Makino Õ o Boehmeria longispica Steud. t o Aristolochiales Œ Aristolochiaceae Aristolochia contorta Bunge o Asarum sieboldii Miq. o Polygonales tœ Polygonaceae t Rumex acetosa Linne o Rumex crispus Linne o Rumex conglomeratus Murr. o Aconogonum polymorphum (Ledeb.) T. Lee o Bilderdykia dumetora (Linne) Dum. o

8 28 Sang-Myong Lee, Hwa-Yun Lee, Yu-Mi Lee, Soo-Hyun Park, Byoung-Chun Lee, and Won-Hyeon Lim Persicaria perfoliata H. Gross Ö o Persicaria senticosa Gross o Persicaria thunbergii H. Gross š o Persicaria nepalensis Miyabe et Kudo ë o Persicaria hydropiper (Linne) Spach ë o Persicaria vulgaris Webb et Moq. ë o Persicaria blumei Gross ë o Persicaria filiforme Nakai ë $ Persicaria lapathifolia S. F. Gray ë $ Persicaria sieboldi Ohki ã ù $ Polygonum aviculare Linne t o Centrospermales Œ Chenopodiaceae Chenopodium album var. centrorubrum Makino o Chenopodium ficifolium Smith o Chenopodium album L. $ Amaranthaceae Amaranthus mangostanus Linne o Achyranthes fauriei H.Lév. & Vaniot l $ Phytolaccaceae œ Phytolacca esculenta V. Houtte œ o Phytolacca americana Linne œ o Portulacaceae Portulaca oleracea Linne o Caryophyllaceae Arenaria serpyllifolia Linne o Pseudostellaria heterophylla (Miq.) Pax. o Pseudostellaria palibiniana (Takeda) Ohwi j o var. hallaisanense Mizushima ù ù o Stellaria aquatica Scop. o Stellaria media Villars o Stellaria alsine var. undulata Ohwi ù o Dianthus sinensis Linne q o Dianthus superbus var. longicalycinus (Maximowz) Williams q o Lychnis cognata Maximowz o Melandryum firmum (S. et Z.) Rohrb. o Melandryum firmum (S. et Z.) Rohrb. for. pubescens Ohwi l o Melandryum seoulense Nakai ƒ o Ranales ù Œ Nymphaeaceae Nymphaea tetragona var. angusta Casp. o Nelumbo nucifera Gaertner o Ceratophyllaceae Ceratophyllum demersum Linne o Ranunculaceae ù Clematis fusca var. violacea Maximowz o Clematis heracleifolia DC. t o Clematis mandshurica Rupr. o Clematis trichotoma Nakai w o Clematis apiifolia A.P. DC. o Pulsatilla koreana Nakai w o

9 Flora of Gyeongju National Park, Korea 29 Hepatica asiatica Nakai o Ranunculus japonicus Thunberg ù o Thalictrum minus var. hypoleucum (S. et Z.) Miq. ç o Thalictrum aquilegifolium Linne ç o Thalictrum actaefolium S. et Z. ç o Aconitum pseudo-laeve var.erectum Nakai o Aconitum jaluense Kom. n o Cimicifuga heracleifolia Kom. o Cimicifuga simplex Wormsk. o Paeonia obovata Maximowz o Paeonia lactiflora var. hortensis Mak. $ Lardizabalaceae Akebia quinata Decne. o Menispermaceae» Cocculus trilobus DC. o Magnoliaceae Magnolia sieboldii K. Koch w ù o Schizandra chinensis Baill o Lauraceae ù Lindera obtusiloba Bl. ù o Lindera obtusiloba Bl. for. villosum Nakai l ù o Lindera glauca Bl. kù o Lindera erythrocarpa Makino ù o Papaverales Œ Papaveraceae Chelidonium majus var. asiaticum (Hara) Ohwi» t o Hylomecon vernale Maximowz vù o Fumariaceae xy Dicentra spectabilis (Linne) Lem. ûy o Corydalis turtschaninovii Bess. xy o Corydalis turtschaninovii var. linearis (Regel) Nakai xy o Corydalis ochotensis Turcz. o Corydalis heterocarpa S. et Z. o Corydalis speciosa Maximowz o Cruciferae y Brassica campestris subsp. napus var. nippo-oleifera Makino $ Lepidium apetalum Willd. þ o Thlaspi arvense Linne þ o Cardamine leucantha O. E. Schulz ù þ o Cardamine flexuosa With. y þ $ Rorippa indica (Linne) Hiern þ o Rorippa islandica (Oedr) Borb. t o Capsella bursa-pastoris (Linne) Medicus þ o Draba nemorosa var. hebecarpa Lindbl. o Arabis glabra (Linne) Bernh. ù o Descurainia sophia (Linne) Prantl o Rosales Œ Crassulaceae ù Orostachys malacophyllus Fisch. o Sedum takesimense Nakai» o Sedum spectabile Boreau jç o

10 30 Sang-Myong Lee, Hwa-Yun Lee, Yu-Mi Lee, Soo-Hyun Park, Byoung-Chun Lee, and Won-Hyeon Lim Sedum verticillatum Linne ç o Sedum erythrostichum Miq. ç o Sedum kamtschaticum Fisch.» o Sedum middendorffianum Maximowz»» o Sedum sarmentosum Bunge ù o Sedum oryzifolium Makino y o Sedum polystichoides Hemsl. y o Saxifragaceae Astilbe chinensis var. davidii Fr. o Chrysosplenium grayanum Maximowz o Deutzia parviflora Bunge o Deutzia glabrata Kom. o Deutzia coreana Lév. y o Philadelphus schrenckii Rupr. šÿù o Philadelphus schrenckii Rupr. var. jackii Koehne lšÿù o Hydrangea serrata for. acuminata (S. et Z.) Wils. o Rosaceae Spiraea prunifolia for. simpliciflora Nakai qù o Spiraea fritschiana Schneid qù o Physocarpus amurensis (Maximowz) Maximowz ù o Stephanandra incisa Zabel ù o Kerria japonica (Linne) DC. y y o Duchesnea chrysantha (Zoll. et Morr.) Miq.» o Potentilla dickinsii Fr. et Sav. o Potentilla fragarioides var. major Maximowz o Potentilla freyniana Bornm. o Potentilla chinensis Ser. o Potentilla paradoxa Nutt. o Geum japonicum Thunberg o Rubus crataegifolius Bunge» o Rubus parvifolius Linne» o Rubus idaeus var. microphyllus Turcz.» o Rubus coreanus Miq.» o Rubus oldhamii Miq.» o Filipendula glaberrima Nakai l t o Sanguisorba officinalis Linne t o Sanguisorba hakusanensis Makino t o Agrimonia pilosa Ledeb. ù o Rosa multiflora Thunberg o Rosa maximowicziana Regel ƒ ù o Prunus persica (Linne) Batsch ù o Prunus yedoensis Matsumura ù o Prunus serrulata var. spontanea (Maximowz) Wils. ù o Prunus sargentii Rehder ù o Pyrus ussuriensis Maximowz o Pyrus pyrifolia (Burm.) Nakai ù o Pourthiaea villosa Decne. ù o Leguminosae g Albizzia julibrissin Durazz. ù o Cercis chinensis Bunge k»ù o Cassia mimosoides var. nomame Makino t o Sophora flavescens Ait. š o Sophora japonica Linne zyù o Maackia amurensis Rupr. et Maximowz var. buergeri C. K. Schneid. t ù o Lespedeza thunbergii var. intermedia (Nakai) T. Lee t o Lespedeza maximowiczii Schneid. o

11 Flora of Gyeongju National Park, Korea 31 Lespedeza bicolor Turcz. o Lespedeza cuneata G. Don o Lespedeza cyrtobotrya Miq $ Lespedeza juncea var. inschanica Maximowz $ Lespedeza maritima Nakai w $ Lespedeza pilosa (Thunberg) S. et Z. $ Kummerowia striata (Thunberg) Schindl. t o Desmodium oxyphyllum DC. š o Desmodium fallax Schindl.» š o Vicia sepium Linne i o Vicia amoena Fisch. iù o Vicia unijuga A. Br. ù ù o Vicia hirticalycina Nakai ù o Lathyrus davidii Hance y ù o Rhynchosia volubilis Lour. g o Vigna vexillata var. tsusimensis Matsumura o Pueraria thunbergiana Benth. e o Glycine soja S. et Z. g o Amphicarpaea edgeworthii var. trisperma Ohwi g $ Indigofera kirilowii Maximowz o Wistaria floribunda A. P. DC. o Robinia pseudo-acacia Linne ¾ ù o Lotus corniculatus var. japonicus Regel o Amorpha fruticosa Linne o Trifolium pratense Linne möt o Trifolium repens Linne möt o Crotalaria sessiliflora Linne yù o Geraniales tœ Geraniaceae t Geranium eriostemon var. glabrescens Nakai o Geranium sibiricum Linne t o Geranium nepalense subsp. thunbergii (S. et Z.) Hara t o Geranium wilfordii Maximowz o Oxalidaceae Oxalis obtriangulata Maximowz j o Oxalis corniculata Linne o Rutaceae w Zanthoxylum piperitum A.P. DC. vù o Zanthoxylum schinifolium S. et Z. ù o Zanthoxylum schinifolium S. et Z. var. inermis T. Lee o Poncirus trifoliata Rafin. k ù o Dictamnus dasycarpus Turcz. o Dictamnus dasycarpus Turcz var. velutinus Nakai l o Simaroubaceae kù Picrasma quassioides (D.Don) Benn. kù o Ailanthus altissima Swingle ƒ ù o Euphorbiaceae Securinega suffruticosa Rehder Ÿ o Sapium japonicum Pax & Hoffm. ù $ Phyllanthus ussuriensis Rupr. et Maximowz o Euphorbia humifusa Willd. o Sapinadales y ù Œ Buxaceae z

12 32 Sang-Myong Lee, Hwa-Yun Lee, Yu-Mi Lee, Soo-Hyun Park, Byoung-Chun Lee, and Won-Hyeon Lim Buxus microphylla var. koreana Nakai z o Anacardiaceae ù Rhus chinensis Mill. ù o Rhus trichocarpa Miq. ù o Rhus verniciflua Stokes ù o Rhus sylvestris Siebold & Zucc. ù $ Aquifoliaceae kù Ilex macropoda Miq. q ù $ Celastraceae Euonymus japonica Thunberg ù o Euonymus alatus (Thunberg) Sieb. y ù o Euonymus alatus for. ciliato-dentatus Hiyama z ù $ Euonymus sachalinensis (Fr. Schm.) Maximowz zù o Euonymus macroptera Rupr. ù zù o Celastrus flagellaris Rupr. t ù o Celastrus orbiculatus Thunberg o Tripterygium regelii Sprague et Takeda ù o Staphyleaceae š ù Staphylea bumalda DC. š ù o Aceraceae tù Acer ginnala Maximowz ù o Acer mono Maximowz š ù o Acer palmatum Thunberg tù o Acer pseudo-sieboldianum (Pax.) Kom. t o Sabiaceae ù ù Meliosma myriantha S. et Z. ù ù o Balsaminaceae y Impatiens noli-tangere Linne y o Impatiens textori for. pallescens Hara o Impatiens textori Miq. o Rhamnales ù Œ Rhamnaceae ù Zizyphus jujuba var. inermis Rehder o Vitaceae s ù Vitis amurensis Rupr. o Vitis coignetiae Pulliat o Vitis thunbergii var. sinuata (Regel) Rehder ¾ o Ampelopsis brevipedunculata for. citrulloides Rehder ƒ o Ampelopsis brevipedunculata var. heterophylla (Thunberg) Hara o Parthenocissus tricuspidata (S. et Z.) Planch. o Malvales Œ Tiliaceae vù Tilia amurensis Rupr. vù o Tilia taquetii Schneid. vù o Sterculiaceae ù Corchoropsis tomentosa (Thunberg) Makino ¾eÁ o Parietales d k Œ Actinidiaceae ù

13 Flora of Gyeongju National Park, Korea 33 Actinidia polygama (S. et Z.) Maximowz ù o Actinidia arguta Planchon o Theaceae ù Stewartia koreana Nakai ƒù o Camellia japonica Linne ù o Hypericaceae ù Hypericum ascyron Linne ù o Hypericum erectum Thunb. š ù $ Hypericum laxum (Blume) Koidz. š ù $ Violaceae Viola dissecta var. chaerophylloides (Regel) Makino û o Viola albida Palibin k o Viola mandshurica W. Becker o Viola diamantica Nakai o Viola acuminata Ledeb. o Viola orientalis W.Becker o Viola scabrida Nakai ¼l $ Viola japonica Langsd. $ Viola patrinii DC. $ Viola verecunda A.Gray g $ Myrtales Œ Elaeagnaceae ù Elaeagnus umbellata Thunberg ù o Alangiaceae ù Alangium platanifolium (S. et Z.) Harms t ù o Alangium platanifolium var. macrophylum (S. et Z.) Wanger. ù o Hydrocaryaceae Trapa japonica Flerov. o Onagraceae Epilobium pyrricholophum Fr. et Sav. o Ludwigia prostrata Roxb. ë $ Oenothera odorata Jacq. o Oenothera lamarckiana Ser. j o Halorrhagaceae k Halorrhagis micrantha R. Br. k o Umbellales xyœ Araliaceae ù Aralia elata Seem. ù o Umbelliferae x Bupleurum falcatum Linne y o Sanicula chinensis Bunge o Torilis japonica (Houtt.) DC. o Oenanthe javanica (Bl.) DC. ù o Sium suave Walter ù o Angelica decursiva (Miq.) Fr. et Sav. ù o Angelica japonica A. Gray. ˆ y o Ostericum koreanum (Maximowz) Kitagawa y o

14 34 Sang-Myong Lee, Hwa-Yun Lee, Yu-Mi Lee, Soo-Hyun Park, Byoung-Chun Lee, and Won-Hyeon Lim Cornaceae ddù Cornus kousa Buerg. ù o Cornus controversa Hemsl. ddù o Cornus walteri Wanger. ù o Metachlamydeae wqy ƒ Ericales Œ Pyrolaceae Pyrola japonica Klenze o Ericaceae Rhododendron mucronulatum Turcz. o Rhododendron mucronulatum var. ciliatum Nakai l o Rhododendron mucronulatum for. albiflorum T.Lee o Rhododendron yedoense var. poukhanense (Lév.) Nakai o Rhododendron schlippenbachii Maximowz o Promulales Œ Primulaceae Lysimachia coreana Nakai t o Lysimachia clethroides Duby j¾e o Androsace umbellata (Lour.) Merr. o Ebenales ù Œ Ebenaceae ù Diospyros lotus Linne š ù o Diospyros kaki Thunberg ù o Symplocaceae ù Symplocos chinensis for. pilosa (Nakai) Ohwi ù o Styracaceae ù Styrax obassia S. et Z. ù o Styrax japonica S. et Z. ù o Gentianales Œ Oleaceae t ù Fraxinus rhynchophylla Hance t ù o Fraxinus sieboldiana Bl. t o Fraxinus sieboldiana var. serrata Nakai t o Ligustrum japonicum Thunberg Ÿù $ Ligustrum obtusifolium S. et Z. ù o Forsythia koreana Nakai ù o Gentianaceae Swertia pseudo - chinensis (Bunge) Hara t o Swertia japonica (Schult.) Makino t $ Gentiana scabra var. buergeri (Miq.) Maximowz o Asclepiadaceae ƒ Metaplexis japonica (Thunberg) Makino ƒ o Cynanchum paniculatum Kitagawa w o Tubiflorales my Œ Convolvulaceae Calystegia japonica (Thunberg) Chois. o Cuscuta australis R. Br. o

15 Flora of Gyeongju National Park, Korea 35 Borraginaceae e Bothriospermum secundum Maximowz o Bothriospermum tenellum Fisch. et Meyer o Trigonotis icumae (Maximowz) Makino o Trigonotis peduncularis Benth. o Verbenaceae r Callicarpa dichotoma Raeusch. ù o Callicarpa japonica Thunberg ù o Clerodendron trichotomum Thunberg ù o Vitex rotundifolia Linne fil.»ù o Caryopteris divaricata (S. et Z.) Maximowz üt o Labiatae ãt Scutellaria indica Linne o Agastache rugosa (Fisch. et Meyer) O. Kuntze w o Meehania urticifolia (Miq.) Makino Á o Nepeta cataria Linne w o Dracocephalum argunense Fisch. o Prunella vulgaris var. lilacina Nakai ãt o Leonurus sibiricus Linne o Stachys riederi var. japonica Miq. t o Lamium amplexicaule Linne Ÿ ù o Lamium album var. barbatum (S. et Z.) Fr. et Sav. Ÿ o Clinopodium gracile var. multicaule (Maximowz) Ohwi k o Elsholtzia ciliata (Thunberg) Hylander w o Elsholtzia splendens Nakai w $ Isodon inflexus (Thunberg) Kudo w o Mosla dianthera Maxim. Át $ Mosla punctulata (Gmel.) Nakai Át $ Solanaceae ƒ Lycium chinense Mill.» ù o Physaliastrum japonicum Honda ƒ o Solanum lyratum Thunberg t o Solanum nigrum Linne ¾ o Datura stramonium Linne t o Scrophulariaceae x Paulownia coreana Uyeki o Mazus japonicus (Thunberg) Kuntze o Lindernia procumbens Borb. t $ Lindernia micrantha D.Don. t o Veronica linariaefolia Pall. Õ t o Veronica didyma var. lilacina (Hara) Yamazaki t o Veronica persica Poir. j t $ Melampyrum roseum Maximowz t o Pedicularis resupinata Linne t o Acanthaceae Õ Justicia procumbens Linne Õ o Phrymaceae q t Phryma leptostachya var. asiatica Hara q t o Plantaginales Œ Plantaginaceae Plantago asiatica Linne o

16 36 Sang-Myong Lee, Hwa-Yun Lee, Yu-Mi Lee, Soo-Hyun Park, Byoung-Chun Lee, and Won-Hyeon Lim Rubiales Õ Œ Rubiaceae Õ Paederia scandens (Lour.) Merr. o Rubia akane Nakai Õ o Galium verum var. asiaticum Nakai ù o Galium trachyspermum A. Gray i o Caprifoliaceae Sambucus williamsii var. coreana Nakai ù o Viburnum carlesii Hemsl. ù o Viburnum furcatum Bl. ù o Viburnum erosum Thunberg çù o Viburnum sargentii Koehne ù o Weigela subsessilis L. H. Bailey ù o Lonicera japonica Thunberg o Lonicera maackii Maximowz ù o Valerianaceae k Patrinia scabiosaefolia Fisch. k o Patrinia villosa (Thunberg) Juss. o Valeriana fauriei Briq. t o Cucurbitales Œ Cucurbitaceae Trichosanthes kirilowii Maximowz w k o Gynostemma pentaphyllum (Thunberg) Makino o Campanulales Œ Campanulaceae Adenophora grandiflora Nakai o Adenophora triphylla var. japonica Hara o Adenophora triphylla var. hirsuta Nakai l o Adenophora remotiflora (S. et Z.) Miq. o Campanula punctata Lam. o Codonopsis lanceolata (S. et Z.) Trautv. o Platycodon grandiflorum (Jacq.) A. DC. o Lobeliaceae Lobelia chinensis Lour. ƒ o Compositae y Gnaphalium japonicum Thunberg t ù o Galinsoga ciliata (Raf.) S.F.Blake l $ Carpesium abrotanoides Linne t o Ainsliaea acerifolia Sch.-Bip. t o Ambrosia artemisiifolia var. elatior Descourtils t o Eupatorium chinense var. simplicifolium Kitamura ù o Eupatorium fortunei Turcz. ù o Solidago virga-aurea var. asiatica Nakai o Aster koraiensis Nakai o Aster yomena Makino o Aster pilosus Willd. $ Aster scaber Thunberg o Aster spathulifolius Maximowz w o Conyza sumatrensis E.Walker j $ Erigeron annuus (Linne) Pers. o Erigeron canadensis Linne o Petasites japonicus (S. et Z.) Maximowz o Emilia flammea Cass. o

17 Flora of Gyeongju National Park, Korea 37 Senecio vulgaris Linne o Cacalia auriculata var. matsumurana Nakai ù o Syneilesis palmata (Thunberg) Maximowz ù o Achillea sibirica Ledeb. mt o Chrysanthemum zawadskii var. latilobum Kitamura o Chrysanthemum boreale Makino o Artemisia scoparia Waldst. et Kitamura o Artemisia keiskeana Miq. o Artemisia montana Pampan. o Artemisia princeps var. orientalis (Pampan.) Hara o Artemisia capillaris Thunb. $ Siegesbeckia glabrescens Makino o Eclipta prostrata Linne w o Bidens tripartita Linne ƒ o Bidens bipinnata Linne Á o Bidens biternata (Lour.) Merr. & Sherff ex Sherff l Á $ Bidens pilosa L. Á $ Atractylodes japonica Koidz. o Carduus crispus Linne i o Cirsium japonicum var. ussuriense Kitamura i o Crassocephalum crepidioides (Benth.) S.Moore y ù $ Saussurea pulchella Fisch. ƒ o Saussurea gracilis Maximowz o Saussurea conandrifolia Nakai o Serratula coronata var. insularis Kitamura o Rhapontica uniflora DC. ã o Cephalonoplos segetum (Bunge) Kitamura o Cosmos bipinnatus Cav. g o Crepidiastrum denticulatum (Houtt.) J.H.Pak & Kawano š» $ Taraxacum platycarpum H. Dahlst. o Taraxacum officinale Weber o Lactuca indica var. laciniata (O. Kuntze) Hara š» o Youngia japonica (Linne) DC. o Youngia sonchifolia Maximowz š» o Vegetation The vegetation of the Gyeongju National Park seemed good in Tohamsan and Danseoksan areas while the vegetation was very simple in other areas. Lee (1997) reported Pte-Q, which is a barometer of damage to the forest vegetation, was 0.62, however, this research found Pte-Q was 1.35, which meant that the forest succession has progressed better than 10 years. It turned out higher than those of Mt. Gayasan (1.27), Mt. Juwangsan (0.95), and Mt. Chiaksan (0.89). In the Tohamsan area, Nymphea tetragona var. angusta, Iris pseudoacorus, Spirodela polyrhiza, Trapa japonica, Potamogeton crispus inhabited ponds in the front yard of Bulguksa Temple. The southern slope of Mt. Tohansan seemed to heavily be inhabited, but the dominant species was Pinus densiflora. P. koraiensis grew in some areas. Quercus mongolica was dominant in the area from the Iljumun Gate of Seokguram to the mountain top and Styrax japonica, Abies holophylla, Corylus heterophylla var. thunbergii, Rhododendron mucronulatum var. ciliatum, Prunus sargentii, Fraxinus rhynchophylla, Castanea creanta, and Tilia taquetii grew as well. Pinus koraiensis in stock on the southwestern slope while Q. variabilis and Q. mongolica lived in stock 300 to 600 m on the western, northern, and eastern slopes. Q. mongolica lived in stock near the Manhobong and Q. mongolica, Pinus densiflora, and Larix kaempferi lived in stock on the northwestern slope of Manhobong. Q. variabilis and Q. acutissima lived in stock in Sibugeo-ri on the northern slope of Mt. Tohamsan. Carpinus laxiflora lived in stock in the valley. Q. variabilis lived in stock on the Upoongi slope, Beomgok-ri and near Mt. Baikdosan, Janghang-ri, Yangbuk-myeon. Q. variabilis and Q. serrata lived in stock in the Hwangyongsaji valley, Hwangryong-dong. Q. variabilis and Q. acutissima lived in stock on the southern slope of Hantibeodeul. Some areas of the northern slope of Hwangryongsaji and Chamnamujeon were oxidation ponds, where Quercus species formed coppice forest. On the verge between Deok-

18 38 Sang-Myong Lee, Hwa-Yun Lee, Yu-Mi Lee, Soo-Hyun Park, Byoung-Chun Lee, and Won-Hyeon Lim dong and Eumgok-dong slopes grew Pinus densiflora. About 20 to 30 cm Platycarya strobilacea DBH grew in stock 300 meters high from Deok-dong to Mt. Cheongsan while acacia lived in stock around Deokdongho Lake. Q. variabilis and Q. mongolica lived in stock under 400 meters high. Q. serrata, Q. alinena, Zanthoxylum schinifolium, Prunus sargentii, Fagara mantschurica var. inermis, Pinus densiflora, Picrasma quassioides, Platycarya strobilacea, Styrax japonica, Cornus controversa, Alangium platanifolium var. macrophyllum, Zelkova serrata, Alangium platarfolim, and Morus bombycis grew under 400 m high. Q. mongolica lived in stock 400 m or higher and there were colonies of Q. variabilis and Q. alinena on the slope toward the look-out shed (Gyeongju Ranch). There were a colony of Q. variabilis and a colony of Q. mongolica and Q. serrata on the northern slope of Orion Ranch. There were relicts of Pinus densiflora, Carpinus laxiflora, and Zelkova serrata in the vicinity of the Girimsa Temple. Forests in the Daebon area, called Gampo area, were composed of colonies of Pinus thunbergii. There were a colony of Q. variabilis in the valleys, a colony of Phyllostachys nigra var. henonis near residential areas, and a colony of Robinia pseudo-acacia near cultivated land. Zostera marina prevailed on the beds of the sea and Phyllospadix iwatensis lived on subtidal rocky shore. Aster spathulifoliusm, Orostachys malacophyllus, Vitex rotundifolia, Sedum oryzifolium, and Youngia denticulata prevailed on the coastal cliffs. P. koraiensis was planted on some of the northwestern slope. In the Seoak area, a colony of P. densiflora prevailed and with human intervention, a colony of acacia were planted on the edge of the pine tree colony. Robinia pseudo-acacia was planted on the verge of eastern slope and northwestern slope of the Hwarang area. Colonies of P. densiflora were found on the northern slope. The southern slope was an oxidated land and showed the first stage succession where a sprout forest of oaks were developed. A colony of P. densiflora was dominant in the whole Sogeumgang area and a colony of P. thunbergii was formed in a shape of band on its verge, which was presumably planted. A colony of Q. acutissima was formed on some of the western slope of Yonggang-dong. There was a military base in the Dongcheon-dong valley, which may give damage to surrounding forests. Larix kaempferi was planted on the verge of the northwestern slope and a colony of P. densiflora grew on the verge of western slope and around 600 m high on the northwestern slope of Danseoksan area. Q. variabilis grew in stock on the southern slope, Q. serrata and Q. alinena prevailed in stock on the edge of northern slope, of the Sinseonsa Temple. Q. acutissima grew in stock around 600 m high south of the mountain top, and Q. mongolica lived in stock around the top. In addition, colonies of Q. serrata were formed mostly in mid-slopes. Colonies of P. densiflora prevailed mostly in the Gumisan area and P. thunbergii was dominant on the edge of Haguri. Colonies of Q. variabilis prevailed on the northeastern and northwestern slopes of Sanamsa-ri. Larix kaempferi was planted on some of the eastern slope of Mt. Gumisan and some of the back slope of Gajeong-ri. Colonies of P. thunbergii were formed in a shape of band on the western, northern and eastern slopes of the Namsan area. Except the colonies of Phyllostachys nigra var. henonis on some verge area near Hwarang Training Center, colonies of P. densiflora prevailed on most of the area. The whole Namsan area was covered with colonies of P. densiflora. On the other hand, aquatic plants such as lotus, Trapa japonica, Ceratophyllum demersum, Spirodela polyrhiza, Lemna perpusilla, Hydrilla verticillata, and Typha angustata lived in the pond beside Dongiljeon in Namsan-dong. Acknowledgment This work was supported by the Korea Science and Engineering Foundation (KOSEF) grant funded by the Korea government (MEST) (No. M N ). References Chung, T.H. (1956) Korean Flora II, Shinjisa, Seoul. Chung, T.H. (1957) Korean Flora I, Shinjisa, Seoul. Kim, W. (1994) Survey of Vegetation naturalness on Gyeobangbuk-do and Gyeongsangnam-do, Ministry of Environment, Korea Kitamura, S. et al. (1964) Coloured Illustrations of Herbaceous Plants of Japan Monocotyledoneae). Hoikusha. 464 pp. Kitamura, S. et al. (1964) Coloured Illustrations of Herbaceous Plants of Japan (Sympetalae). Hoikusha. 464 pp. Kitamura, S. et al. (1966) Coloured Illustrations of Herbaceous Plants of Japan (Choripetalae). Hoikusha. 464 pp. Lee, S.M. (1997) Flora of Gyeongju National Park. National Science Museum, Daejeon. Lee, T.B. (1982) Illustrated Flora of Korea. 990 pp. Hyangmunsa, Seoul. Nakai, T. (1909) Flora Koreana. Pars prima. Journ. Coll. Sci. Univ. Tokyo 26: Nakai, T. (1911) Flora Koreana. Pars secunda. Journ. Coll. Sci. Univ. Tokyo 31: Nakai, T. (1952) A synoptical sketch of Korean flora. Ohwi, J. (1984) Flora of Japan. Smithsonian Institution 1,066 pp. Palibin, J.W. (1898) Conspectus florae Koreae, Pars Prima. Act. Hort. Petrop. 17: Taktajan, A. (1986) Floristicregions of the World. Univ. Califinia Press. Berkeley pp. [Received on Feb. 25, 2008]

도감본문(수정)~10p

도감본문(수정)~10p 두번째이야기 덩굴나무 두번째이야기덩굴나무 6 00 Pinus densiflora Siebold & Zucc. 4 5 6 6 5 4 7 8 9 P. densiflora P. densiflora for. multicaulis P. densiflora for. erecta 0 6 산에서자주만나는큰키나무 덩굴나무 8 산에서자주만나는큰키나무 덩굴나무 덩굴나무차례 9

More information

13-ºÎ·Ï¸ðÀ½-0312

13-ºÎ·Ï¸ðÀ½-0312 Pinus thunbergii Parlatore Abies holophylla Maximowicz Pinus densiflora Siebold et Zuccarini Juniperus chinesis Linnaeus Pinus densiflora for. erecta Uyeki Juglans mandshurica Maximowicz Ginkgo biloba

More information

이웅빈 A Flora of Mt. Umyeon Department of Biological Science, Yongin University Mt. Umyeon is located between Seocho-gu in Seoul and Gwacheon-si in Gyeo

이웅빈 A Flora of Mt. Umyeon Department of Biological Science, Yongin University Mt. Umyeon is located between Seocho-gu in Seoul and Gwacheon-si in Gyeo 이웅빈 A Flora of Mt. Umyeon Department of Biological Science, Yongin University Mt. Umyeon is located between Seocho-gu in Seoul and Gwacheon-si in Gyeonggi-do. The investigated vascular plants consist of

More information

17(2)-08.fm

17(2)-08.fm ª Ÿ (Korean J. Medicinal Crop Sci.) 17(2) : 125 132 (2009) ù k p ¼ÁÁÁkÁÁÁ½y w ww Ecological Characteristics of the Asparagus cochinchinensis (Lour.) Merr. Population in South Korea Byung Kil Choo, Yunui

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012년전국자연환경조사 - 식물 - 심정기 - 도곡 목명과명출현종도곡 (377162) 도엽특이사항영문한글영문한글학명국명 E1 E2 E4 E5 Equisetales 속새목 Equisetaceae 속새과 Equisetum arvense 쇠뜨기 Filicales 고사리목 Aspleniaceae 꼬리고사리과 Athyrium iseanum

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012 년전국자연환경조사 - 식물 - 이두범 - 경주 목명과명출현종경주 (359014) 도엽특이사항영문한글영문한글학명국명 E7 Selaginellales 부처손목 Selaginellaceae 부처손과 Selaginella tamariscina 부처손 Equisetales 속새목 Equisetaceae 속새과 Equisetum arvense

More information

7(3)-03.fm

7(3)-03.fm w» wz, 7«3y(2005) Korean Journal of Agricultural and Forest Meteorology, Vol. 7, No. 3, (2005), pp. 201~210 ½ 1 Á v 2 Á 2 Á 1 Á Ÿ 1 Á½ y 2 1 w ù, 2 w w (2005 2 15 ; 2005 8 19 ) The Vegetation Structure

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012년전국자연환경조사 - 식물 - 손현덕 - 완도 목명과명출현종완도 (346114) 도엽특이사항영문한글영문한글학명국명 E2 Ophioglossales 고사리삼목 Ophioglossaceae 고사리삼과 Botrychium ternatum 고사리삼 Filicales 고사리목 Osmundaceae 고비과 Osmunda japonica

More information

< C1A4C8EFB6F42E687770>

< C1A4C8EFB6F42E687770> J. Ecol. Field Biol. 29 (3): 265 275, 2006 대구인접지역삼림식생의진행천이와잠재자연식생 정흥락 * 전영문 1 이호준 1, 1 Progressive Succession and Potential Natural Vegetation on the Forest Vegetation in and surrounding Daegu, Korea Choung,

More information

untitled

untitled 11-1400119-000205-01 THE FOREST EDUCATION PROGRAM THE FOREST EDUCATION PROGRAM 93520 9 788997 450602 ISBN 978-89-97450-60-2 THE FOREST EDUCATION PROGRAM 20149 031-540-2000 415 aplan Tomorrow FOUR SEASONS

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012년전국자연환경조사 - 식물 - 김영동 - 태백 목명과명출현종태백 (378164) 도엽특이사항영문한글영문한글학명국명 E8 E9 Lycopodiales 석송문 Lycopodiaceae 석송과 Huperzia selago 좀다람쥐꼬리 식물구계학적등급 (Ⅳ) Lycopodiales 석송문 Lycopodiaceae 석송과 Lycopodium

More information

358051_마상_식물상_종목록.xlsx

358051_마상_식물상_종목록.xlsx 2014년전국자연환경조사-식물-고성철과명출현종영문한글학명국명 특이사항 도엽명 SOLANACEAE 가지과 Solanum nigrum var. nigrum L. 까마중 마상 (358051) RHAMNACEAE 갈매나무과 Rhamnus yoshinoi Makino 짝자래나무 마상 (358051) EBENACEAE 감나무과 Diospyros lotus L. 고욤나무

More information

정규영 서정수 * 박명순 이선희 최하나 정수영 Flora of Vascular Plants on Mt. Kookmang(Chungju, Chungbuk) School of Bioresource Science, Andong National University *The K

정규영 서정수 * 박명순 이선희 최하나 정수영 Flora of Vascular Plants on Mt. Kookmang(Chungju, Chungbuk) School of Bioresource Science, Andong National University *The K 정규영 서정수 * 박명순 이선희 최하나 정수영 Flora of Vascular Plants on Mt. Kookmang(Chungju, Chungbuk) School of Bioresource Science, Andong National University *The Korean Association for Conservation of Nature This survey

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012년전국자연환경조사 - 식물 - 안진갑 - 진도 목명과명출현종진도 (346101) 도엽특이사항영문한글영문한글학명국명 E2 Selaginellales 부처손목 Selaginellaceae 부처손과 Selaginella tamariscina 부처손 Ophioglossales 고사리삼목 Ophioglossaceae 고사리삼과 Botrychium

More information

<C3D6C1BEBAB8B0EDBCAD5FC7A5C1F62E687770>

<C3D6C1BEBAB8B0EDBCAD5FC7A5C1F62E687770> 훼손된 자연생태계 복원기술 Restoration Technology of Damaged Ecosystem 도시녹지공간의 생태 corridor 설계기법 Development of Design Technology for the Eco-corridor in Urban Area 고려대학교 환 경 부 보고서 초록 연구과제명 코드번호 (국문) 도시녹지공간의 생태 corridor

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 목명과명출현종추자 (336021) 도엽특이사항영문한글영문한글학명국명 E1 E2 E5 E6 Selaginellales 부처손목 Selaginellaceae 부처손과 Selaginella involvens 바위손 Ophioglossales 고사리삼목 Ophioglossaceae 고사리삼과 Botrychium virginianum 늦고사리삼 식물구계학적등급 (Ⅰ)

More information

fm

fm Floristic study of Jogyesan Mt. 339 Appendix 1. List of vascular plants distributed in Jogyesan Mt. Lycopodiaceae 석송과 Huperzia serrata (Thunb.) Trevis. 뱀톱 P 150635 Equisetaceae 속새과 Equisetum arvense L.

More information

UM00003782.PDF

UM00003782.PDF 1 북한 산림 생태계의 지속가능한 관리 방안에 관한 연구 강 호 상 (서울대 객원연구원) 목 차 요약문 3 1. 서 론 5 2. 북한의 자연자원 8 3. 북한의 산림자원 16 4. 북한의 산림황폐화 원인 및 현황 18 5. 훼손된 북한 산림생태계의 복원 25 6. 장기생태연구지 설정 및 연구 31 7. 동북아시아 국가간 산림 network 조성 및 교류 협력

More information

담양군 도래수마을의 식물상 조사 분석

담양군 도래수마을의 식물상 조사 분석 담양군도래수마을의식물상조사분석 박미정 1, 최진아 1* 2 1, 이상화, 김은자, 전보배, 유준완 1 1 1. 국립농업과학원 2. 녹색마당 Vegetation Survey and Analysis in Damyang-gun Doraesoo Village Park Meejeong 1, Choi Jin-a 1*, Lee Sanghwa 2, Kim Eunja 1,

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012 년전국자연환경조사 - 식물 - 유기억 - 영월 목명과명출현종영월 (378142) 도엽특이사항영문한글영문한글학명국명 E6 Equisetales 속새목 Equisetaceae 속새과 Equisetum arvense 쇠뜨기 Filicales 고사리목 Dennstaedtiaceae 잔고사리과 Dennstaedtia wilfordii

More information

2(2): 87~97, JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN Flora around Gudeok Campsite, Busan Metropolitan City, Korea Yo

2(2): 87~97, JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN Flora around Gudeok Campsite, Busan Metropolitan City, Korea Yo 2(2): 87~97, 2016. 12. JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN 2465-8146 Flora around Gudeok Campsite, Busan Metropolitan City, Korea You, Ju-Han ABSTRACT 국문초록 Corresponding author: You,

More information

401.fm

401.fm Journal of Korean Nature Vol. 3, No. 4 199-211, 2010 Classification Type of Vascular Plants in Yeohangsan, Muhaksan and Palyongsan, Masan Hyun-Kyung Oh 1 *, Hyun-Mi Kang 2 and Song-Hyun Choi 2 1 Department

More information

101.fm

101.fm Journal of Korean Nature Vol. 3, No. 1 1-10, 2010 Dispersion of Vascular Plant in Mt. Huiyangsan, Korea Hyun-Tak Shin 1, Sung-Tae Yoo 2, Byung-Do Kim 2, and Myung-Hoon YI 3 * 1 Gyeongsangnam-do Forest

More information

BMYIHXZUOVDO.xls

BMYIHXZUOVDO.xls 1 좌사일대의식물 좌사일대의식물 - 154.5고지 - 도재화 국립환경과학원 김용현 경원대학교 요약 1 조사지역내에자생하는관속식물은 34목 63 과, 142 속, 139 종, 24 변종, 1 품종, 1잡 종의총 168 분류군으로나타났다. 2 식물구계학적특정식물종 IV등급종은비진도콩 1 분류군, III등급종까마귀쪽나무등 6 분류군, II등급종층꽃나무등 1 분류군,

More information

Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard by Yoo Kyung Lee, Gyu Lee, Eun Ju Lee 다산과학기지 주변에서 볼 수 있는 북극 식물 Arctic Plants living in N

Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard by Yoo Kyung Lee, Gyu Lee, Eun Ju Lee 다산과학기지 주변에서 볼 수 있는 북극 식물 Arctic Plants living in N 다산과학기지 주변에서 볼 수 있는북극 식물 Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard 북극식물-본문p001-019(0409).indd 1 2012-04-10 오후 4:36: Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard by Yoo

More information

Method Country Vegetation type Reference AA Japan Quercus-mixed Kirita(1971) Japan Quercus-mixed Nakane(1975) CC China glassland Jia et al.(2006) Japan deciduous forest Hirano e tal.(2003) USA hardwood

More information

11.hwp

11.hwp 23(3): 281 291, 2000 Korean J. Ecol. 금강송림의식생구조에관한정량적분석 윤충원 홍성천 적요 :,,,. 1) CCA,,,.,.,,. 2),,,,,.,. 3) 0.6622, 0.7,. 4), 0.6. 5).,. 검색어 :,, CCA,,,, 서론 1950 (classification) (ordination) (GreigSmith 1983),.

More information

도엽별출현종 _ 통계 년전국자연환경조사 - 식물 - 박재홍 - 남원 목명과명출현종남원 (357102) 도엽특이사항영문한글영문한글학명국명 E2 SELAGINELLALES 부처손목 SELAGINELLACEAE 부처손과 Selaginella involvens 바

도엽별출현종 _ 통계 년전국자연환경조사 - 식물 - 박재홍 - 남원 목명과명출현종남원 (357102) 도엽특이사항영문한글영문한글학명국명 E2 SELAGINELLALES 부처손목 SELAGINELLACEAE 부처손과 Selaginella involvens 바 도엽별출현종 _ 통계 - 2013 년전국자연환경조사 - 식물 - 박재홍 - 남원 목명과명출현종남원 (357102) 도엽특이사항영문한글영문한글학명국명 E2 SELAGINELLALES 부처손목 SELAGINELLACEAE 부처손과 Selaginella involvens 바위손 식물구계학적등급 (Ⅲ) OPHIOGLOSSALES 고사리삼목 OPHIOGLOSSACEAE

More information

소비형태보고서.PDF

소비형태보고서.PDF A0063-65610-57-0109 A Study on the Consumption Pattern and Pricing Structure of Major Oriental Medicines in Korea 2001. 5 : . 2001. 5. : : ( ) : ( ) : ( ) : ( ) : ( ) : ( ) : ( ) : ( ) : ( ) : ( ) : (

More information

2_11_24 김준수.hwp

2_11_24 김준수.hwp 농업생명과학연구 45(3) pp.9-18 Journal of Agriculture & Life Science 45(3) pp.9-18 비룡산 신갈나무림의 식물 다양성 김준수 1 홍진기 1 김경수 1 조용찬 2 배관호 3* 1 경북대학교 과학기술대학원 산림환경자원학과, 2 국립수목원, 3 경북대학교 생태환경시스템학부 접수일(2011년 03월 04일), 수정일(2011년

More information

조경식재학 - 식재재료(2) -

조경식재학 - 식재재료(2) - 조경식재설계 2 - 조경식물 ( 목본 )- 1. 자작나무 음양성 : 양수 건습성 : 건조 자작나무 Betula platyphylla var. japonica 번식 : 실생, 삽목 성상 : 낙엽활엽교목 수형 : 원추형 백색의수피, 황색단풍 강조, 유도, 차폐, 녹음식재 2. 서어나무 음양성 : 음수 생장속도 : 중간 건습성 : 건조 서어나무 Carpinus laxiflora

More information

untitled

untitled 1 2 3 4 5 006 009 020 024 028 032 036 040 044 050 056 064 070 086 090 188 192 195 199 202 205 209 212 214 219 102 110 224 6 7 6 008 9 8 9 9 10 10 11 11 12 12 13 13 14 14 15 15 16 16 17 17 18 19 파주 20 1)

More information

hwp

hwp 습지유형분류및기능평가의배경 / 목적 이론적고찰 습지의개념및정의습지지표습지의생성및발달 습지의유형및특성습지의기능, 이용습지의관리및복원 물영아리오름습지의유형분류기능평가 유형분류기능평가 HGM 습지분류체계 람사습지분류체계 습지분류의재구성 물영아리오름습지유형분류 기능평가모델구축 평가변수 / 지표설정 현장조사 물영아리오름습지평가항목별평가 관리전략기본방향설정 *

More information

<BACF3FC1DF20C1A2B0E6C1F6BFAA20B0B3B9DFC7F6C8B220B9D720C8AFB0E6BBF3C5C220C1B6BBE72833C2F72928B0ADC5C3B1B8292E687770>

<BACF3FC1DF20C1A2B0E6C1F6BFAA20B0B3B9DFC7F6C8B220B9D720C8AFB0E6BBF3C5C220C1B6BBE72833C2F72928B0ADC5C3B1B8292E687770> 사업보고서 2013-07-02 북 중 접경지역 개발현황 및 환경상태 조사(3차) 강택구 외 편 연구진 연구책임자 참여연구진 강택구 (한국환경정책 평가연구원 부연구위원) 노태호 (한국환경정책 평가연구원 연구위원) 추장민 (한국환경정책 평가연구원 연구위원) 오일찬 (한국환경정책 평가연구원 부연구위원) 이호림 (중국 연변대학교 농학과 교수) 박인철 (중국 연변대학교

More information

박선주.fm

박선주.fm 자연보존 173 : 22-33 ; 2016 년 5 월 운문산생태 경관보전지역의특정식물및귀화식물연구 1) 박선주 송임근 2) 영남대학교생명과학과 서론 운문산은가지산 (1,240 m), 천황산 (1,189 m), 재약산 (1,108 m) 등과더불어해발 1,000 m 이상의고봉에둘러싸여있고, 영남의 7산중의하나이며, 경상남 북도의경계를이루는성현산맥 ( 省峴山脈 )

More information

fm

fm Vascular plant diversity and vegetation of Yokjido Island 97 Appendix 1. List of vascular plants investigated on Yokjido Island. Taxa / Collection number Selaginellaceae 부처손과 1. Selaginella rossii (Baker)

More information

Weed Turf. Sci. 3(1):6~12 Print ISSN , Online ISSN Research Article Weed & Turfgrass Scien

Weed Turf. Sci. 3(1):6~12   Print ISSN , Online ISSN Research Article Weed & Turfgrass Scien Weed Turf. Sci. 3(1):6~12 http://dx.doi.org/10.5660/wts.2014.3.1.6 Print ISSN 22877924, Online ISSN 22883312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was renamed from formerly

More information

7(4)-10.fm

7(4)-10.fm w» wz, 7«4y(2005) Korean Journal of Agricultural and Forest Meteorology, Vol. 7, No. 4, (2005), pp. 303~310 y 1 Á z 2 Á½ 1 1 w y w, 2 w w (2005 11 29 ; 2005 12 7 ) Vegetation Composition and Structure

More information

untitled

untitled CANCER PREVENTION RESEARCH ORIGINAL ARTICLE 우리나라자생민속식물의항산화효과와위암에대한보호효과 1 부산대학교식품영양학과및노인생활환경연구소, 2 중앙대학교식물시스템과학과, 3 국립수목원산림자원보존과 최지명 1 ㆍ최지연 1 ㆍ김혜민 2 ㆍ최경 3 ㆍ구자정 3 ㆍ박광우 3 ㆍ이상현 2 ㆍ조은주 1 Antioxidative Activity

More information

< C2F7C6EDC1FD BDC3C7E8BFACB1B8BAB8B0EDBCAD2E687770>

< C2F7C6EDC1FD BDC3C7E8BFACB1B8BAB8B0EDBCAD2E687770> 어젠다코드 4-16 - 56 구 분 과제완결 기술분야코드 V2 기술유형코드 P01 작목구분코드 LP-02-4130 과제종류 공동연구 세세부사업 국책기술개발 연구과제및세부과제 수행기간 과제책임자및세부책임자 설사방지및항원충성항생제대체물질개발 10~ 12 국립축산과학원 김동운 2) 항생제대체물질개발을위한식물자원탐색및공급체계확립 10~ 12 인삼약초연구소이광재 색인용어

More information

12 Korean Journal of Agricultural and Forest Meteorology, Vol. 16, No. 1 다 (Kim et al., 2012). 여러가지생물종이어우러져구성된생물군집은종간상호작용이다양할것이므로종다양성이높은군집은구조적으로복잡할것이다

12 Korean Journal of Agricultural and Forest Meteorology, Vol. 16, No. 1 다 (Kim et al., 2012). 여러가지생물종이어우러져구성된생물군집은종간상호작용이다양할것이므로종다양성이높은군집은구조적으로복잡할것이다 한국농림기상학회지, 제 16 권제 1 호 (2014) (pissn 1229-5671, eissn 2288-1859) Korean Journal of Agricultural and Forest Meteorology, Vol. 16, No. 1, (2014), pp. 11~21 DOI: 10.5532/KJAFM.2014.16.1.11 c Author(s) 2014.

More information

<30322D31312DB1E8B8EDC7F BFCFB7E1295F E31C4AEB6F328BFCF292E687770>

<30322D31312DB1E8B8EDC7F BFCFB7E1295F E31C4AEB6F328BFCF292E687770> Korean Journal of Environmental Agriculture Korean J Environ Agric. 2015;34(2):77-90. Korean Online ISSN: 2233-4173 Published online 2015 March 23. http://dx.doi.org/10.5338/kjea.2015.34.2.11 Print ISSN:

More information

3(1): 21~33, JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN Vascular Plants around Tongdosa(Temple) in Gajisan Provincial Pa

3(1): 21~33, JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN Vascular Plants around Tongdosa(Temple) in Gajisan Provincial Pa 3(1): 21~33, 2017. 6. JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN 2465-8146 Vascular Plants around Tongdosa(Temple) in Gajisan Provincial Park Oh, Hyun-Kyung* Choi, Yoon-Ho** You, Ju-Han*** ABSTRACT

More information

함동호외. 한반도난온대지역전남대학교내한약자원및상록활엽식물 최근우리나라는한약자원의해외의존도를줄이기위해대량증식을목적으로하는몇몇기초조사형태의연구가활발히진행중에있다 3). 또한전세계적으로각국가마다생물자원을환경생태보호의목적뿐만아니라산업적인목적으로적극적으로조사및관리하는추세에있다

함동호외. 한반도난온대지역전남대학교내한약자원및상록활엽식물 최근우리나라는한약자원의해외의존도를줄이기위해대량증식을목적으로하는몇몇기초조사형태의연구가활발히진행중에있다 3). 또한전세계적으로각국가마다생물자원을환경생태보호의목적뿐만아니라산업적인목적으로적극적으로조사및관리하는추세에있다 한반도난온대지역전남대학교내한약자원및상록활엽식물 함동호 1, 김원호 1, 이지윤 1, 이준성 1, 한은경 2, 조원범 2, 이정현 2* 1. 전남대학교과학영재교육원 2. 전남대학교사범대학생물교육과 The medicinal and evergreen broad leaved plants in Chonnam national university on warm-temperate

More information

Journal of Climate Change Research 2017, Vol. 8, No. 3, pp DOI: 지리산국립공원세석지역의아고산관속식물상 노일 * 정재민 *

Journal of Climate Change Research 2017, Vol. 8, No. 3, pp DOI:   지리산국립공원세석지역의아고산관속식물상 노일 * 정재민 * Journal of Climate Change Research 2017, Vol. 8, No. 3, pp. 201 211 DOI: http://dx.doi.org/10.15531/ksccr.2017.8.3.201 지리산국립공원세석지역의아고산관속식물상 노일 * 정재민 ** 조민기 *** 김태운 **** 문현식 **** * 국립공원관리공단내장산사무소, ** 국립수목원산림자원보존과,

More information

차례

차례 차례 표차례 優占度階級 群度階級 그림차례 - 1 - - 2 - - 3 - 표 2. 優占度階級 (Braun-Blanquet, 1964) 5 : 표본구면적의 3/4이상을덮고, 개체수는임의 4 : 1/2-3/4을덮고, 3 : 1/4-1/2을덮고, 2 : 개체수는많으나被度가낮다혹은산재하나被度는높다 ( 단1/10이다 ). + : 被度는낮고散在 r : 고립하여출현하고被度는극히낮다.

More information

고당질 특수미 활용 식미 증진 연구

고당질  특수미 활용 식미 증진 연구 천연물질산업화기술개발 신물질연구소 1) 자생식물표준추출물 D/B 구축 Key word : tyrosinase inhibitory activity, whitening effect Melanin은동물, 식물및미생물에널리존재하는페놀성화합물로자외선, 건조, 극한온동등에대한생존능력을높여주지만, 과도한 melanin 생성은인체에기미, 주근깨, 검버섯을형성하는역할을하기도한다.

More information

한실정이며, 초화류생육및식재후관리에관한연구또한옥상녹화, 실내조경등인공토양환경에서의연구가주를이루고있다. 외부공간에서의초화류생육에관한연구로는아파트단지내식재된지피식물의생육환경및관리현황 (Lee, 2006) 과상록성지피식물의이용확대를위한환경조건에따른생육비교 (Kim, 2010

한실정이며, 초화류생육및식재후관리에관한연구또한옥상녹화, 실내조경등인공토양환경에서의연구가주를이루고있다. 외부공간에서의초화류생육에관한연구로는아파트단지내식재된지피식물의생육환경및관리현황 (Lee, 2006) 과상록성지피식물의이용확대를위한환경조건에따른생육비교 (Kim, 2010 J. Korean Soc. People Plants Environ. Vol. 18 No. 4: 257-263, August 2015 http://dx.doi.org/10.11628/ksppe.2015.18.4.257 ISSN 1226-9778(Print) ISSN 2287-8238(Online) 박은희 정명일 한승원 정나라 김재순 * 국립원예특작과학원원예작물부도시농업연구팀

More information

유기억.fm

유기억.fm 54 Jong-Soo Kang, Jun-Soo Han, Kyeong-Sik Cheon, Kyung-Ah Kim,Yong-Ho ark and Ki-ug Yoo Appendix 1. List of vascular plants of t. Hanseok. Scientific name / Korean name / Voucher number Selaginellaceae

More information

DMZ 의식물 155 마일

DMZ 의식물 155 마일 DMZ의식물 155마일 을엮은우리의노력이식물을앞세워현실의휴전선을지워나가는길이되었으면합니다. 남과북의경계없이피고지는비무장지대의식물처럼말입니다. DMZ 의식물 155 마일 DMZ의식물 155마일 을엮은우리의노력이식물을앞세워현실의휴전선을지워나가는길이되었으면합니다. 남과북의경계없이피고지는비무장지대의식물처럼말입니다. 발행일 2016년 10월 15일발행처 국립수목원발행자

More information

(056 김진숙).fm

(056 김진숙).fm 생약학회지 Kor. J. Pharmacogn. 44(4) : 372 378 (2013) 한국약용식물의최종당화산물생성저해활성검색 (XI) 최소진 1 김영숙 1 송유진 1 김주환 2 김진숙 1 * 1 한국한의학연구원한약연구본부한의신약개발그룹, 2 가천대학교생명과학과 Screening of Korean Herbal Medicines with Inhibitory Activity

More information

Programs The 201 EABCN symposium will be held on 13 October and two-day field trips will be arranged at October. A side event is also planned to

Programs The 201 EABCN symposium will be held on 13 October and two-day field trips will be arranged at October. A side event is also planned to THE 201 EABCN SYMPOSIUM Program Book 9-1 October 201 Republic of Korea East Asia Biodiversity Conservation Network Published by Korea National Arboretum Programs The 201 EABCN symposium will be held on

More information

102.fm

102.fm Journal of Asia-Pacific Biodiversity Vol. 6, No. 1 31-81, 2013 http://dx.doi.org/10.7229/jkn.2013.6.1.031 The Vascular Plant Species in the Korean Demilitarized zone (DMZ) Chang Hyeon Lee 1, Hyun Tak Shin

More information

<30322E20BABBB9AEC0FCC3BC2E687770>

<30322E20BABBB9AEC0FCC3BC2E687770> Korean Journal of Environmental Agriculture Korean J Environ Agric. 2014;33(2):86-102. Korean Online ISSN: 2233-4173 Published online 2014 June 17. http://dx.doi.org/10.5338/kjea.2014.33.2.86 Print ISSN:

More information

(044 김진숙).fm

(044 김진숙).fm 생약학회지 Kor. J. Pharmacogn. 45(4) : 354 358 (2014) 한국약용식물추출물의알도즈환원효소억제효능검색 (IX) 최소진 1 김영숙 1 김주환 2 김진숙 1 * 1 한국한의학연구원한약연구본부한의신약연구그룹, 2 가천대학교생명과학과 Screening of Korean Herbal Medicines with Inhibitory Effect

More information

이상훈 심재국 Vegetation of Mt. Yeonin Provincial Park Department of Life Science, Chung-Ang University The forest vegetation of Mt. Yeonin Provincial Park

이상훈 심재국 Vegetation of Mt. Yeonin Provincial Park Department of Life Science, Chung-Ang University The forest vegetation of Mt. Yeonin Provincial Park 이상훈 심재국 Vegetation of Mt. Yeonin Provincial Park Department of Life Science, Chung-Ang University The forest vegetation of Mt. Yeonin Provincial Park was surveyed from August 2016 to October 2016. The

More information

58 Journal of Agriculture & Life Science 46(4) Ⅰ. 서론곰솔 (Pinus thunbergii Parl.) 은바닷가와해풍의 영향이미치는곳에서자생하고있으며, 분포범위는북위 에서 까지분포하고있다 (Kim & Kil,

58 Journal of Agriculture & Life Science 46(4) Ⅰ. 서론곰솔 (Pinus thunbergii Parl.) 은바닷가와해풍의 영향이미치는곳에서자생하고있으며, 분포범위는북위 에서 까지분포하고있다 (Kim & Kil, 농업생명과학연구 46(4) pp.57-68 Journal of Agriculture & Life Science 46(4) pp.57-68 경상북도동해안곰솔림의군집구조 천광일 1 정성철 1* 윤호중 1 변준기 2 주성현 3 1 국립산림과학원산림보전부, 2 국립수목원, 3 경북대학교임학과 접수일 년 월 일 수정일 년 월 일 게재확정일 년 월 일 Community

More information

04(오영주)p fm

04(오영주)p fm Weed Turf. Sci. 3(4):276~283 http://dx.doi.org/10.5660/wts.2014.3.4.276 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was renamed from both

More information

< 표지설명 > 한라산에자생하는왕벚나무와이나무의염색체.

< 표지설명 > 한라산에자생하는왕벚나무와이나무의염색체. 연구보고 발 간 등 록 번 연구보고 호 11-01 11-1400377-000436-01 11 01 제주지역 산림유전자원의 수집 및 보존연구 제주지역 산림유전자원의 수집 및 보존연구 김찬수 김수영 변광옥 국립산림과학원 국립산림과학원 KOREA FOREST RESERCH INSTITUTE < 표지설명 > 한라산에자생하는왕벚나무와이나무의염색체. 제주지역산림유전자원의

More information

류새한 박시룡 * 강상준 ** Riparian Vegetation and Bird Biotope of Urban Stream with Special Reference to Mushimcheon-River of Cheonju City, Chungbuk Province S

류새한 박시룡 * 강상준 ** Riparian Vegetation and Bird Biotope of Urban Stream with Special Reference to Mushimcheon-River of Cheonju City, Chungbuk Province S 류새한 박시룡 * 강상준 ** Riparian Vegetation and Bird Biotope of Urban Stream with Special Reference to Mushimcheon-River of Cheonju City, Chungbuk Province School of Science Education, College of Education, Chungbuk

More information

< D FBDC3C7E8BFACB1B8BAB8B0EDBCAD E687770>

< D FBDC3C7E8BFACB1B8BAB8B0EDBCAD E687770> 어젠다코드 1-7 - 22 구 분 세부완결 기술분야코드 V1 기술유형코드 S04 작목구분코드 PG-03-PG31 과제종류 기관고유 세세부사업 - 연구과제및세부과제 수행기간 과제책임자및세부책임자 자생식물자원화기반구축 09~ 13 농식품연구소 김희연 식물기원추출물은행및생리활성 library 작성 09~ 13 농식품연구소 김희연 색인용어 자원식물, 추출물 ABSTRACT

More information

μ μ μ matk_193f trnk_670f matk_520r matk_1246r rbcl accd matk matk trnk (5 ) trnk (3 ) trnk_670f CTGTATCGCACTATGTATC matk_193f GTTATTCGAATGTATCAACAG matk_520r CTCATGCTTGCATTTATTACG matk_1246r CTTTCTCATTATTACAGCGG

More information

fm

fm Korean J. Pl. Taxon. 48(4): 331 356 (2018) https://doi.org/10.11110/kjpt.2018.48.4.331 RESEARCH ARTICLE pissn 1225-8318 eissn 2466-1546 Korean Journal of Plant Taxonomy Floristic study of Jogyesan Mt.

More information

韓資植誌 Korean J. Plant Res. 28(4) : 511~525(2015) 소, 기암 10개소, 계곡 4개소, 해변 1개소등 26개소의경관자원이있으며, 공원깃대종은소나무와원앙이다 (Korea National Park Service, 2013). 경주국립공원의

韓資植誌 Korean J. Plant Res. 28(4) : 511~525(2015) 소, 기암 10개소, 계곡 4개소, 해변 1개소등 26개소의경관자원이있으며, 공원깃대종은소나무와원앙이다 (Korea National Park Service, 2013). 경주국립공원의 Korean J. Plant Res. 28(4):511-525(2015) http://dx.doi.org/10.7732/kjpr.2015.28.4.511 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article 경주국립공원구미산지구에분포하는관속식물상 유주한 1 *, 권순영 2 1 동국대학교경주캠퍼스조경학과,

More information

84 Journal of Agriculture & Life Science 47(5) Cheonbu-ri Buk-myeon, while there was the least number of 10 individuals(0.4%) in the newly found habit

84 Journal of Agriculture & Life Science 47(5) Cheonbu-ri Buk-myeon, while there was the least number of 10 individuals(0.4%) in the newly found habit 농업생명과학연구 47(5) pp.83-94 Journal of Agriculture & Life Science 47(5) pp.83-94 울릉도섬현삼의새로운자생지보고및현지내 외보전전략 김수승 1 강기호 2 강신구 1 신현탁 3 조경호 2 김윤영 2 이명섭 2 양병훈 1* 1 산림청, 2 기청산식물원, 3 국립수목원 접수일 (2013 년 7 월 8 일 ), 수정일

More information

제출문 농림축산식품부장관귀하 이보고서를 허브산업기반활용뷰티산업소재 제품개발및특화산업육성기획 과제의 보고서로제출합니다 년 5 월 16 일 주관연구기관명 :( 주 ) 하이솔 주관연구책임자 : 김광상 세부연구책임자 : 김광상 연 구 원 : 박이경 연 구 원 : 최

제출문 농림축산식품부장관귀하 이보고서를 허브산업기반활용뷰티산업소재 제품개발및특화산업육성기획 과제의 보고서로제출합니다 년 5 월 16 일 주관연구기관명 :( 주 ) 하이솔 주관연구책임자 : 김광상 세부연구책임자 : 김광상 연 구 원 : 박이경 연 구 원 : 최 제출문 농림축산식품부장관귀하 이보고서를 허브산업기반활용뷰티산업소재 제품개발및특화산업육성기획 과제의 보고서로제출합니다. 2017 년 5 월 16 일 주관연구기관명 :( 주 ) 하이솔 주관연구책임자 : 김광상 세부연구책임자 : 김광상 연 구 원 : 박이경 연 구 원 : 최담선 연 구 원 : 김민숙 연 구 원 : 김민지 협동연구기관명 : ( 재 ) 남원시화장품산업지원센터

More information

fm

fm Korean endemic plants 283 Appendix 2. List of excluded taxa from KFS (2012) and NIBR (2013). The information is listed as follow; scientific and vernacular names, reference and note. PTERIOPHYTA 양치식물문

More information

Study on the Vascular Plants Found in Nearby Island Regions of Ganghwado

Study on the Vascular Plants Found in Nearby Island Regions of Ganghwado Journal of Korean Nature Vol. 3, No. 2 83-101, 2010 Study on the Vascular Plants Found in Nearby Island Regions of Ganghwado You-Mi Lee, Su-Hyun Park, Su-Young Jung, and Jong-Cheol Yang Korea National

More information

<30302E20B8F1C2F72E666D>

<30302E20B8F1C2F72E666D> Korean J. Pl. Taxon. 44(3): 222-232 (2014) http://dx.doi.org/10.11110/kjpt.2014.44.3.222 ISSN 1225-8318 Korean Journal of Plant Taxonomy Flora of Sumeunmulbaengdui wetland in Jeju-do, Korea Sung Chul Ko*,

More information

08(김익휘)p fm

08(김익휘)p fm Asian J. Turfgrass Sci. 26(1):60~66, 2012 Print ISSN 1229-3253 Research Articles Open Access Asian Journal of Turfgrass Science The Turfgrass Society of Korea 잔디밭잡초바랭이와민들레방제를위한살초활성약용식물의탐색 김대호 강재영 김인섭 전민구

More information

<BFACB1B8C0DAB7E C8A328C8F1B1CDC0AFC0FCC0DABFF8292DB3BBC1F6C6ED2E687770>

<BFACB1B8C0DAB7E C8A328C8F1B1CDC0AFC0FCC0DABFF8292DB3BBC1F6C6ED2E687770> KOREA FOREST RESEARCH INSTITUTE 발간사 산림은물, 공기, 휴양등으로인류에간접적인크나큰혜택을주고있으며, 산업사회가발전할수록기후변화와더불어산림자원의존재가치와중요성이더욱더높아지고있습니다. 그중에서도고급용재수, 약용수등의산림유전자원은직접적인활용가치가높은생물자원입니다. 아울러생물산업발달과더불어산림유전자원은다양성이요구되는미래사회의중요한생명자원으로서그역할은이루말할수없을것입니다.

More information

03 .이인용( ).fm

03 .이인용( ).fm Weed Turf. Sci. 5(3):126~135 http://dx.doi.org/10.5660/wts.2016.5.3.126 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was red from both

More information

01-Megascolex(dh)

01-Megascolex(dh) Journal of Species Research 2(2):203-222, 2013 A floristic study of Donggeom-do (Isl.), Ganghwa-gun, Korea Sun-Yu Kim, Byoung Yoon Lee and Jung-Hyun Kim* Division of Plant Resources, National Institute

More information

완료_eri hwp

완료_eri hwp Ecology and Resilient Infrastructure (2015) 2(1): 080-092 http://dx.doi.org/10.17820/eri.2015.2.1.080 http://www.kseie.or.kr/ Online ISSN: 2288-8527 ORIGINAL ARTICLE 외래식물에의한대학교정생태계의교란 Disturbance of Campus

More information

천연물로부터티로시나제활성억제물질외탐색 457 lin \ tyrosinase 당쇄수식에의한성숙과정의저해 (glucosamin, tunicamycin) 이. 세포득성 (hydroquinone 등각종 phenol, catechol 유도체 ) 파^작용으로대별된다. 이처럼 me

천연물로부터티로시나제활성억제물질외탐색 457 lin \ tyrosinase 당쇄수식에의한성숙과정의저해 (glucosamin, tunicamycin) 이. 세포득성 (hydroquinone 등각종 phenol, catechol 유도체 ) 파^작용으로대별된다. 이처럼 me 약학회지제 41 권제 4 호 456~461(1997) Yakhak Hoeji Vol. 41. No. 4 고등식물로부터퍼부엘라닌생성에관여하는티로시나제활성억제물질의탐색 이승호 * 박지수 김소영 김진준 정시련 영남대학교약학대학 (Received Ju ly 15, 1997) T h e S c r e e n i n g o f t h e I n h i b i t o r

More information

외떡잎식물 Monocotyledoneae

외떡잎식물 Monocotyledoneae 외떡잎식물 Monocotyledoneae 8 붓과 Iridaceae 등심붓 S E Sisyrinchium angustifolium Mill. Blue-eyed Grass 80 열매 높이 0~0cm 원산지 북아메리카 개화기 4~6월 결실기 5~7월 분포 제주도 다년생. 줄기는 모여나며 좁은 날개가 있다. 잎은 선형으 로 칼 모양이다. 은 지름 cm 내외이며 청자색이고

More information

조경식물학 - 활엽수 계열(2) -

조경식물학 - 활엽수 계열(2) - 조경식물학 - 상록활엽수외 - 1. 녹나무 내한성 : 약함 음양성 : 중용수 녹나무 Cinnamomum camphora 성상 : 상록활엽교목 수형 : 타원형 분포 : 난온대지역 이식 : 어려움 번식 : 실생 / 삽목 대기정화능력우수, 환경정화수 기조, 녹음, 가로수, 방풍, 방화식재 2. 생달나무 내한성 : 약함 음양성 : 음수 생달나무 Cinnamomum

More information

발간사 반구대 암각화는 고래잡이 배와 어부, 사냥하는 광경, 다양한 수륙동물 등 약 300여점의 그림이 바위면에 새겨져 있는 세계적 암각화입니다. 오랜 기간 새겨진 그림들 가운데 고래를 잡는 배와 어부모습은 전 세계적으로 유례를 찾기 힘들 정도로 그 중요성과 가치가 큽

발간사 반구대 암각화는 고래잡이 배와 어부, 사냥하는 광경, 다양한 수륙동물 등 약 300여점의 그림이 바위면에 새겨져 있는 세계적 암각화입니다. 오랜 기간 새겨진 그림들 가운데 고래를 잡는 배와 어부모습은 전 세계적으로 유례를 찾기 힘들 정도로 그 중요성과 가치가 큽 울주 대곡리 반구대 암각화 발굴조사보고서 BANGUDAE PETROGLYPH IN DAEGOK-RI, ULJOO EXCAVATION 발간사 반구대 암각화는 고래잡이 배와 어부, 사냥하는 광경, 다양한 수륙동물 등 약 300여점의 그림이 바위면에 새겨져 있는 세계적 암각화입니다. 오랜 기간 새겨진 그림들 가운데 고래를 잡는 배와 어부모습은 전 세계적으로 유례를

More information

Korean J. Plant Res. 29(2): (2016) Print ISSN Online ISSN Original Research Art

Korean J. Plant Res. 29(2): (2016)   Print ISSN Online ISSN Original Research Art Korean J. Plant Res. 29(2):241-263(2016) http://dx.doi.org/10.7732/kjpr.2016.29.2.241 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article 석회암지대석병산일대의관속식물상 송재모 1, 손호준 2, 김영설 3, 김세창 3, 이다현

More information

102(1)-00(74).fm

102(1)-00(74).fm Jour. Korean For. Soc. Vol. 102, No. 1, pp. 1~21 (2013) JOURNAL OF KOREAN FOREST SOCIETY w p š 1 Á¼ 1 Á½ { 2 Á 1 1 w w w w, 2 s w w w A Reconsideration of the List of National Endemic Plants (appendix

More information

44-3(13) fm

44-3(13) fm KOREAN J. FOOD SCI. TECHNOL. Vol. 44, No. 3, pp. 337~342 (2012) The Korean Society of Food Science and Technology 자생식물과생약자원추출물의폴리페놀, 플라보노이드함량및항산화활성탐색 김은진 1 최주연 1 유미리 1 김미영 1 이상현 2 이복희 1,3 * 1 중앙대학교대학원식품영양학과,

More information

조경식물학 - 활엽수 계열(3) -

조경식물학 - 활엽수 계열(3) - 조경식물학 - 활엽수계열 (2) - 1. 서부해당화 음양성 : 양수 서부해당화 Malus prunifolia 성상 : 낙엽활엽소교목 수형 : 구형 번식 : 실생 / 접목 적색의꽃, 적색열매가아름다움 기조, 강조식재 2. 마가목 음양성 : 음수 마가목 Sorbus commixta 수형 : 타원형 이식 : 어려움 전정 : 보통 번식 : 실생 / 접목 / 취목 흰색꽃과적색열매가아름다움

More information

Journal of Climate Change Research 2015, Vol. 6, No. 4, pp DOI: * ** *** *** * ***, *, **, ***

Journal of Climate Change Research 2015, Vol. 6, No. 4, pp DOI:   * ** *** *** * ***, *, **, *** Journal of Climate Change Research 2015, Vol. 6, No. 4, pp. 379 388 DOI: http://dx.doi.org/10.15531/ksccr.2015.6.4.379 * ** *** *** * ***, *, **, *** ( ) Ecological Characteristics of Abies koreana Forest

More information

05(김창석)p fm

05(김창석)p fm Weed Turf. Sci. 3(4):284~291 http://dx.doi.org/10.5660/wts.2014.3.4.284 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was renamed from both

More information

[00]_목차.hwp

[00]_목차.hwp Korean J. Plant Res. 27(5):518-533(2014) http://dx.doi.org/10.7732/kjpr.2014.27.5.518 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article 장창석 1, 양선규 1, 장현도 1, 이로영 2, 박민수 3, 김기홍 1, 오병운

More information

R hwp

R hwp 목적기초연구 1 * Anticomplement Activities of Korean Indigeneous Plants No. Plant name Srientific name Family Activity(IC50) 98112 해변싸리 Lespedeza martrima 콩과 12.2 96019 지리산오갈피 Acanthopamax chiisanensis

More information

304.fm

304.fm Journal of the Korean Housing Association Vol. 20, No. 3, 2009 yw s w - û - A Study on the Planning of Improved-Hanok - Focused on Jeon-Nam Province - y* ** z*** **** Kang, Man-Ho Lee, Woo-Won Jeong, Hun

More information

605.fm

605.fm Journal of the Korean Housing Association Vol. 19, No. 6, 2008 y k y p w sƒ Care-giver s Needs and Evaluation on the Actual Condition of the Playgrounds in Child Care Facilities y* Choi, Mock-Wha x **

More information

슬라이드 1

슬라이드 1 양치식물문 (Pteridophyta) O 유관속을갖지만꽃과종자를만들지못하고포자로번식하는식물군 O 포자체 (2n) 과배우체 (n) 이규칙적으로무성세대와유성세대와의세대교번 O 뿌리, 줄기, 잎으로분화하고뿌리는부정근 속새강 (Equisetineae) 속새과 (Equisetaceae) 쇠뜨기 (Equisetum arvense), 문형 ( 지상부 ). 다년생초본. Saponin,

More information

04. 이채영(71-81).fm

04. 이채영(71-81).fm Weed Turf. Sci. 5(2):71~81 http://dx.doi.org/10.5660/wts.2016.5.2.71 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was renamed from both

More information

63 19 2 1989 90 2013 3 4 2 54 15 2002 p 19; 1 2008 pp 32 37; 2013 p 23 3 2001 ㆍ 2002 2009 新 興 寺 大 光 殿 2010 2013 2013 4 大 光 殿 壁 畵 考 察 193 1992 ; : 2006

63 19 2 1989 90 2013 3 4 2 54 15 2002 p 19; 1 2008 pp 32 37; 2013 p 23 3 2001 ㆍ 2002 2009 新 興 寺 大 光 殿 2010 2013 2013 4 大 光 殿 壁 畵 考 察 193 1992 ; : 2006 DOI http:ddoi org 10 14380 AHF 2015 41 113 新 興 寺 佛 殿 莊 嚴 壁 畵 考 I. 머리말 朴 銀 卿 동아대학교 인문과학대학 고고미술사학과 교수 규슈대학 문학박사 불교회화사 15 3 3 1 1 * 2013 NRF 2013S1A5A2A03045496 ** : 26 2014; 高 麗 佛 畵 : 本 地 畵 幅 奉 安 問 題 美 術

More information

<38392D B1E8BBF3C5C22E666D>

<38392D B1E8BBF3C5C22E666D> 한국자연보호학회지, 제 10 권제 2 호 (2016) Korean Journal of Nature Conservation Vol. 10, No. 2, pp. 89-100 ISSN (Pring) 1976-6769 ISSN (Online) 2287-8122 https://doi.org/10.11624/kjnc.2016.10.2.089 DNA 보존을위한 FTA 카드의관속식물분류군별적용성조사

More information

03. 이인용2(65-70).fm

03. 이인용2(65-70).fm Weed Turf. Sci. 5(2):65~70 http://dx.doi.org/10.5660/wts.2016.5.2.65 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was red from both formerly

More information

[10_ 최종]JPR15-17(김현준_덕적도(옹진군) 및 인근 도서지역의).hwp

[10_ 최종]JPR15-17(김현준_덕적도(옹진군) 및 인근 도서지역의).hwp Korean J. Plant Res. 28(4):487-510(2015) http://dx.doi.org/10.7732/kjpr.2015.28.4.487 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article 덕적도 ( 옹진군 ) 및인근도서지역의관속식물상 김현준, 지성진, 정수영, 박수현,

More information

상술한본발명은, 피부내산화물질을제거하여피부를보호하며노화를예방하고피부세포내멜라닌의생성을억제하여미백에도움을주는효과가월등하고, 상기추출물을첨가하여제조한화장료조성물도항산화및미백효과가현저하다. 대표도 - 도 1 (72) 발명자 정관영 충청남도천안시동남구신방동향촌현대아파트 302

상술한본발명은, 피부내산화물질을제거하여피부를보호하며노화를예방하고피부세포내멜라닌의생성을억제하여미백에도움을주는효과가월등하고, 상기추출물을첨가하여제조한화장료조성물도항산화및미백효과가현저하다. 대표도 - 도 1 (72) 발명자 정관영 충청남도천안시동남구신방동향촌현대아파트 302 (51) Int. Cl. (19) 대한민국특허청 (KR) (12) 등록특허공보 (B1) A61K 8/97 (2006.01) A61Q 19/02 (2006.01) A61Q 19/08 (2006.01) (21) 출원번호 10-2009-0059106 (22) 출원일자 2009 년 06 월 30 일 심사청구일자 2009 년 06 월 30 일 (65) 공개번호 10-2011-0001538

More information

fm

fm Korean J. Pl. Taxon. 47(3): 264 288 (2017) https://doi.org/10.11110/kjpt.2017.47.3.264 pissn 1225-8318 eissn 2466-1546 Korean Journal of Plant Taxonomy A checklist of endemic plants on the Korean Peninsula

More information

<3033BFECC6F7B4CB28BBF3292E687770>

<3033BFECC6F7B4CB28BBF3292E687770> 1 장. 서론 1 1. 과업의 배경 3 2. 과업의 목적 4 3. 과업의 범위 5 2장. 선행연구 및 사례고찰 7 1. 이론적 고찰 9 2. 외국의 습지관련정책 15 3. 사례연구 21 3장. 보전관리방안수립을 위한 준거틀 35 1. 보전관리대책수립과정 37 2. 습지기능 평가 38 4장. 우포늪의 생태계 47 1. 우포늪의 변화과정 49 2.

More information

Korean J. Pl. Taxon. 45(2): (2015) ISSN Korean Journal of Plant Taxonomy A florisitic

Korean J. Pl. Taxon. 45(2): (2015)   ISSN Korean Journal of Plant Taxonomy A florisitic Korean J. Pl. Taxon. 45(2): 192-212 (2015) http://dx.doi.org/10.11110/kjpt.2015.45.2.192 ISSN 1225-8318 Korean Journal of Plant Taxonomy A florisitic study of Ulleungdo Island in Korea Sungyu Yang 1, Hyun-Do

More information

목 차 제 1 편 : 원흥이생태공원 관리조례(안) 1 제 2 편 : 주민협약 3 제 3 편 : 원흥이생태공원 생태보고서 5 1. 서언 5 2. 동 식물상 7 3. 원흥이생태공원의 생태자원 관리방안 45 4. 수질조사 결과 49 제 4 편 : 회의록 60 1. 연구진회의 60 2. 자문회의 99 3. 관리운영주체 및 역할 106 3. 관리운영주체 및 역할 115

More information

<31362DB3EDB5CF20BDC4BBFDC0C720BDC4B9B05F28B0ADBAB4C8AD2EBFC0BFB5C1D BFCFB7E1292E687770>

<31362DB3EDB5CF20BDC4BBFDC0C720BDC4B9B05F28B0ADBAB4C8AD2EBFC0BFB5C1D BFCFB7E1292E687770> 한국환경농학회지제27권제4 호 (2008) Korean Journal of Environmental Agriculture Vol. 27, No. 4, pp. 413-420 연구보문 논둑식생의식물사회학적군락분류 오영주 1) 손수인 2) 김창석 1) 김병우 3) 강병화 4)* 1) 국립농업과학원유기농업과, 2) 국립농업과학원생물안전성과, 3) 상지대학교생명과학과,

More information