DNA Sequencing Service Sequencing Reagents DNA sequencing Phone: (ext.4->4)

Size: px
Start display at page:

Download "DNA Sequencing Service Sequencing Reagents DNA sequencing Phone: (ext.4->4)"

Transcription

1 Sequencing Reagents DNA sequencing Phone: (ext.4->4)

2 01 217

3 Overview 바이오니아는국내최초로 Sequencing Service 를시작하였으며, 매년개선된 high-throughput sequencing service 를제공하고있습니다. Plasmid DNA, PCR product 등을비롯하여수많은 template sequencing 이가능한유전자자동분석장비인 ABI 3730XL 및전문인력등의인프라를보유하여연구자들에게신뢰도높은 data 를제공합니다. 또한, 바이오니아만의합성유전자기술을적용하여 Sequencing Service 와 Oligo Synthesis Service 를동시에이용함으로써빠른시간내에 DNA sequence 결과를얻을수있습니다. 특히 primer walking, Virus/ Vector sequence validation 을빠르게서비스해드리고있습니다. 고객의 sample 을소중한고객자산으로인식하여요구사항에부합될수있도록정확한결과를약속된시간내에전달한다는서비스철학을가지고더높은품질의유전자분석서비스를제공하기위해최선을다하고있습니다. Description 바이오니아의 Sequencing Service 는고객이분석하고자하는 template DNA 를의뢰받아 Automatic DNA Analyzer 를이용하여접수시점으로부터 24 시간이내에신뢰도높은염기서열분석결과 (Phred Score (QV): 20, Guaranteed read lengths: 700 bp) 를제공해드리는서비스입니다. Features and Benefits High-reliable Sequence Analysis: 분석하고자하는다양한샘플에대해최적화된조건으로수행되며, 자동분석장비를이용하여 Phred Score (QV): 20, Guaranteed read lengths: 700 bp 를제공합니다. Fast Turnaround Time: 분석시간은접수시점으로부터 24 시간이내로소요됩니다. Convenience - Universal primer is provided free: 다양한 Universal primer 를무료로제공합니다. Competitive Pricing: 합리적인서비스가격으로이용할수있습니다

4 BIONEER Sequencing Service Procedure Sample 및 Primer 준비 Sample Plasmid DNA (150~200 ng/μl, vol. 10~15 μl) Purified PCR product (50 ng/μl, vol. 10~15 μl) Non-purified PCR product (20 μl 이상 ) Primer : 5 pmole/μl(5 μm), universal primer 제공, oligo synthesis 동시주문가능 주문접수 Order sheet 작성후 (sequencing@bioneer.co.kr) 접수 접수시간 : 10 시, 15 시, 21 시 ( 샘플도착기준 ) Working day: 접수후 24 hour service Sequencing Sample purity 및 yield 확인 BigDye Terminator Cyclic Sequencing Reaction 수행 Sequencing PCR product clean-up ABI 3730XL running Data 분석및발송 Phred score(qv) 20 이상, read length 보장범위 700 bp 이상 3 가지 format(ab1, seq, PDF file) 과 text file 및분석 report 발송 BIONEER 218

5 기술지원및서비스문의 (Technical Support & Service Inquiry) Tel: (4 번 -4 번 ) 또는 042) ,3 sequencing@bioneer.co.kr 상담시간 : 평일오전 9:00 ~ 오후 6:00 ( 주말, 휴일휴무 ) Sequencing 서비스안내 1. Standard Sequencing Service plasmid/pcr product 를분석하고자하는 primer 를이용하여고객이원하는 region 을분석하는서비스이며, 대부분의 normal 샘플에대해최적화되어있습니다. 2. Full length sequencing (primer walking) 길이가긴 insert 를포함한 plasmid 혹은 PCR product 를 primer walking 으로분석하는서비스입니다. 3 kb 기준으로약 1 주일소요되며, size 에따라추가기간이발생됩니다. 서비스완료후 data 는각 single data 및 assemble 후 contig file 형식으로제공되며, primer 는 design 된 primer 정보와함께 dry 된상태로발송됩니다. 3. Difficult sequencing GC/AT rich, repeat sequence, secondary structure 등의 standard sequencing 으로는분석이어려운 structure 를가지고있는 template 를대상으로하는서비스입니다. Difficult sequencing process 는바이오니아만의노하우로최적화되어있으며, standard sequencing 과는다른분석조건및시약이사용됩니다. 4. End sequencing BAC, Fosmid, Cosmid DNA 등 large construct 를대상으로한서비스입니다. 5. Ready-to-load (without editing) DNA Analyzer (ABI 3730XL) running 이전단계까지준비된샘플을대상으로한서비스입니다 (dry 또는 Hi-Di TM formamide 에 elution 된상태로접수가능, 단 BigDye V3.1 만가능 ). 6. Custom DNA Sequencing PCR product 의 direct sequencing 시 high quality data 를얻기위해서는 PCR optimization 이수행되어야합니다. 이에당사에서는다량의샘플에대해최상의맞춤서비스를제공하며, genomic DNA 와세부의뢰정보를보내주시면 primer design 을포함하여 PCR 조건최적화및 Sequencing 까지일련의과정을서비스합니다. 부가서비스 (Additional Service) 안내의뢰샘플의종류에따라선택적으로부가서비스를이용하실수있으며, 부가서비스에사용되는모든 material 은당사제품으로서비스하고있습니다. Colony/ Cell stock Cell stock Cultured Cell Plasmid DNA Genomic DNA Non-purified PCR product Purified PCR product 1. Plasmid DNA extraction 액체배지에서배양된 cell 을보내주시면 plasmid DNA extraction 을수행합니다. Agar plate 혹은 cell stock 형태로의주문도가능하며, 별도의배양비용이추가됩니다. 2. PCR clean-up 1 PCR purification: PCR product 의 direct sequencing 시에는반드시 product 내불순물을제거하기위한 PCR clean up 과정이선행되어야하며, high quality data 를얻기위해서는 non-specific band 를제거하는것이중요합니다. 일반적으로 spin column 을이용한정제는 non-specific band 가존재하지않을경우적합하며, 당사제품인 PCR Purification Kit (AccuPrep PCR Purification Kit) 을사용합니다. 2 Agarose gel extraction: Agarose gel 에서원하는 band 만분리하여추출하는방법으로서 PCR product 내 non-specific band 가존재할경우적합하며, 당사제품인 PCR Purification Kit (AccuPrep Gel Purification Kit) 을사용합니다. 3. PCR & Purification 최적화된 PCR 조건, product size 등의정보와함께 genomic DNA 및 specific primer 를보내주시면 PCR 후 size 확인과 purification 을수행하며, 당사 primer synthesis service 도이용가능합니다. 본서비스과정에는당사제품인 high fidelity PCR premix(accupower ProFi Taq PCR PreMix) 및 PCR Purification Kit 를사용합니다. 서비스이용안내 바이오니아 Sequencing Service Order Sheet 를작성하신후아래안내사항에따라 sample 및 primer 를준비하셔서보내주시면됩니다. 1. Sequencing order sheet 작성안내 1 Order sheet 를다운받으셔서고객정보및샘플정보등해당사항을기입해주시면됩니다. 2 Sample 및 primer name 은알파벳, 숫자, 괄호, 하이픈 (-) 을사용하여간단하게기입해주시기바랍니다. 3 작성하신의뢰서는 (sequencing@bioneer.co.kr) 로보내시면접수가됩니다

6 2. Sample 및 primer 준비안내 ( 최적적정조건 : 1 rxn 기준 ) 1 Sample 준비 Type Concentration Volume/rxn Purity Plasmid DNA 100 ng/μl 10 μl PCR product 50 ng/μl 10 μl Non-purified PCR product 50 ng/μl 20 μl A 260/A280 : ~ 1.8 A 260/A230: 2.0 ~ 2.2 Genomic DNA 30 ng/μl 30 μl * 1 rxn 기준이며, 샘플은 1.5 ml tube 혹은 plate 로준비해주시고, 재분석에필요한샘플양을감안하여충분한양을보내주시기바랍니다. 2 Primer 준비 Type Concentration Volume/rxn 세부안내 Universal primer 무상제공 - 당사보유 universal primer 를사용하실경우 name 만기재해주시면됩니다. Specific primer 5 pmol/μl (5 μm) 5 μl Ordered primer Sequencing primer 적정조건 : 18~22 mer, TM 50~56 당사홈페이지온라인주문을하시면생산된올리고의일부는바로 sequencing 에사용됩니다 3. 샘플형태에따른준비사항 1 Single tube 형태 : 1.5 ml microcentrifuge tube 로준비하실경우상단에기재된샘플이름과 order sheet 에기재하신샘플이름을동일하게적어주시기바랍니다. 4. 배송안내 1 샘플박스에소속기관과의뢰자명을정확히기입하시고, 아래의당사연계배송회사를통하여 sample 및 primer 를배송하시면됩니다. ( 실의뢰자명기재 ) 2 택배발송 ( 현대택배, ), 퀵서비스 ( 대전지역에한함, 스피드퀵, ) { 보내실곳 : 대전시대덕구문평서로 8-11 바이오니아 Sequencing 팀 (TEL: )} 3 배송비정책 - 10 rxn 이상당사부담 - 10 rxn 미만고객부담 4 고객님의샘플을해당지역의지사나대리점을확인하시어보내주시면빠르고편하게이용하실수있습니다. 2 Plate 형태 : V-type bottom 의 96 well plate 에각 well 순서에맞도록넣어주시고, cross-contamination 이되지않도록 cap 을이용하여 sealing 하시길권장합니다. BIONEER 220

7 5. BIONEER 보유 universal primer list Primer name Sequence (5 -> 3 ) Length [bases] T7 promoter TAATACGACTCACTATAGGG 20 T7 terminator GCTAGTTATTGCTCAGCGG 19 T3 AATTAACCCTCACTAAAGGG 20 SP6 ATTTAGGTGACACTATAG 18 EBV-R GTGGTTTGTCCAAACTCATC 20 BGH-rev CTAGAAGGCACAGTCGAGGC 20 M13F(-40) GTTTTCCCAGTCACGAC 17 M13R(-40) CAGGAAACAGCTATGAC 17 M13F(-20) GTAAAACGACGGCCAGT 17 M13R(-20) GCGGATAACAATTTCACACAGG 22 pgex5 GGCAAGCCACGTTTGGTG 18 pgex3 GAGCTGCATGTGTCAGAGG 19 pqe-forward CCCGAAAAGTGCCACCTG 18 pqe-reverse GTTCTGAGGTCATTACTGG 19 EGFP-C CATGGTCCTGCTGGAGTTCGTG 22 EGFP-N CGTCGCCGTCCAGCTCGACCAG 22 RVprimer3 CTAGCAAAATAGGCTGTCCC 20 RVprimer4 GACGATAGTCATGCCCCGCG 20 GLprimer1 TGTATCTTATGGTACTGTAACTG 23 GLprimer2 CTTTATGTTTTTGGCGTCTTCCA 23 CMV-F CGCAAATGGGCGGTAGGCGTG 21 CMV30 AATGTCGTAATAACCCCGCCCC GTTGACGC 30 CMV24 TATTAGGACAAGGCTGGTGGG CAC 24 Gal4AD TACCACTACAATGGATG 17 Gal4BD-F TCATCGGAAGAGAGTAG 17 Gal4BD-R TTTCTTTGGAGCACTTGAGC 20 MATCHMAKER 3 GTGAACTTGCGGGGTTTTTCA GTATCTACGAT pbad-for ATGCCATAGCATTTTTATCC 20 pbad-rev GATTTAATCTGTATCAGG 18 SV40-pArev CCTCTACAAATGTGGTATGG 20 SV40-pAF AAATAAAGCAATAGCATCAC 20 malef GGTCGTCAGACTGTCGATGAA GCC 24 pcold-f ACGCCATATCGCCGAAAGG 19 pcold-r TCCCCGCCAAATGGCAGGGA 20 3AOX GCAAATGGCATTCTGACATCC 21 5AOX GACTGGTTCCAATTGACAAGC 21 pbabe-f TGACCTGGGAAGCCTTGGCT 20 pbabe-r TTGCTGACTAATTGAGATGCAT GCTTT 27 V5_Reverse ACCGAGGAGAGGGTTAGGGA 20 pjet1.2f CGACTCACTATAGGGAGAGCGG C 23 pjet1.2r AAGAACATCGATTTTCCATGGC AG 24 27F AGAGTTTGATCMTGGCTCAG R TACGGYTACCTTGTTACGACTT F CCAGCAGCCGCGGTAATAC R TACCAGGGTATCTAATCC 18 ITS1 TCCGTAGGTGAACCTGCGG 19 ITS2 GCTGCGTTCTTCATCGATGC 20 ITS3 GCATCGATGAAGAACGCAGC 20 ITS4 TCCTCCGCTTATTGATATGC 20 ITS5 GGAAGTAAAAGTCGTAACAA GG 22 LCO1490 GGTCAACAAATCATAAAGATA TTGG 25 HCO2198 TAAACTTCAGGGTGACCAAAA AATCA 26 Ordering Information Cat. no. Service Description Unit Price ( 원 ) Sequencing Service S Standard Sequencing <96 rxn 6,000 S Standard Sequencing 96 rxn 5,000 S Full length Sequencing kb 60,000 S Ready-to-load Service rxn 3,000 S Difficult Sequencing Service rxn 12,000 S End Sequencing Service rxn 20,000 S Custom DNA Sequencing Service rxn Inquire Additional service S Plasmid DNA Preparation rxn 1,500 S PCR purification rxn 1,500 S Agarose Gel-Extraction rxn 2,500 S PCR & Purification rxn 3,000 S Custom Sequencing Primer Synthesis (25 nmol기준 ) mer

8 FAQ [ 접수 ] Q: Sequencing 의뢰를할때필요한것이무엇인가요? A: 의뢰하고자하는 sample 과 primer 를준비하여보내주시고, sequencing order sheet 를다운받으셔서작성하여 sequencing@ bioneer.co.kr 로메일을보내주시면샘플이도착하는즉시접수가이루어집니다. Q: Order sheet 는어디서받을수있나요? A: 바이오니아홈페이지에서다운받아사용하시면됩니다. ( SequencingService-overview.aspx) Q: 바이오니아에서제공하는 Universal primer 는무엇이있나요? A: 앞서기술지원및서비스문의에기재된 Universal primer list 를참조하여주시기바랍니다. Q: 바이오니아에서주문한올리고를 sequencing 하고싶습니다. A: 바이오니아올리고서비스를이용하여주문하시되, comment 란에 sequencing 에사용해주세요 와같이기재하시면, primer 합성후 sequencing team 으로전달되어쉽게동시주문하실수있습니다. Q: 의뢰샘플의배송방법과배송료에대해설명해주세요. A: 아래주소로배송하여주시고, 본사및서울지사영업사원혹은바이오니아지역대리점을통해샘플을보내주시면됩니다. 배송료는 10 rxn 미만 - 고객부담, 10 rxn 이상 - 당사부담이오니참고하시기바랍니다. ( 주소 - 대전광역시대덕구문평동문평서로 8-11 바이오니아 Sequencing 팀 ) Q: 재반응접수란무엇인가요? A: 재반응접수는초기반응과동일 sample 및동일 primer 에대해결과개선의여지가있는건에한하여 1 회무료로자동접수됩니다. 이는결과보고에기재되어확인가능하며, 결과발송 2 일이내에재반응결과를받아보실수있습니다. Q: 추가반응과재반응의차이점이무엇인가요? A: 추가반응이란초기반응샘플을다른 primer 를사용해 sequencing 하는것으로, 동일샘플을사용하더라도서비스비용이부가됩니다. 결과개선의여지가있어무료로 1 회에한하여초기반응을반복시행하는재반응과는차이가있으므로서비스이용에유의하시기바랍니다. Q: 추가반응을의뢰하고싶습니다. A: Sequencing order sheet 내에초기반응샘플의접수번호를 comment 란에기재하셔서접수하시고, 추가의뢰 primer 를보내주시면됩니다. [ 결과 ] Q: Sequencing service 를통해얻을수있는 read length 가얼마나되나요? A: single extension 의경우일반적으로약 1.2 kb 까지분석되며당사 guarantee 범위는 700 bp 입니다. 양방향분석시약 1.2 kb 의 high quality data 를받아보실수있습니다. Q: 분석소요시간은얼마나걸리나요? A: 접수후 24 시간이내에결과를받아보실수있습니다. 접수가완료되면접수메일이발송되고결과발송예정시각을알려드립니다. Q: 결과는어떤형태로제공되나요? A: single extension 당 3 가지 format (ab1/ seq/ PDF file) 과 seq merge text file 및 report 가발송됩니다. ab1 file: Chromatogram file 로서, chromas/ Finch TV 등의프로그램으로확인하실수있습니다. seq file: 염기서열을나열한 file 로, 메모장을통해확인하실수있습니다. PDF file: 염기서열을나타내는 signal 을손쉽게확인할수있도록 PDF 형태로변환한 file 입니다. seq merge text file: 의뢰하신모든샘플의분석된 sequence 를 text file 로통합한 file 입니다. Report: 결과분석및개선방법에대한정보및전달사항을포함한보고서입니다. Q: Sequencing report 상에 group a, b, c, d 가뭔가요? A: Low quality data 를 data 양상에따라 group 으로나누어이해가쉽도록하였습니다. a 재반응을통해개선의여지가있는그룹입니다. 1 회에한하여무료로자동접수됩니다. b 분석되지않은경우로재반응을통해확인할필요성이있습니다. 1 회에한해무료로자동접수됩니다. c 샘플의구조적원인에의해분석저해를받아동일반응으로는결과개선이되지않으므로재반응을진행하지않습니다. d 기타원인으로인하여, 동일반응으로는결과개선이되지않으므로재반응을진행하지않습니다. [ 결제 ] Q: 결제관련문의는어디로연락하나요? A: 온라인 / 지로 / 기관결제가가능하며자세한사항은고객지원센터 ( ) 로문의하시면친절히답변해드리겠습니다. Q: 견적서를받아볼수있을까요? A: 가격정보는 ordering information 을참조하여주시고, 견적서발행을원하신다면고객지원센터 ( ) 로요청하여주시기바랍니다. 대량건의경우가격조정이가능하므로담당영업사원과상담하여주시기바랍니다. BIONEER 222

9 [ 기타 ] Q: 서비스진행후샘플을보관하나요? 보관한다면보관기간은어떻게되나요? A: 네. Sample 및 primer 모두접수번호로구분하여최대 1 개월보관합니다. 이기간내에추가반응접수를원하신다면초기접수번호를 order sheet 에기재해주시면됩니다. 장기보관에따른 degradation 으로인한문제는책임지지않으므로, primer 를장기보관하실경우에는 1 개월을주기로교체하시길권장합니다. Q: 부가서비스이용은어떻게하나요? A: Order sheet 의 order information 에체크하여주시면됩니다. Sheet 가구버전일경우 comment 란에기재하여주시기바랍니다. Q: 사용되는시약및기기에대해알고싶습니다. A: 아래 Information 을참고하여주시기바랍니다. Sequencing Process Information 1) Material & Instruments 1 MyGenie TM 96 Gradient Thermal Block (Block PCR 장비, Bioneer 사 ) 2 BigDye Terminator v3.1 sequencing kit (Applied Biosystems, USA) 3 ABI3730XL (Applied Biosystems, USA) 2) Method 1 Sequencing PCR <PCR 에사용된 template 양은아래표를참조하시면됩니다.> DNA size/ DNA amount Template PCR product DNA amount 100~200 bp 5~10 ng 200~500 bp 10~20 ng 500 bp~1 kb 20~50 ng Double strand Cosmid, BAC Genomic DNA 1~2 kb 50~100 ng 2 kb 2 Purification 3 ABI3730XL Running 100~200 ng 200~500 ng 300~600 ng 2~3 μg 223

10 02 Sequencing Reagents AccuPower DNA Sequencing Kit 225 Top TM DNA Sequencing Kit 226 SilverStar TM Staining Kit 227

11 AccuPower DNA Sequencing Kit Experimental data Description AccuPower DNA Sequencing Kit 는 sequencing 에필요한모든성분이 premix type 으로하나의 tube 에동결건조처리된 sequencing kit 로서, 빠르고정확하게염기서열을분석할수있습니다. 주형 DNA 를증폭시키기위해 thermal cyclic technique 을사용하여고온에서 sequencing 반응을수행하므로, double strand DNA 의 alkaline denaturation 과정이필요없을뿐만아니라주형 DNA 의 2 차구조나높은 GC 함량에의한문제점을최소화시킬수있습니다. 또한 7-deaza dgtp 를포함하고있어 band 의 compression 을최소화시킬수있습니다. Features and Benefits Sensitivity & reproducibility 모든구성성분을진공건조시켜 1 회분씩제공하므로편리하게사용할수있으며, 특허받은물질이첨가되어있어제품의안정성이높고, 보관성이뛰어나며실험재현성을최대화합니다. G/A/T/C 각 tube 에반응에필요한모든구성성분이 premix 되어진공건조상태로존재합니다. G mix : ddgtps/dntps A mix : ddatps/dntps T mix : ddttps/dntps C mix : ddctps/dntps 각 mix 는 buffer, Top DNA polymerase 를모두포함하고있습니다. *Sequencing 반응에영향을주지않는특정 dye 를포함하여, mix 과정을직접확인, 반응액의손실우려에대한모니터링이가능합니다. * 반복적이고번거로운 pipetting 조작을최소화, mixing time 을줄이고이에따른실험오류를방지합니다. Figure. 1. The sequence analysis of plasmid DNA. DNA sequence analysis of purified plasmid DNA 1 μg of the purified sample was sequenced using AccuPower DNA Sequencing Kit(K-1010) and stained by Silverstar TM Staining Kit (K-1050) Reference 1. Template DNA 와 primer 의적정농도 PCR product(200 bp 기준 ) Primer(17-24 mer) 100 ~ 300 ng 20 ~ 30 pmoles Plasmid DNA(3,000 bp 기준 ) 1 ~ 2 μg Primer(17-24 mer) 20 ~ 30 pmoles Reference 2. Primer Sequences M13/pUC(-47) Forward Primer 24 mer 5 -d(cgccagggttttcccagtcacgac)-3 M13/pUC(-48) Reverse Primer 24 mer 5 -d(agcggataacaatttcacagga)-3 Ordering Information Cat. no. K Product Description AccuPower DNA Sequencing Kit, 24 rxns, 0.2 ml 8-strip tube PreMix type Storage : Store at

12 Top DNA Sequencing Kit Features and Benefits Cat. no. K-1020 Contents : 100 samples을반응할수있는양 500 U Top DNA polymerase 200 μl 4d/ddNTP Mixes(7-Deaza dgtp), each 500 μl 10 x Reaction Buffer 1.6 ml Stop Solution 100 μl M13/pUC(-47) forward primer(10 pmoles/ μl) 1 ea. Technical Manual Cat. no. K-1021 Contents : 500 samples을반응할수있는양 Description Top TM DNA Sequencing Kit 는 Sequencing 에필요한모든성분이공급되는 sequencing kit 로서빠르고도안전한 silver staining 에의해유전자서열을분석할수있습니다. Thermus thermophilus 의 DNA polymerase sequencing grade (Top DNA polymerase) gene 을 E.coli 에 cloning 한다음유전자조작에의해 5 ->3 exonuclease 의활성을제거시킨 sequencing grade Top DNA polymerase 를사용함으로써일정한 band intensity 와 background 를최소화시킨최상의 sequencing 결과를얻을수 있습니다. 2,500 U Top DNA polymerase 1 ml 4d/ddNTP Mixes(7-Deaza dgtp), each 2.5 ml 10 x Reaction Buffer 8 ml Stop Solution 500 μl M13/pUC(-47) forward primer(10 pmoles/μl) 1 ea. Technical Manual *Caution: 녹일시에는 ice 상태에서온도를유지시켜주십시오. Enzyme 은첨가된안정화물질에의해장기보관시안정합니다. Storage : Store at -20 Table1. Comparison of Top DNA polymerase with other sequencing grade enzymes Sequencing Grade Enzyme Top DNA polymerase Taq polymerase T7 Sequenase Klenow Fragment Processivity High High Moderate Low Rate of incorporation (dntps/sec) Exonuclease activity >600 >600 > >3 exonuclease inactivated by deletion 5 ->3 exonuclease inactivated by deletion 3 ->5 exonuclease inactivated by deletion 3 ->5 exonuclease inactivated by deletion MW(Dalton) 60,000 80,000 84,000 75,000 Readable data(bp) Organism Thermus thermophilus HB27 Thermus aquaticus T7 bacteriophage E. coli Ordering Information BIONEER Cat. no. Product Description K-1020 Top TM DNA Sequencing Kit, 100 rxns, Each tube K-1021 Top TM DNA Sequencing Kit, 500 rxns, Each tube 226

13 SilverStar Staining Kit Storage: Store at room temperature Silver Staining 에사용되는물은반드시 3 차증류수를이용하십시오. Experimental data Description 기존의 Silver staining system 보다 DNA 검출민감도를 20 배이상높일수있도록고안된 enhancing solution( 등록특허 ; KOR, US) 을포함한제품입니다. Enhancing solution 에의해높은민감도를가지는 Silverstar TM Staining kit 는적은양 (1 pg DNA/mm2 band cross-selection) 의 DNA 도검출가능하며, DNA sequencing 용 gel 뿐만아니라 DDRT, SSCP, VNTR, RAPD 등다양한분석에적용할수있습니다. 방사선동위원소를사용하지않으므로안전하게실험을할수있을뿐만아니라, kit 를구성하는각각의시약들이 1 회용으로개별포장되어있어사용하기에편리합니다. Silver 에의한 DNA 분석의또하나의장점은신속한결과확인입니다. 방사선동위원소에의한 detection 결과는하루이상의시간이경과된후확인이가능한반면 gel 의 fixing, staining, developing 3 단계에의해이루어지는 DNA silver staining 은 1 시간 30 분안에결과를확인할수있습니다. Figure. 1. Pattern of differentially displayed mrna using RT/PCR PreMix. A total RNA was purified from endothelial cell(-) and Ras induced endothelial cell(r). dt-({g/a/c} indicates oligo dt11-(g/a/c) primer and AP1 indicates arbitrary primer 1. Procedures 1. Glass Coat Treatment : for long glass (separation) 2. Glass Bind Treatment : for short glass (binding) 15 min 15 min 3. Gel making & Pre-running/Running 2-4 hr 4. Fixing : by 10% acetic acid 30 min 5. Enhancing : by Enhancing solution 30 min 6. Staining : by Silver Nitrate 30 min 7. Developing : by Sodium Carbonate 5-10 min 8. Stopping& Washing : 10% acetic acid 5 min 9. Drying : on Ordering Information Cat. no. K-1050 SilverStar TM Staining Kit, 20 Gels Product Description 227

14 BIONEER 228

Sequencing Service DNA sequencing Phone: (ext.4->4)

Sequencing Service DNA sequencing Phone: (ext.4->4) DNA sequencing Phone: 1588-9788 (ext.4->4) Email: sequencing@bioneer.co.kr 01 3 Overview 바이오니아는국내최초로 를시작하였으며, 매년개선된 high-throughput sequencing service 를제공하고있습니다. Plasmid DNA, PCR product 등을비롯하여다양한종류의 template

More information

Technical/Specs Sequencing 서비스안내 Standard Sequencing Plasmid/PCR product 를 primer 를이용하여고객이원하는 region 을분석하는서비스이며, 대부분의 normal 샘플에대해 최적화되어있습니다. Full Len

Technical/Specs Sequencing 서비스안내 Standard Sequencing Plasmid/PCR product 를 primer 를이용하여고객이원하는 region 을분석하는서비스이며, 대부분의 normal 샘플에대해 최적화되어있습니다. Full Len Technical/Specs Sequencing 서비스안내 Standard Sequencing Plasmid/PCR product 를 primer 를이용하여고객이원하는 region 을분석하는서비스이며, 대부분의 normal 샘플에대해 최적화되어있습니다. Full Length Sequencing (Primer walking) 길이가긴 insert 를포함한 plasmid

More information

F. Sequencing FSequencing 01. Sequencing Service DNA sequencing Phone: (ext.4 4)

F. Sequencing FSequencing 01. Sequencing Service DNA sequencing Phone: (ext.4 4) FSequencing 01. DNA sequencing Phone: 1588-9788 (ext.4 4) E-mail: sequencing@bioneer.co.kr 01. 242 FAQs 247 개요 상세 설명 바이오니아는 국내 최초로 를 시작하였으며, 매년 개선된 high-throughput sequencing service를 제공하고 있습니다. Plasmid

More information

01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6

01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview

More information

Cloning

Cloning Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군

More information

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를 Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는

More information

DNA/RNA Amplification Overview AccuPower PreMix series 는세계적으로기술력을인정받은특허기술로보다경제적인가격과편리한방법으로실험할수있는제품입니다. Conventional PCR, Real-Time PCR 수행을위한 DNA ampli

DNA/RNA Amplification Overview AccuPower PreMix series 는세계적으로기술력을인정받은특허기술로보다경제적인가격과편리한방법으로실험할수있는제품입니다. Conventional PCR, Real-Time PCR 수행을위한 DNA ampli DNA Amplification RNA Amplification Real-Time PCR Customized PCR DNA/RNA Amplification Phone: 1588-9788 (ext.4->2) Email: accupower-support @bioneer.co.kr DNA/RNA Amplification Overview AccuPower PreMix

More information

01 Automated Protein Expression and Purification Using ExiProgen Selection Guide 267 ExiProgen EC Protein Synthesis Kit 268 ExiProgen EC-Maxi Protein

01 Automated Protein Expression and Purification Using ExiProgen Selection Guide 267 ExiProgen EC Protein Synthesis Kit 268 ExiProgen EC-Maxi Protein Automated Protein Expression and Purification Using ExiProgenTM Manual Protein Expression and Purification Preparation of Template DNA for Protein Expression Protein Service Protein Expression and Purification

More information

슬라이드 1

슬라이드 1 LC-MS 단백질분석을위한 SDS-PAGE staining protocol 및주의할점 Proteomics Core Facility 2017.12.28 Contents LC-MS 분석의뢰용 protein SDS-PAGE staining 시주의할점 Coomassie Blue R-250 을이용한 gel staining (general protocol) Coomassie

More information

슬라이드 1

슬라이드 1 TAKARA 1. PCR 2. qpcr 2014. 02. 13. 최유미 DNA? DNA 생물체 > 기관 > 세포 >DNA DNA (Deoxyribonucleic acid) 세포내에서생물의유젂정보를보관하는물질 구성 : Adenine, Thymine, Cytosine, Guanine 종특이적, 개체특이적 PCR (Polymerase Chain Reaction)

More information

TOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme

TOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme PCR Enzyme 부터 qpcr 까지! PCR 실험은 TOYOBO 로해결하세요! 행사기간 : 7 월 15 일 ~ 9 월 13 일까지 TOYOBO Reagent PCR Enzyme High Quality PCR Enzyme cdna Synthesis Kit qpcr One-step RT Kit Immunoreaction Enhancer Solution 추가

More information

고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn

고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna

More information

항체 포털 서비스 Preparation Peptide 총 4주 소요 / 473,000 ~ 511,000 Free of charge 2~3 days 243,000 ~ 281,000 의뢰서 작성 Peptide epitope prediction 유전자 정보

항체 포털 서비스 Preparation Peptide 총 4주 소요 / 473,000 ~ 511,000 Free of charge 2~3 days 243,000 ~ 281,000 의뢰서 작성 Peptide epitope prediction 유전자 정보 Preparation Service AbFrontier Custom service 장점 실험 담당자와의 원활한 1:1 커뮤니케이션 (신속한 feedback을 통한 맞춤형 제작 서비스) 고객연구센터 - 개별 서비스의 진행 상황 및 결과 즉시 확인 http://center.abfrontier.com (e-mail & SMS 전송) 회원제 -연구자의 프로젝트 보안

More information

ITEM 1 PCR Enzyme 20% DNA Polymerase Enzyme Quick Selection Guide for Effective PCR DNA Polymerase General PCR / Colony PCR Long PCR (Max. 23 kb) Hot

ITEM 1 PCR Enzyme 20% DNA Polymerase Enzyme Quick Selection Guide for Effective PCR DNA Polymerase General PCR / Colony PCR Long PCR (Max. 23 kb) Hot 2017 Summer BIG SALE 2017.7.3 ~ 9.8 ITEM 1 P C R Enzyme cpcr Enzyme 20% High Quality Enzyme ITEM 2 cdna Synthesis cdna Synthesis Kit 최대 33 % off ITEM 3 q P C R Enzyme Two-Step / One-Step Kit NGS Library

More information

System Biology Core

System Biology Core System Biology Core 연세의생명연구원연구지원부 _ 연세유전체센터 The RNAi Consortium (TRC) shrna 안내 Ⅰ. MISSION shrna 의설계 MIT 와 Harvard 의 Broad Institute 의 The RNAi Consortium (TRC) 에서설계하고개발한 MISSION shrna clones 는 21 base

More information

01 Cloning AccuRapid Cloning Kit NEW 3 Gene Cloning Service 4 AccuPower Ligation PreMix 6 T4 DNA Ligase 7 Thermostable Thermus filiformis (Tfi) DNA Li

01 Cloning AccuRapid Cloning Kit NEW 3 Gene Cloning Service 4 AccuPower Ligation PreMix 6 T4 DNA Ligase 7 Thermostable Thermus filiformis (Tfi) DNA Li Cloning DNA Amplification DNA Preparation Cloning (Cloning Kit & Gene Cloning Service) Phone: 042-930-8793 Email: genesynthesis-support@bioneer.co.kr Cloning (Ligase) Phone: 1588-9788 (ext.4->2) DNA Amplification

More information

01 Automated Protein Expression and Purification: ExiProgen Selection Guide 3 Protein Synthesis Kit ExiProgen EC Protein Synthesis Kit 4 ExiProgen EC-

01 Automated Protein Expression and Purification: ExiProgen Selection Guide 3 Protein Synthesis Kit ExiProgen EC Protein Synthesis Kit 4 ExiProgen EC- Automated Protein Expression and Purification: ExiProgen TM Manual Protein Expression and Purification: AccuRapid TM & MagListo TM Preparation of Template DNA for Protein Expression Protein Service Protein

More information

Automated high multiplex qPCR platform for simultaneous detection and quantification of multiple nucleic acid targets

Automated high multiplex qPCR platform for simultaneous detection and quantification of multiple nucleic acid targets PCR FlashGel System 2013. 04. 24 PCR 2013. 04. 24 순서 1. PCR 이란 2. PCR 실험의기본조건 3. PCR 효소선택가이드 4. Hot Start PCR의원리 5. PCR 실험시 Troubleshooting 6. PCR 장비 _TP350 소개 PCR(Polymerase Chain Reaction) PCR 이란? -

More information

2019 TOYOBO BIG SALE 기간 : 2019년 7월 1일 ~ 9월 11일까지 최대 33% SALE qpcr Enzyme PCR Enzyme 20% 2+1 cpcr Enzyme cdna Synthesis 2+1 cdna Synthesis kit High Qua

2019 TOYOBO BIG SALE 기간 : 2019년 7월 1일 ~ 9월 11일까지 최대 33% SALE qpcr Enzyme PCR Enzyme 20% 2+1 cpcr Enzyme cdna Synthesis 2+1 cdna Synthesis kit High Qua 2019 TOYOBO BIG SALE 기간 : 2019년 7월 1일 ~ 9월 11일까지 최대 33% SALE qpcr Enzyme PCR Enzyme cpcr Enzyme cdna Synthesis cdna Synthesis kit High Quality Enzyme Immuno Enhancer Cloning One-Step kit Can Get Signal

More information

ReverTra Ace cdna Synthesis Kit d ReverTra Ace M-MLV RTase의 RNase H domain 부위에유전자조작을시켜, Rnase H activity를낮추어 mrna의 degradation을방지하여 cdna 합성효율을높임 Long

ReverTra Ace cdna Synthesis Kit d ReverTra Ace M-MLV RTase의 RNase H domain 부위에유전자조작을시켜, Rnase H activity를낮추어 mrna의 degradation을방지하여 cdna 합성효율을높임 Long 2016 TOYOBO SUMMER SALE 2016.7.4 ~ 9.9 cdna Synthesis Kit qpcr Master Mix KOD Polymerase Enzyme DNA Polymerase Enzyme Immuno Enhancer ReverTra Ace cdna Synthesis Kit d ReverTra Ace M-MLV RTase의 RNase H

More information

PCR DNA Polymerase 선택가이드 일반적인 PCR 실험 Blend Taq / Blend Taq -Plus- Repairing 일반 DNA polymerase와 proofreading 기능의효소가섞인제품 Taq polymerase 보다 3~4 배낮은 error

PCR DNA Polymerase 선택가이드 일반적인 PCR 실험 Blend Taq / Blend Taq -Plus- Repairing 일반 DNA polymerase와 proofreading 기능의효소가섞인제품 Taq polymerase 보다 3~4 배낮은 error TOYOBO HOT SUMMER BIG SALE 행사기간ㅣ 2015 년 6 월 22 일 ~ 8 월 28 일까지 2+1 PCR DNA Polymerase cdna Synthesis Kit ㅣ KOD Series ㅣ Blend Taq Series ㅣ Quick Taq HS DyeMix ㅣ ReverTra Ace Series 플러스혜택 Set 구매시, 최대 45%

More information

3월 온라인 교육

3월 온라인 교육 2013 년 2 분기대리점집체교육 - Protein - Takara Korea Biomedical Protein Workflow Chapter 1: 샘플준비 Chapter 2: Electrophoresis -Precast gel (Lonza/NuSep) -ProSieve EX running buffer -Protein marker Chapter 3: Staining

More information

Surpass the limit of Polymerase Chain Reaction (PCR) PCR Enzyme Guide High Fidelity PCR 효소 범용적인 PCR 효소 특수목적을위한 PCR 효소 - Epigenetics - Multiplex PCR -

Surpass the limit of Polymerase Chain Reaction (PCR) PCR Enzyme Guide High Fidelity PCR 효소 범용적인 PCR 효소 특수목적을위한 PCR 효소 - Epigenetics - Multiplex PCR - Surpass the limit of Polymerase Chain Reaction (PCR) PCR Enzyme Guide High Fidelity PCR 효소 범용적인 PCR 효소 특수목적을위한 PCR 효소 - Epigenetics - Multiplex PCR - Direct PCR High Fidelity PCR 효소 - NGS targeted sequencing,

More information

Selection chart of Bioneer s cdna synthesis products Categories Application Product cdna Synthesis Kits One step RT-PCR Kits One step RT-qPCR Kits RTa

Selection chart of Bioneer s cdna synthesis products Categories Application Product cdna Synthesis Kits One step RT-PCR Kits One step RT-qPCR Kits RTa Selection chart of Bioneer s cdna synthesis products Categories Application Product cdna Synthesis Kits One step RT-PCR Kits One step RT-qPCR Kits RTase 표준 cdna 합성 높은효율의 cdna 합성 복잡한 2 차구조 RNA 의 cdna 합성

More information

Ver.4 (KR) All about RT (cdna Synthesis) 8-11 Munpyeongseo-ro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea) (Internatio

Ver.4 (KR) All about RT (cdna Synthesis) 8-11 Munpyeongseo-ro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea) (Internatio 20170619 Ver.4 (KR) All about RT (cdna Synthesis) 8-11 Munpyeongseo-ro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea)1588-9788 (International) +82-42 - 930-8777 Email: sales@bioneer.com Selection

More information

Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No ) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터

Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No ) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터 Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No. 50004) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터 (학술/제품문의) 02-2081 - 2510 www.takara.co.kr support@takara.co.kr

More information

뉴스지14호-칼라

뉴스지14호-칼라 2 3 4 5 6 TaKaRa Taq TM / TaKaRa Ex Taq TM / TaKaRa LA Taq TM / Pyrobest TM DNA Polymerase/ TaKaRa Z -Taq TM TaKaRa Taq TM TaKaRa Ex Taq TM TaKaRa LA Taq TM TaKaRa Z-Taq TM Pyrobest TM DNA Polymerase 7

More information

Cloning=Clontech In-Fusion Cloning

Cloning=Clontech  In-Fusion Cloning Cloning 을위한모든것 2014-06-18 다카라코리아바이오메디칼 Contents Cloning Restriction Enzyme General Restriction Enzyme QuickCut Restriction Enzyme Cloning Restriction Enzyme/Ligation TA Cloning In-Fusion Cloning TaKaRa

More information

DNA Polymerase Enzyme Quick Selection Guide for Effective PCR DNA Polymerase High Quality Polymerase General PCR / Colony PCR High Fidelity PCR (80-fo

DNA Polymerase Enzyme Quick Selection Guide for Effective PCR DNA Polymerase High Quality Polymerase General PCR / Colony PCR High Fidelity PCR (80-fo 2018 TOYOBO BIG SALE 기간 : 2018년 7월 16일 ~ 9월 21일까지 TOYOBO 전제품 최대 33% SALE PCR Enzyme cpcr Enzyme cdna Synthesis cdna Synthesis Kit qpcr Enzyme One-Step / Two-Step Kit Immuno Enhancer High Quality Enzyme

More information

EZ-Cloning kit

EZ-Cloning kit EZ TM 5 /3 RACE PCR Kit Instruction Manual Korean Ver. Kit for 10 reactions Cat.# EZ025 EZ TM 5 /3 RACE PCR Kit Table of Contents I. 제품설명... 3 II. 원리... 4 III. 제품구성... 7 IV. 염기서열정보... 8 V. 주의사항... 8 VI.

More information

SMARTer Sequencing Kits for Next Generation Sequencing

SMARTer Sequencing Kits for Next Generation Sequencing Simple, Fast, Powerful SMARTer Solution for NGS 다카라코리아바이오메디칼 1 페이지 표지분석 NGS Library 제작시의어려움을, SMARTer 기술로극복! FFPE Sample 과같은 Low input, degraded RNA 로부터 Sequencing 을가능하게! Single Cell sample 로부터 Library

More information

실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양

실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양 실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양의시료를대량으로증폭할수있다는장점과그과정이간단하여 Cloning, Sequencing 등의기본기술로응용되었다.

More information

Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot

Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot EZ-LDH Cell Cytotoxicity Assay Kit Cat. No. DG-LDH500 DG-LDH1000 FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. 1 ( 주 ) 대일랩서비스부설두젠생명공학연구소 Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는

More information

(Establishment and Management of Proteomics Core Facility)

(Establishment and Management of Proteomics Core Facility) (Establishment and Management of Proteomics Core Facility) 1 sample running on SDS-PAGE Gel (10well) 163570 10 16357 1D size marker 225500 100 2255 Buffer(20X, 500ml) 119900 20 5995 Staining

More information

CD 2117(121130)

CD 2117(121130) 제품보증서 품질 보증기간은 구입일로부터 1년간이며, 애프터서비스용 부품의 보증기간은 5년간 입니다. 애프터서비스용 부품이란 외장을 제외한 회로, 기능 부품을 말합니다. (당사 규정에 따른 것임) 제 품 명 모 년 구 입 일 구 입 자 판 매 자 월 일 주소 성명 주소 대리점명 델 명 SERIAL NO. TEL. TEL. 제품보증조건 무상 서비스: 보증기간내의

More information

mau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions

More information

2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.

2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2. 2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.8.1. OIE 2012 ver. - EU ASF reference lab CISA-INIA(Spain)

More information

Ver.3(KR) All about Real-Time PCR 8-11, Munpyeongseoro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea) (International) +

Ver.3(KR) All about Real-Time PCR 8-11, Munpyeongseoro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea) (International) + 20170402 Ver.3(KR) All about Real-Time PCR 8-11, Munpyeongseoro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea) 1588-9788 (International) +82-42 - 930-8777 Email: sales@bioneer.com Real-Time

More information

Slide 1

Slide 1 PrimeScript 1st strand cdna Synthesis Kit 1 Central Dogma replication transcription 0 processing translation 오늘의내용은? 조직추출 RNAiso Plus 5 mrna 우리가관심있는 mrna가차지하는비율이극히일부이기때문에관심있는 mrna를증폭해서그것을눈으로확인할정도로만들어주는것이다.

More information

슬라이드 1

슬라이드 1 EVENT 퀴아젠인기상품연말특별가전 200203 Top Taq DNA Polymerase (250U) 90,000 72,000 200205 Top Taq DNA Polymerase (1000U) 331,000 281,350 200403 Top Taq Master Mix Kit(250U) 104,000 83,200 201203 Taq DNA Polymerase

More information

SMARTer 시리즈

SMARTer 시리즈 SMARTer 시리즈 SMARTer Solutions 2014.12.17 다카라코리아바이오메디칼 SMART 하게실험하고 SMARTer 한결과를얻는방법 Clontech SMARTer 시리즈 Contents 1. Introduction 1. 역전사반응이란? 2. 기존역전사반응의한계 2. SMARTer 시리즈 1. SMARTer 란? 2. SMARTer 시리즈와적용

More information

슬라이드 1

슬라이드 1 Real Time PCR 목차 1. PCR 및 Real Rime PCR 원리 2. Real Time PCR 검출방법 3. Real Time PCR 정량방법 4. Takara Real Time PCR 시약 5. 금일실험내용 Polymerase Chain Reaction Taq DNA Polymerase - Thermostable DNA polymease from

More information

- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol

More information

(Table of Contents) 2 (Specifications) 3 ~ 10 (Introduction) 11 (Storage Bins) 11 (Legs) 11 (Important Operating Requirements) 11 (Location Selection)

(Table of Contents) 2 (Specifications) 3 ~ 10 (Introduction) 11 (Storage Bins) 11 (Legs) 11 (Important Operating Requirements) 11 (Location Selection) SERVICE MANUAL (Table of Contents) 2 (Specifications) 3 ~ 10 (Introduction) 11 (Storage Bins) 11 (Legs) 11 (Important Operating Requirements) 11 (Location Selection) 12 (Storage Bins) 12 (Ice Machine)

More information

주의내용 주 의 1. 이보고서는질병관리본부에서시행한학술연구용역사업의최종결 과보고서입니다. 2. 이보고서내용을발표할때에는반드시질병관리본부에서시행한 학술연구용역사업의연구결과임을밝혀야합니다. 3. 국가과학기술기밀유지에필요한내용은대외적으로발표또는공개 하여서는아니됩니다.

주의내용 주 의 1. 이보고서는질병관리본부에서시행한학술연구용역사업의최종결 과보고서입니다. 2. 이보고서내용을발표할때에는반드시질병관리본부에서시행한 학술연구용역사업의연구결과임을밝혀야합니다. 3. 국가과학기술기밀유지에필요한내용은대외적으로발표또는공개 하여서는아니됩니다. 편집순서 1 : 겉표지 학술연구용역사업최종결과보고서 과 제 명 주 의 ( 주의내용기재 ) 2 0 1 1 ( 글 14 point 고딕체 ) 주관연구기관 질병관리본부 질병관리본부 주의내용 주 의 1. 이보고서는질병관리본부에서시행한학술연구용역사업의최종결 과보고서입니다. 2. 이보고서내용을발표할때에는반드시질병관리본부에서시행한 학술연구용역사업의연구결과임을밝혀야합니다.

More information

Database Search 편 * Database Explorer 8개의카테고리로구성되어있으며, 데이터베이스의폴더역할을하는 subset ( 혹은 subbase) 을생성하여데이터를조직및관리하게된다. 클릭! DNA/RNA Molecules : feature map의데이터

Database Search 편 * Database Explorer 8개의카테고리로구성되어있으며, 데이터베이스의폴더역할을하는 subset ( 혹은 subbase) 을생성하여데이터를조직및관리하게된다. 클릭! DNA/RNA Molecules : feature map의데이터 Database Search 편 * Database Explorer 8개의카테고리로구성되어있으며, 데이터베이스의폴더역할을하는 subset ( 혹은 subbase) 을생성하여데이터를조직및관리하게된다. 클릭! DNA/RNA Molecules : feature map의데이터정보를 annotation하고, 다른소스로부터가져온데이터를 VectorNTI 내부포맷으로저장시킨다.

More information

Title: Biacore getting started kit 를이용한 KD 값도출방법 목차 1. 실험목적 2. 실험개요와필요한시약및소모품 2.1 실험개요 2.2 필요한시약및소모품 3. 실험방법과결과 3.1 ph-scouting for pre-concentration

Title: Biacore getting started kit 를이용한 KD 값도출방법 목차 1. 실험목적 2. 실험개요와필요한시약및소모품 2.1 실험개요 2.2 필요한시약및소모품 3. 실험방법과결과 3.1 ph-scouting for pre-concentration Title: Biacore getting started kit 를이용한 KD 값도출방법 목차 1. 실험목적 2. 실험개요와필요한시약및소모품 2.1 실험개요 2.2 필요한시약및소모품 3. 실험방법과결과 3.1 ph-scouting for pre-concentration 3.2 Immobilization 3.3 Regeneration scouting 3.4 Interaction

More information

슬라이드 1

슬라이드 1 New PCR Instruments 2013. 2. 21 다카라코리아바이오메디칼 Agenda FAST PCR이란? New FAST PCR Instrument _ TP450 New PCR Instrument _ TP350 기기캠페인소개 PCR FAST 관련 PCR 제품관련제품 최고수준의정확성 & 최고의신장속도 ( 신장성 5sec/kb) PrimeSTAR Max

More information

뉴스레터6호F?2??訝

뉴스레터6호F?2??訝 February 2009 No.06 Roche Diagnostics Korea Co., Ltd. Focus Tech EDITORIAL February 2009 No.06 Contents Editorial 03 Focus 04 Product 10 Talk 12 Tech 14 Activity 19 Style 22 February 2009 No.06 02 03 FOCUS

More information

Print

Print 2018-09-11 Ver.4 (KR) 8-11, Munpyeongseo-ro, Daedeok-gu, Daejeon, 34302, Republic of Korea Tel: (Korea) 1588-9788 (International) +82-42-930-8777 Email: sales@bioneer.com Real-Time PCR Reagents Selection

More information

BIONEER CORPORATION Preface 본책자는포스트게놈시대의생명공학연구실의필수적인연구장비인 ExiProgen 에관한설명서입니다. ExiProgen 은무세포 transcription, translation 반응과 magnetic affinity purification 을이용하여 DNA 로부터다양한단백질들을전자동으로합성하고고순도로정제할수있어생명공학의획기적인발전을가져올수있는신개념의장비입니다.

More information

Vertical Probe Card Technology Pin Technology 1) Probe Pin Testable Pitch:03 (Matrix) Minimum Pin Length:2.67 High Speed Test Application:Test Socket

Vertical Probe Card Technology Pin Technology 1) Probe Pin Testable Pitch:03 (Matrix) Minimum Pin Length:2.67 High Speed Test Application:Test Socket Vertical Probe Card for Wafer Test Vertical Probe Card Technology Pin Technology 1) Probe Pin Testable Pitch:03 (Matrix) Minimum Pin Length:2.67 High Speed Test Application:Test Socket Life Time: 500000

More information

Conventional PCR: AllInOneCycler Real-Time PCR: Exicycler 96 Protein Synthesis and Purification: ExiProgen DNA/RNA Preparation: ExiPrep 16 Plus & ExiC

Conventional PCR: AllInOneCycler Real-Time PCR: Exicycler 96 Protein Synthesis and Purification: ExiProgen DNA/RNA Preparation: ExiPrep 16 Plus & ExiC Conventional PCR: AllInOneCycler Real-Time PCR: Exicycler 96 Protein Synthesis and Purification: ExiProgen DNA/RNA Preparation: ExiPrep 16 Plus & ExiCracker Electrophoresis: Agaro-Power Microbial Culture:

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun

More information

PowerPoint Presentation

PowerPoint Presentation GE Healthcare Life Sciences 재교육프로그램 실험장비활용을위한재교육이필요하신고객님을위해본사의 Applications Specialists 가여러분의실험실로방문해서재교육서비스를제공해드립니다. 교육참여인원은가급적 3 명이내로제한해야의미있는 Hands-on 교육이될수있음을알려드립니다. 장비의보증기간이만료되었고, 서비스계약이체결되어있지않은고객님께는소정의교육비가부과됩니다.

More information

00.1

00.1 HOSPA Chipboard screws with countersunk head Material: Drive: Cross recess PZ galvanized yellow chromatized nickel plated burnished Partly threaded, galvanized or yellow chromatized dk k L d m Head Ø dk

More information

한약재품질표준화연구사업단 작약 ( 芍藥 ) Paeoniae Radix 생약연구과

한약재품질표준화연구사업단 작약 ( 芍藥 ) Paeoniae Radix 생약연구과 한약재품질표준화연구사업단 작약 ( 芍藥 ) Paeoniae Radix 생약연구과 - 2 - KP 11 CP 2015 JP 16 Paeoniae Radix Paeoniae Radix Alba Paeoniae Radix Rubra Paeoniae Radix Paeonia lactiflora Pallas paeoniflorin, albiflorin 2.3% Paeonia

More information

Microsoft Word - Genolution RNAi Manual.doc

Microsoft Word - Genolution RNAi Manual.doc 1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000

More information

Week01-workshop.hwp

Week01-workshop.hwp Polymerase Chain Reaction 과반응산물의정제 김상태서울대학교천연물과학연구소 adanson@plaza.snu.ac.kr A. Polymerase Chain Reaction Polymerase chain reaction (PCR) 은 genome 상의특정 DNA 염기서열을 denaturation, primer annealing, DNA polymerase에의한

More information

(....).hwp

(....).hwp 연구기관 한국식품연구원 농림부 연구기관 한국식품연구원 농림부 Analytical Semi-preparative Solution A 1) Solution B 2) Mixing Spreading Coating medium Corona treated OPP 3) film Casting Drying

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Original Article Journal of Apiculture 31(1) : 41~50 (2016) Rapid Detection of Black Queen Cell Virus from Honeybee using Reverse Transcription Real-Time Recombinase Polymerase Amplification (RT/RT RPA)

More information

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF. 1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -

More information

Development of culture technic for practical cultivation under structure in Gastrodia elate Blume

Development of culture technic for practical cultivation under structure in Gastrodia elate Blume Development of culture technic for practical cultivation under structure in Gastrodia elate Blume 1996. : 1. 8 2. 1 1998. 12. : : ( ) : . 1998. 12 : : : : : : : : : : - 1 - .. 1.... 2.. 3.... 1..,,.,,

More information

cdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR

cdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR RT-PCR 법 II. 역전사효소반응 ( 주 ) 다인바이오연구소 현재분자생물학분야에서 RNA 수준의 gene expression ( 유전자발현 ) 과 cdna (complementary DNA) cloning에널리이용되고있는 RT-PCR (Reverse transcription ploymerase chain reaction) 은생명정보가 DNA에서 RNA로전달된다는분자생물학분야의

More information

(specifications) 3 ~ 10 (introduction) 11 (storage bin) 11 (legs) 11 (important operating requirements) 11 (location selection) 12 (storage bin) 12 (i

(specifications) 3 ~ 10 (introduction) 11 (storage bin) 11 (legs) 11 (important operating requirements) 11 (location selection) 12 (storage bin) 12 (i SERVICE MANUAL N200M / N300M / N500M ( : R22) e-mail : jhyun00@koreacom homepage : http://wwwicematiccokr (specifications) 3 ~ 10 (introduction) 11 (storage bin) 11 (legs) 11 (important operating requirements)

More information

50(2)-04.fm

50(2)-04.fm 2006, Vol. 50, No. 2 Printed in the Republic of Korea RFLP 와 DHPLC 를이용한베체트병환자에서 Interleukin-6 유전자다형성의분석 Áû xá Á Á * w w yw» w (2005. 12. 26 ) Analysis of Interleukin-6 Gene Polymorphisms in Behcet s Disease

More information

MHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State

More information

Ver.0 (KR) Next Generation Sequencing Service Bioneer Corporation is Korea s leading biotech company. Bioneer is the first Korean biotechnolo

Ver.0 (KR) Next Generation Sequencing Service Bioneer Corporation is Korea s leading biotech company. Bioneer is the first Korean biotechnolo Ver.0 (KR) 20190410 Next Generation Sequencing Service Bioneer Corporation is Korea s leading biotech company. Bioneer is the first Korean biotechnology company when it was established in 1992. 생명과학국내

More information

#KM-235(110222)

#KM-235(110222) PARTS BOOK KM-235A/B INFORMATION A. Parts Book Structure of Part Book Unique code by mechanism Unique name by mechanism Explode view Ref. No. : Unique identifcation number by part Parts No. : Unique Product

More information

1217 WebTrafMon II

1217 WebTrafMon II (1/28) (2/28) (10 Mbps ) Video, Audio. (3/28) 10 ~ 15 ( : telnet, ftp ),, (4/28) UDP/TCP (5/28) centralized environment packet header information analysis network traffic data, capture presentation network

More information

MIL-C-99 Class C, R Style Connector, Receptacle, lectrical, Wall mounting YH7(MS7 Style) PLCS 전기적특성 (lectrical ata) ltitude erating Service Rating Nom

MIL-C-99 Class C, R Style Connector, Receptacle, lectrical, Wall mounting YH7(MS7 Style) PLCS 전기적특성 (lectrical ata) ltitude erating Service Rating Nom MIL-C-99 Class C, R Style MIL-C-99 Class C, R Style 주문정보 및 부품번호 구분 (Ordering Information) MS7 C 0 C 7 P W MS Number Shell Style Class Contact rrangement Contact Style Polarizing Position MS Number Shell

More information

Oligo synthesis 4 단계공정을한 cycle 로하여 1 mer 씩 3' 말단에서 5' 말단까지순차적으로합성이진행됩니다. Deblocking Coupling Capping Oxidation OPC Purification Reverse-phase chromato

Oligo synthesis 4 단계공정을한 cycle 로하여 1 mer 씩 3' 말단에서 5' 말단까지순차적으로합성이진행됩니다. Deblocking Coupling Capping Oxidation OPC Purification Reverse-phase chromato 온라인용 Brochure 입니다. CUSTOM Oligo SYNTHESIS SERVICE Oligo synthesis 4 단계공정을한 cycle 로하여 1 mer 씩 3' 말단에서 5' 말단까지순차적으로합성이진행됩니다. Deblocking Coupling Capping Oxidation OPC Purification Reverse-phase chromatography

More information

l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related

More information

Preliminary spec(K93,K62_Chip_081118).xls

Preliminary spec(K93,K62_Chip_081118).xls 2.4GHz Antenna K93- Series KMA93A2450X-M01 Antenna mulilayer Preliminary Spec. Features LTCC Based designs Monolithic SMD with small, low-profile and light-weight type Wide bandwidth Size : 9 x 3 x 1.0mm

More information

*....1..~2..

*....1..~2.. Contents 1 2 Contents 2 3 Korea Culture Korea Culture Information Service Information Service 1 1 1 02 Korea Culture Information Service 2 03 04 Korea Culture Information Service 3 05 06 Korea Culture

More information

05052유식안101.hwp

05052유식안101.hwp 제 출 문 식품의약품안전청장 귀 하 이 보고서를 유전자재조합식품 모니터링(부산광역시보건환경연구원/정구영) 과제의 연구 결과보고서로 제출합니다. 2005. 11. 30 주관연구기관명 : 부산광역시보건환경연구원 주관연구책임자 : 정구영 목 차 Ⅰ. 연구개발결과 요약문----------------------------------- 1 (한글)------------------------------------------

More information

한약재품질표준화연구사업단 단삼 ( 丹參 ) Salviae Miltiorrhizae Radix 생약연구과

한약재품질표준화연구사업단 단삼 ( 丹參 ) Salviae Miltiorrhizae Radix 생약연구과 한약재품질표준화연구사업단 단삼 ( 丹參 ) Salviae Miltiorrhizae Radix 생약연구과 - 1 - KP 11 CP 2015 Salvia miltiorrhizae Radix Salviae Miltiorrhizae Radix et Rhizoma Salvia miltiorrhiza Bunge Salvia miltiorrhiza Bunge salvianolic

More information

Statistical Data of Dementia.

Statistical Data of Dementia. Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.

More information

Chapter 4. Bacteria (the first microbes)

Chapter 4. Bacteria (the first microbes) - DNA 정제후클로닝을위한효소적절단과연결필요 -> restriction enzyme, ligase 가중요 1. DNA 조작효소범위 - 촉매반응에따라 5 분류 1. Nuclease : 핵산분자의절단, 단편화 2. Ligase : 핵산분자의연결 3. Polymerase : DNA 사슬합성 4. Modifying enzyme : 화학기능기의첨가, 제거 5. Topoisomerase

More information

Chapter 14 유전정보 (Genetic Information) A + G = C + T 일정 ( 샤가프룰 ] - Watson & Crick(1953년 ) : double helix model of DNA( 이중나선구조 ) 제시 1. 유전정보의전달경로 DNA 상의정

Chapter 14 유전정보 (Genetic Information) A + G = C + T 일정 ( 샤가프룰 ] - Watson & Crick(1953년 ) : double helix model of DNA( 이중나선구조 ) 제시 1. 유전정보의전달경로 DNA 상의정 Chapter 14 유전정보 (Genetic Information) A + G = C + T 일정 ( 샤가프룰 ] - Watson & Crick(1953년 ) : double helix model of DNA( 이중나선구조 ) 제시 1. 유전정보의전달경로 DNA 상의정보를 RNA로옮겨주는과정 ex) retrovirus 2. DNA Replication ( 유전자복제

More information

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법

More information

<4D F736F F F696E74202D C61645FB3EDB8AEC7D5BCBA20B9D720C5F8BBE7BFEBB9FD2E BC8A3C8AF20B8F0B5E55D>

<4D F736F F F696E74202D C61645FB3EDB8AEC7D5BCBA20B9D720C5F8BBE7BFEBB9FD2E BC8A3C8AF20B8F0B5E55D> VHDL 프로그래밍 D. 논리합성및 Xilinx ISE 툴사용법 학습목표 Xilinx ISE Tool 을이용하여 Xilinx 사에서지원하는해당 FPGA Board 에맞는논리합성과정을숙지 논리합성이가능한코드와그렇지않은코드를구분 Xilinx Block Memory Generator를이용한 RAM/ ROM 생성하는과정을숙지 2/31 Content Xilinx ISE

More information

<31335FB1C7B0E6C7CABFDC2E687770>

<31335FB1C7B0E6C7CABFDC2E687770> 에너지기후변화교육 4(2):203~211(2014) 203 초등학교 교과서 에너지 단원의 탐구활동과 시각자료 기능 분석 사례 연구 신명경 권경필 * 경인교육대학교 Abstract : This study aimed to analyze energy related inquiry activity and visual materials in elementary textbook.

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,

More information

DW 개요.PDF

DW 개요.PDF Data Warehouse Hammersoftkorea BI Group / DW / 1960 1970 1980 1990 2000 Automating Informating Source : Kelly, The Data Warehousing : The Route to Mass Customization, 1996. -,, Data .,.., /. ...,.,,,.

More information

한약재품질표준화연구사업단 금은화 ( 金銀花 ) Lonicerae Flos 생약연구과

한약재품질표준화연구사업단 금은화 ( 金銀花 ) Lonicerae Flos 생약연구과 한약재품질표준화연구사업단 금은화 ( 金銀花 ) Lonicerae Flos 생약연구과 - 2 - KP 11 Lonicerae Flos Lonicera japonica Thunberg - CP 2015 JP 16 Lonicerae Japonicae Flos Lonicerae Folium Cum Caulis Lonicera japonica Thunberg - Lonicera

More information

김도희_HT protein expression 표준 보고서_v1.5

김도희_HT protein expression 표준 보고서_v1.5 Production of Recombinant Proteins For Further Information, Please Contact Neurogenex Co., Ltd. Biotechnology Incubating Center "Golden Helix" Seoul Natl' Univ. Seoul 151-744, Korea TEL 82-2-875-8998 FAX

More information

USER GUIDE

USER GUIDE Solution Package Volume II DATABASE MIGRATION 2010. 1. 9. U.Tu System 1 U.Tu System SeeMAGMA SYSTEM 차 례 1. INPUT & OUTPUT DATABASE LAYOUT...2 2. IPO 중 VB DATA DEFINE 자동작성...4 3. DATABASE UNLOAD...6 4.

More information

Microsoft Word - USB복사기.doc

Microsoft Word - USB복사기.doc Version: SD/USB 80130 Content Index 1. Introduction 1.1 제품개요------------------------------------------------------------P.02 1.2 모델별 제품사양-------------------------------------------------------P.04 2. Function

More information

APOGEE Insight_KR_Base_3P11

APOGEE Insight_KR_Base_3P11 Technical Specification Sheet Document No. 149-332P25 September, 2010 Insight 3.11 Base Workstation 그림 1. Insight Base 메인메뉴 Insight Base Insight Insight Base, Insight Base Insight Base Insight Windows

More information

Abstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,

More information

A

A 2009 4 A270412 < 차례> 1 요약 1 2 심사경위 2 3 심사경과 2 4 심사방법 3 5 심사신청자료검토 3 51 심사신청된식품의개요 3 52 식품으로의적합성검토 3 53 유전자재조합체의안전성 3 가 유전자재조합체의개발목적및이용방법에관한자료 3 나 숙주에관한자료 4 (1) 분류학적특성( 일반명 학명 계통분류등) 4 (2) 재배및품종개량의역사 4

More information

김기남_ATDC2016_160620_[키노트].key

김기남_ATDC2016_160620_[키노트].key metatron Enterprise Big Data SKT Metatron/Big Data Big Data Big Data... metatron Ready to Enterprise Big Data Big Data Big Data Big Data?? Data Raw. CRM SCM MES TCO Data & Store & Processing Computational

More information

(Microsoft PowerPoint - src.ppt [\300\320\261\342 \300\374\277\353] [\310\243\310\257 \270\360\265\345])

(Microsoft PowerPoint - src.ppt [\300\320\261\342 \300\374\277\353] [\310\243\310\257 \270\360\265\345]) LC/MS, LC/MS/MS 기초개론 LC LC/MS(Liquid Chromatography/Mass Spectrometry) 액상의분석물질을기화및이온화하여고진공관에서원하는질량 (m/z) 이나질량범위만검출하여정량 정성분석하는시스템 High vacuum PC/Software Ion source Mass Analyzer Detector ESI APCI APPI

More information

Subject : 귀사의 일익번창하심을 진심으로 기원합니다.

Subject : 귀사의 일익번창하심을 진심으로 기원합니다. 1. 18 D-303 Tel : () 031-711-1560 Fax : 031-711-1563 www.iontec.co.kr e-mail : ion@iontec.co.kr (organic reaction). (esterification) (hydrolysis of ester). Porous type (alkylation) system. ( gel type ).

More information

(....).hwp

(....).hwp sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial

More information

( Full Automatic Printer ) 작용업종 : Tube Light ( 형광등 1.2m / 2.4m) 가로등조명. 인테리어산업용조명 Loader 1.2m Stencil Solder LED LD812V Reflow 8 to 10 Hot Air Convecti

( Full Automatic Printer ) 작용업종 : Tube Light ( 형광등 1.2m / 2.4m) 가로등조명. 인테리어산업용조명 Loader 1.2m Stencil Solder LED LD812V Reflow 8 to 10 Hot Air Convecti Autotronik-SMT GmbH LED Assembly 위한장비구성도 Printer LED Pick & Place Reflow V-Cutting Model 1 1.2m Tube LED " 양산 " 장비 Full Vision Auto Printer 1.2m LED Pick & Place LED Reflow 10 Zone LED Multi V-Cutting

More information

iloom STUDY 2012(<B300><C6A9><B7C9>).pdf

iloom STUDY 2012(<B300><C6A9><B7C9>).pdf 2012 STUDY FALL / WINTER 2012 STUDY FALL / WINTER CONTENTS 04 INTRO 04 MAKING STORY 06 ILOOM SMART SERVICE 08 KIDS 10 TINKLE2 20 TWINY 28 STUDY 30 LINKI 38 KARAT 42 OLLI 46 REVO 50 ALTUS 56 EDIS 62 NOX

More information

Chapter 26

Chapter 26 11 주 RNA 합성 11.1 DNA-dependent synthesis of RNA: Bacteria에서의 transcription l RNA polymerase (5 subunits로구성 : 2α, β, β, σ) l 효소에의한 RNA 합성의특징 - Complementary sequence to template DNA - RNA chain의합성방향 : 5

More information

DocsPin_Korean.pages

DocsPin_Korean.pages Unity Localize Script Service, Page 1 Unity Localize Script Service Introduction Application Game. Unity. Google Drive Unity.. Application Game. -? ( ) -? -?.. 준비사항 Google Drive. Google Drive.,.. - Google

More information