Microsoft PowerPoint - Gene Cloning.ppt

Size: px
Start display at page:

Download "Microsoft PowerPoint - Gene Cloning.ppt"

Transcription

1 Gene Cloning 메가MD 생물 김재윤 1

2 1) Gene cloning의 1단계 - 원하는 유전자를 얻어낸다 1 Internet에서의 유전자 검색 GenBank 2 GenBank 염기서열의 분석 3 Polymerase Chain Reaction(PCR)Reverse 4 Transcriptase-Polymerase Chain Reaction(RT-PCR)RNA의분리 5 PCR 산물의 전기영동(electrophoresis) 2) Gene cloning의 2단계 - 얻은 유전자를 vector에 삽입한다. 1 Vector에 대하여 DNA ligation과 restriction enzyme 2 T-vector를 이용한 PCR product의 cloning 3) Gene cloning의 3단계 -유전자가 삽입된 DNA를 세포 내로 주입한다. 1 Transformation 2 항생제와 LacZ를 이용한 selection 4) Gene cloning의 4단계 - 올바른 clone을 선택한다 1 Plasmid DNA 분리 2 Restriction enzyme mapping 3 DNA sequencing 2

3 >>Gene cloning의 1단계 - 원하는 유전자를 얻어낸다. 1. 어떤 유전자에서 찾을 것인가? 유전자는 RNA에서 얻을 수도 있고 DNA에서 얻을 수도 있다. DNA 에서는 exon 과 intron, cds(coding sequences)를 생각해야 한다. 우선 어떤 종(species)에서 실험해야 하는가를 결정해야 한다. Human, rat, mouse 등 각각의 종에 해당이 되어야 한다. 그다음으로중요한것은특히mRNA를 이용하는 경우에 반드시 어떤 장기를 사용해야 하는가를 명백히 해야 한다는 것이다. 각 장기들에서 DNA는대개같다고볼수있지만 mrna는있을수도 있고 없을 수도 있다. 그리고 구조가 다를 수도 있습니다. 따라서 자신이 얻고자 하는 유전자가 잘 발현되는 장기를 선택해야 한다. 2. 유전자를 어떻게 얻을 것인가? Library screening 과 PCR(polymerase chain reaction) 방법. 3. 유전자에서 증폭할 부분이 어디인가? 3

4 4

5 >>Internet에서의 유전자 검색 -GenBank 5

6 6

7 7

8 8

9 <Genomic DNA, mrna, CDS와의 관계> 사람의 유전자는 exon과 intron으로 구성되어 있다. 첫 exon 앞에는 이 유전자의 발현을 조절해주는 promoter가 존재합니다. 9

10 10

11 The Universal Genetic Code 11

12 12

13 13

14 >>Polymerase Chain Reaction (PCR) PCR에는 다음과 같은 재료가 필요하다. 1.Template DNA : 증폭 대상이 되는 DNA. 2. 한쌍의primer : 증폭할 부분을 잡는 짧은 oligonucleotide 이다. 3. dntp(datp, dctp, dgtp, dttp) : 유전자를 합성하는 재료가 되는 nucleotide들이다. 4. Taq polymerase : 열에 특별히 강한 유전자 합성효소. 14

15 1. DNA 의변성(denaturation) 90 C - 96 C로 가열하여 double strand DNA(ds DNA)를 single strand DNA(ssDNA)로 분리시킨다. 높은 온도일수록 ssdna 로 잘 이행되지만 Taq DNA polymerase도 온도가 아주 높은 상태에서는 활성이 낮아질 수 있으므로 보통 94 C로 합니다. 첫 cycle에서는 확실한 변성을 위하여 약 5분간 지속시킵니다. 2. Primer 의결합(annealing) 50 C - 65 C에서 진행됩니다. 염기간의 결합은 G와 C는 세군데에서 수소결합이 일어나고, A와 T는 두군데에서 결합이 일어나므로 G+C 비율에 따라 결합온도에 변화를 주는 것이 좋습니다. 사실 primer 를 만드는 것도 이 annealing temperature를 고려하여 합성해야 합니다. 일반적으로 GC content 가 50%가되는primer 쌍을 이용하는 것이 바람직합니다. 3. DNA의합성(polymerization) 70 C - 74 C에서 시행하며 원하는 PCR 산물의 크기가 크거나 반응요소의 농도가 낮을 때에는 시간을 연장시킬 수도 있습니다. Taq DNA polymerase는보통1분에 2,000-4,000 nucleotides를 합성할 수 있으므로 원하는 PCR 산물의 크기 1 kb마다 1분 정도의 시간을 배당하면 충분히 반응이 일어납니다. 마지막 cycle 에는 약 10분정도시간을충분히주는것이좋겠습니다. 15

16 16

17 다음은 대표적인 PCR mixture의 예입니다. example of PCR mix DNA template 1 ul Primer, upstream(10 pmoles/ul) 1 ul Primer, downstream(10 pmoles/ul) 1 ul 2.5 mm dntp 4 ul 10x Taq buffer (+MgCl 2 ) 5 ul Taq DNA polymerase(1 u/ul) 1 ul water to 50 ul example of PCR cycle 94 C 5분 94 C 30초 -60 C 30초 -72 C 30초 (30 cycle) 72 C 5분 17

18 Primer의디자인 1) 관심있는 부분이 포함되어야 한다 주로 ORF 대개 단백질의 expression을 위해서는 ORF 전체가 필요하게 됩니다. 2) 증폭하려는 부위의 크기를 고려해야 한다 bp 3) GC content와 primer length 4) 이상한 염기서열은 피하라 예, primer가 GGGGCCCCGGTTTTAATTAA경우. 5) 합성될 때의 사정을 고려하라 이것도 조금 어려운 내용이지만, primer에 포함되지는 않았어도 증폭되는 부위에 너무 GC content가 높다거나 다른 secondary structure를 형성할 수 있는 부위가 있으면 잘 안될 것입니다 18

19 19

20 20

21 21

22 RT-PCR의반응 cdna 를 만드는 반응의 예 Total RNA 1-5 ug Random hexamer or nonamer (100 ng/ul) 1 ul 10x reverse transcriptase buffer 2 ul 10 mm DTT 4 ul 10 mm dntp 1 ul Reverse transcriptase (250 units/ul) 1 ul (Mn 2+ 에서는 역전사 효소 기능이 유지되며 Mn 2+ 를 chelate시키고 MgCl 2+ 를 처리하면 DNA Polymerase 활성을 모두 가진다. water to 20 ul 70 C 10분 RNA denaturation 42 C 1시간 Reverse transcriptase reaction 80 C 15분 Enzyme killing 22

23 >>RNA의분리 1) RNase로부터 RNA를 보호한다 주위 환경의 RNase contamination 방지하기 위해서 시약에 DEPC라는 RNase inhibitor를처리. 용기는 대개 1회용을 쓰고, 어쩔수없는경우autoclave, baking 등을 이용한다. 2) 단백질을 제거한다 Phenol/Chloroform을 처리하거나 ultracentrifuge 등여러방법. 3) DNA로부터 선택적으로 RNA를 분리한다. 23

24 24

25 25

26 26

27 27

28 Spectrophotometry 28

29 >>PCR 산물의 전기영동 (electrophoresis). 29

30 Commonly used electrophoresis buffers Buffer Concentrated stock solution (per liter) Tris-acetate (TAE) 50x 242 g Tris base 57.1 ml glacial acetic acid 100 ml 0.5 M EDTA (ph 8.0) Generally used for agarose EP Tris-borate (TBE) 20x g Tris base 61.7 g boric acid 7.44 g Na2EDTA-2H2O Generally used for DNA sequencing 30

31 Gel loading buffers (6x) I 0.25% bromophenol blue 0.25% xylene cyanol FF 40%(w/v) sucrose in water II 0.25% bromophenol blue 0.25% xylene cyanol FF 15% Ficoll(Type 400) in water III 0.25% bromophenol blue 0.25% xylene cyanol FF 30% glycerol in water IV 0.25% bromophenol blue 40%(w/v) sucrose in water 31

32 32

33 33

34 34

35 35

36 36

37 37

38 >>Gene cloning의 2단계 얻은 유전자를 vector에 삽입한다 38

39 Vector의기능 1) 세포 내에서 자가복제(self-replication) 을 합니다 Vector로쓰는DNA들은 세포 내에서 자가복제를 한다. 박테리아 세포 내에는 박테리아가 고유하게 가지고 있는 chromosomal DNA가있다. 한 세포당 하나 존재. Vector는 한 세포 내에서도 스스로 복제하여 수많은 copy가존재할수있다. 이런 성질을 실험에 이용한다. 2) 항생제를 이용한 선택(selection) 이 가능하다. Vector에 존재하는 항생제 내성 유전자를 이용하면 DNA가 세포 내로 주입되었는지 아닌지를 판별할 수 있다. Gene cloning에서는 내가 원하는 유전자가 세포 속으로 들어갔는지가 중요하기 때문에 이런 기능은 필수적이라고 할 수 있다. 이렇게 해서 세포 속으로 DNA가 들어간 세포만을 선별하는 것을 selection이라고 한다. 3) Multiple cloning site(mcs)를 이용할 수 있게 해 준다. 실험실에서 사용하는 vector는 일정부위에 제한효소 절단부위가 밀집된 부분이 있어서 cloning에 용이하다. 때로는 이 부분을 이용하여 자신이 원하는 construct를 자유자재로 만들 수도 있다. Multiple cloning site가없는vector는 이용 가치가 거의 없다. 4) Vector 부위를 이용한 DNA sequencing, 단백질발현등을할수있게해준다. 내가 원하는 유전자를 삽입하고 나면 여러 가지 실험이 용이 해진다. Vector에 존재하는 염기서열을 이용한 DNA sequencing을하기도편하고, vector에달린여러부분을이용하여단백질발현을할수도있다. 39

40 Vector의종류 Vector의 종류에는 plasmid, bacteriophage, cosmid, phagemid 등여러가지가 있다. 그 중 가장 널리 쓰이는 것은 plasmid 이다. Plasmid는 self-replicatable, extrachromosomal, double stranded, small circular DNA이다. 40

41 The lambda phage which infects E. coli demonstrates the cycles of a temperate phage. 41

42 42

43 >>DNA ligation과 restriction enzyme Recombinant DNA 43

44 제한효소(restriction enzyme) 44

45 Restriction enzyme type II 제한효소에는 type I, II, III가 있으며 실험실에서는 주로 type II를사용한다. 1) 이름은 발견된 세균, serotype, 발견 순서로 명명한다. 예) Hinf III : H emophilus influenza type f, 세번째(III) 효소 2) 인식부위와 절단부위가 같고 특이적(specific)`이다. 3) Palindrome을주로인식한다. 4) 절단 후 모양은 세가지가 가능하다. 5'-overhang cohesive (sticky) end. 3'-overhang cohesive (sticky) end. Blunt end. 45

46 46

47 47

48 48

49 PCR product의모습은다른blunt end DNA와는 다른다음과같은특징. 1) Primer의 5'쪽에는 phosphate가 없다. 2) Taq DNA polymerase는합성이끝난후3' 끝에 A를하나더붙인다. 49

50 50

51 51

52 >>Gene cloning의 3단계 - 유전자가 삽입된 DNA를 세포 내 로 주입한다 52

53 <Transformation의개념> Transformation(형질전환)이란 DNA를 bacteria 세포 내로 주입하는 과정을 말한다. Prokaryote와 eukaryote에서는 DNA를 세포 내로 주입할 때 다음과 같이 조금 다른 용어를 사용한다. 이 실험에서는 prokaryote인 E.coli를 사용하므로 'transformation'을하는것이다. Cell DNA Term Prokaryote Plasmid Transformation Bacteriophage (virus) Infection Eukaryote Plasmid Transfection Virus vector Transfection 53

54 <Transformation 방법> Chemical method - Calcium phosphate를이용한방법 -Liposome을이용한방법 Physical method - Electroporation - Microinjection Virus를이용한방법 - Retrovirus - Adeno or adenoassociate virus 54

55 <Competent cell 이란?> Competent cell이란 정상적인 bacteria에 화학적 처리를 하여 DNA가잘들어갈수있게만든cell을 의미합니다. 화학처리에 쓰이는 시약은 다음과 같이 여러가지가 있으며이중가장중요한것은calcium chloride입니다. 1. Calcium Chloride 2. Manganase Chloride 3. Hexamminecobalt Chloride 4. Dimethyl Sulfoxide (DMSO) 55

56 56

57 <Transformation 과정 > 57

58 1) Replication origin 2) Antibiotics resistance gene 3) Multiple cloning site(mcs)와 LacZ' 58

59 59

60 60

61 61

62 (1) IPTG (Isopropyl-B-D-1-Thiogalactoside)는 LacZ gene inducer역할을 합니다. Lactose 대신 inhibitor와 결합하지만 분해되지 않습니다. (2) X-Gal (5-bromo-4-chloro-3-indolyl-D-galactopyranoside)은 lactose 대신 beta-galactosidase에 의하여 대사되는 물질입니다. 일종의 변형된 galactose sugar로서 원래 무색이지만 beta-galactosidase에 의하여 대사되면 푸른색을 나타낸다. 62

63 63

64 64

65 65

66 66

67 >>Gene cloning의 4단계 올바른 clone을 선택한다 1) 우선 PCR product가 순수한 것이 아닙니다 67

68 Plasmid 분리 방법-Alkali lysis method 68

69 69

70 <Plasmid 분리에 사용하는 시약 > Solution I 50 mm glucose 25 mm Tris-Cl, ph mm EDTA Solution II 0.2 N NaOH 1% SDS (sodium dodecyl sulfate) Solution III 5 M potassium acetate, glacial acetic acid 70

71 <Plasmid 분리에 사용하는 시약 > Solution I 50 mm glucose 25 mm Tris-Cl, ph mm EDTA EDTA는 세포벽의 integrity를 유지하는 데 필수적인 calcium ion을 제거하여 세포벽이 군데군데 무너지게 한다. 이때 glucose는 삼투압을 유지시켜 세포의 외형을 유지시켜 줍니다. 뒤에서 설명하겠지만, 이 과정에서 실험상 vortex를 해야 하는데 이때 세포가 완전히 깨지게 되면 chromosomal DNA가 잘게 깨지게 되어 plasmid DNA와 구분할 수 없게 됩 니다. 따라서 이렇게 세포를 유지시켜가면서 세포벽만 깨는 것입니다. 71

72 Solution II 0.2 N NaOH 1% SDS (sodium dodecyl sulfate) SDS는 ionic detergent로세포막을깨는일을합니다. NaOH는 DNA를 denaturation시킨다. Chromosomal DNA가잘게부서지지않게조심스럽 게처리. Solution III 5 M potassium acetate, glacial acetic acid Renature시키는 산성용액입니다. 이렇게 해서 Chromosomal DNA는 SDS와 potassium과함께엉김. 72

73 73

74 DNA는 적당한 salt 농도와 적당한 alcohol 농도 하에서 침전. DNA 침전에 쓰이는 조건들은 다음과 같다. 1. Ethanol : 2 ~ 2.5 volume final 0.3 M sodium acetate, ph 5.2 : commonly used final 0.2 M sodium chloride DNA containing SDS final 2 M ammonium acetate triphosphate removal inhibits T4 polynucleotide kinase and TdT final 0.8 M lithium chloride RNA precipitation, very soluble in ethanol inhibits reverse transcription 2. Isopropyl alcohol : equal volume 74

75 DNA, RNA, Protein pellet TE buffer + RNase A 첨가 75

76 Phenol + Chloroform처리 수용성 상층액만을 분리 (위의 수용성층에 DNA 포함) 76

77 Sodium acetate와 Ethanol 첨가 TE buffer 에 DNA pellet 녹임 77

78 78

79 Restriction enzyme mapping (제한효소 지도) 79

80 반응조건 Plasmid DNA 1 ug 10x buffer 2 ul EcoRI 5 unit HindIII 5 unit water to 20 ul, 37 C, 1시간 80

81 81

82 DNA sequencing 82

83 83

84 84

85 85

86 86

87 87

88 <DNA sequencing gel> DNA sequencing gel은 다음과 같이 준비. Urea, acrylamide 용액, TBE, 증류수를 섞어 잘 녹인 다음 여과지로 한 번 거르면 된다. Gel cast를 모두 준비한 다음에 ammonium persulfate와 TEMED를 넣으면 굳기 시작한다. DNA sequencing gel은 한base 차이를 구분 하고 해상도를 높이면서 denaturing 상태를 유지하기 위한 다음과 같은 특성이 있다. 7 M Urea, 8% Acrylamide, TBE buffer Denaturing polyacrylamide gel electrophoresis(page) Long distance(40 cm) and thin(0.35 mm) High voltage electrophoresis(2,000 volts) Urea, formamide, formaldehyde와 같은 시약은 DNA의 Tm 값을 낮추는 시약들. 이 시약들이 들어간 상태에서 2,000 volts 의 전기영동을 하게 되면 gel이 약55 C 정도로 heating되면서 DNA 가 denaturation 상태로 내려간다. 88

89 <Sequencing Gel Mix > Urea 42 g 40% (38:2) Acrylamide : bisacrylamide 20 ml 20x TBE 5 ml Water to 100 ml 30% Ammonium persulfate 260 ul TEMED 75 ul 89

90 90

91 91

92 92

93 93

94 94

95 95

96 96

97 97

98 98

99 Cellular differentiation: The structural and functional divergence of cells as they become specialized during a multicellular organism s development; dependant on the controlof gene expression. <-> Dedifferentiation(탈분화) 99

01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6

01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview

More information

cdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR

cdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR RT-PCR 법 II. 역전사효소반응 ( 주 ) 다인바이오연구소 현재분자생물학분야에서 RNA 수준의 gene expression ( 유전자발현 ) 과 cdna (complementary DNA) cloning에널리이용되고있는 RT-PCR (Reverse transcription ploymerase chain reaction) 은생명정보가 DNA에서 RNA로전달된다는분자생물학분야의

More information

Cloning

Cloning Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군

More information

슬라이드 1

슬라이드 1 EVENT 퀴아젠인기상품연말특별가전 200203 Top Taq DNA Polymerase (250U) 90,000 72,000 200205 Top Taq DNA Polymerase (1000U) 331,000 281,350 200403 Top Taq Master Mix Kit(250U) 104,000 83,200 201203 Taq DNA Polymerase

More information

Automated high multiplex qPCR platform for simultaneous detection and quantification of multiple nucleic acid targets

Automated high multiplex qPCR platform for simultaneous detection and quantification of multiple nucleic acid targets PCR FlashGel System 2013. 04. 24 PCR 2013. 04. 24 순서 1. PCR 이란 2. PCR 실험의기본조건 3. PCR 효소선택가이드 4. Hot Start PCR의원리 5. PCR 실험시 Troubleshooting 6. PCR 장비 _TP350 소개 PCR(Polymerase Chain Reaction) PCR 이란? -

More information

Microsoft PowerPoint - 12-전기영동.pptx

Microsoft PowerPoint - 12-전기영동.pptx 전기영동 실험목적 기본적인분자실험장비인피펫, 저울, 원심분리 기, vortex mixer 사용법숙지 전기영동과정을통해서 DNA 크기비교 여러가지피펫종류들 Basic type P2 white tip P10 white tip P20 yellow tip P100 yellow tip P200 yellow tip P1000 blue tip Multi-channel pipette

More information

PowerPoint Presentation

PowerPoint Presentation Interchapeter B : 핵산생물공학기술 (part A) Recombinant DNA techniques - 전기영동 - 제한효소 - 클로닝 - 대장균을이용한단백질대량생산 Agarose mesh DNA 분리기술 : Agarose Gel Electrophoresis ( 수평형 ) _ + DNA is negatively charged from the phosphate

More information

Cloning=Clontech In-Fusion Cloning

Cloning=Clontech  In-Fusion Cloning Cloning 을위한모든것 2014-06-18 다카라코리아바이오메디칼 Contents Cloning Restriction Enzyme General Restriction Enzyme QuickCut Restriction Enzyme Cloning Restriction Enzyme/Ligation TA Cloning In-Fusion Cloning TaKaRa

More information

Microsoft PowerPoint - d ppt [호환 모드]

Microsoft PowerPoint - d ppt [호환 모드] 전기영동 ( SDS-PAGE ) 개 요 전기영동과그목적 실험전준비 실험과정 실험결과및분석 전기영동과그목적 전기영동 단백질의순도나성질의분석및분리등에사용하는방법 -> 단백질의정성적인분석 SDS-PAGE ( Sodium Dodecyl Sulphate Polyacrylamide Gel Electrophoresis ) : SDS 와 Polyacrylamide 를사용한전기영동전기영동의목적

More information

mau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions

More information

Microsoft Word - Genolution RNAi Manual.doc

Microsoft Word - Genolution RNAi Manual.doc 1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000

More information

SMARTer 시리즈

SMARTer 시리즈 SMARTer 시리즈 SMARTer Solutions 2014.12.17 다카라코리아바이오메디칼 SMART 하게실험하고 SMARTer 한결과를얻는방법 Clontech SMARTer 시리즈 Contents 1. Introduction 1. 역전사반응이란? 2. 기존역전사반응의한계 2. SMARTer 시리즈 1. SMARTer 란? 2. SMARTer 시리즈와적용

More information

뉴스지14호-칼라

뉴스지14호-칼라 2 3 4 5 6 TaKaRa Taq TM / TaKaRa Ex Taq TM / TaKaRa LA Taq TM / Pyrobest TM DNA Polymerase/ TaKaRa Z -Taq TM TaKaRa Taq TM TaKaRa Ex Taq TM TaKaRa LA Taq TM TaKaRa Z-Taq TM Pyrobest TM DNA Polymerase 7

More information

Chapter 6. Nucleotides and Nucleic Acids 세포대사에서뉴클레오타이드 (nucleotide) 의기능은무엇인가? Objective 유전체학 (genomics) 과단백체학 (proteomics) 기본개념이해 재조합 DNA 기술 (recombin

Chapter 6. Nucleotides and Nucleic Acids 세포대사에서뉴클레오타이드 (nucleotide) 의기능은무엇인가? Objective 유전체학 (genomics) 과단백체학 (proteomics) 기본개념이해 재조합 DNA 기술 (recombin Chapter 6. Nucleotides and Nucleic Acids 세포대사에서뉴클레오타이드 (nucleotide) 의기능은무엇인가? Objective 유전체학 (genomics) 과단백체학 (proteomics) 기본개념이해 재조합 DNA 기술 (recombinant DNA technology) 란? - 효소의보조인자, 대사중간산물구성성분, 유전정보함유등

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Mass-production of Four Specific Proteins Originated from Deformed Wing Virus, Honeybee-viral Pathogen Joo-seong Lee, Giang Thi Huong Luong and Byoung-Su Yoon* Department of Life Science, College of Natural

More information

Week01-workshop.hwp

Week01-workshop.hwp Polymerase Chain Reaction 과반응산물의정제 김상태서울대학교천연물과학연구소 adanson@plaza.snu.ac.kr A. Polymerase Chain Reaction Polymerase chain reaction (PCR) 은 genome 상의특정 DNA 염기서열을 denaturation, primer annealing, DNA polymerase에의한

More information

프로메가 2018 여름이벤트 BIG SALE 행사기간 2018년 8월 06일 ~ 9월 14일 *본 행사지에 표기된 금액은 부가세 별도 금액입니다. *단가 계약 및 입찰은 행사에서 제외됩니다.

프로메가 2018 여름이벤트 BIG SALE 행사기간 2018년 8월 06일 ~ 9월 14일 *본 행사지에 표기된 금액은 부가세 별도 금액입니다. *단가 계약 및 입찰은 행사에서 제외됩니다. 프로메가 2018 여름이벤트 BIG SALE 행사기간 2018년 8월 06일 ~ 9월 14일 *본 행사지에 표기된 금액은 부가세 별도 금액입니다. *단가 계약 및 입찰은 행사에서 제외됩니다. EtBr 을아직사용하신다면? 일회용 Gel extractor 를사용해보세요! 내몸은소중하니깐 ~~~ 15ul minimum elution 이가능합니다!! 프로메가 Steady

More information

Slide 1

Slide 1 PrimeScript 1st strand cdna Synthesis Kit 1 Central Dogma replication transcription 0 processing translation 오늘의내용은? 조직추출 RNAiso Plus 5 mrna 우리가관심있는 mrna가차지하는비율이극히일부이기때문에관심있는 mrna를증폭해서그것을눈으로확인할정도로만들어주는것이다.

More information

TOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme

TOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme PCR Enzyme 부터 qpcr 까지! PCR 실험은 TOYOBO 로해결하세요! 행사기간 : 7 월 15 일 ~ 9 월 13 일까지 TOYOBO Reagent PCR Enzyme High Quality PCR Enzyme cdna Synthesis Kit qpcr One-step RT Kit Immunoreaction Enhancer Solution 추가

More information

Chapter 4. Bacteria (the first microbes)

Chapter 4. Bacteria (the first microbes) - DNA 정제후클로닝을위한효소적절단과연결필요 -> restriction enzyme, ligase 가중요 1. DNA 조작효소범위 - 촉매반응에따라 5 분류 1. Nuclease : 핵산분자의절단, 단편화 2. Ligase : 핵산분자의연결 3. Polymerase : DNA 사슬합성 4. Modifying enzyme : 화학기능기의첨가, 제거 5. Topoisomerase

More information

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를 Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는

More information

SMARTer Sequencing Kits for Next Generation Sequencing

SMARTer Sequencing Kits for Next Generation Sequencing Simple, Fast, Powerful SMARTer Solution for NGS 다카라코리아바이오메디칼 1 페이지 표지분석 NGS Library 제작시의어려움을, SMARTer 기술로극복! FFPE Sample 과같은 Low input, degraded RNA 로부터 Sequencing 을가능하게! Single Cell sample 로부터 Library

More information

실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양

실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양 실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양의시료를대량으로증폭할수있다는장점과그과정이간단하여 Cloning, Sequencing 등의기본기술로응용되었다.

More information

슬라이드 1

슬라이드 1 TAKARA 1. PCR 2. qpcr 2014. 02. 13. 최유미 DNA? DNA 생물체 > 기관 > 세포 >DNA DNA (Deoxyribonucleic acid) 세포내에서생물의유젂정보를보관하는물질 구성 : Adenine, Thymine, Cytosine, Guanine 종특이적, 개체특이적 PCR (Polymerase Chain Reaction)

More information

슬라이드 1

슬라이드 1 Real Time PCR 목차 1. PCR 및 Real Rime PCR 원리 2. Real Time PCR 검출방법 3. Real Time PCR 정량방법 4. Takara Real Time PCR 시약 5. 금일실험내용 Polymerase Chain Reaction Taq DNA Polymerase - Thermostable DNA polymease from

More information

EZ-Cloning kit

EZ-Cloning kit EZ TM 5 /3 RACE PCR Kit Instruction Manual Korean Ver. Kit for 10 reactions Cat.# EZ025 EZ TM 5 /3 RACE PCR Kit Table of Contents I. 제품설명... 3 II. 원리... 4 III. 제품구성... 7 IV. 염기서열정보... 8 V. 주의사항... 8 VI.

More information

항체 포털 서비스 Preparation Peptide 총 4주 소요 / 473,000 ~ 511,000 Free of charge 2~3 days 243,000 ~ 281,000 의뢰서 작성 Peptide epitope prediction 유전자 정보

항체 포털 서비스 Preparation Peptide 총 4주 소요 / 473,000 ~ 511,000 Free of charge 2~3 days 243,000 ~ 281,000 의뢰서 작성 Peptide epitope prediction 유전자 정보 Preparation Service AbFrontier Custom service 장점 실험 담당자와의 원활한 1:1 커뮤니케이션 (신속한 feedback을 통한 맞춤형 제작 서비스) 고객연구센터 - 개별 서비스의 진행 상황 및 결과 즉시 확인 http://center.abfrontier.com (e-mail & SMS 전송) 회원제 -연구자의 프로젝트 보안

More information

01 Cloning AccuRapid Cloning Kit NEW 3 Gene Cloning Service 4 AccuPower Ligation PreMix 6 T4 DNA Ligase 7 Thermostable Thermus filiformis (Tfi) DNA Li

01 Cloning AccuRapid Cloning Kit NEW 3 Gene Cloning Service 4 AccuPower Ligation PreMix 6 T4 DNA Ligase 7 Thermostable Thermus filiformis (Tfi) DNA Li Cloning DNA Amplification DNA Preparation Cloning (Cloning Kit & Gene Cloning Service) Phone: 042-930-8793 Email: genesynthesis-support@bioneer.co.kr Cloning (Ligase) Phone: 1588-9788 (ext.4->2) DNA Amplification

More information

슬라이드 1

슬라이드 1 LC-MS 단백질분석을위한 SDS-PAGE staining protocol 및주의할점 Proteomics Core Facility 2017.12.28 Contents LC-MS 분석의뢰용 protein SDS-PAGE staining 시주의할점 Coomassie Blue R-250 을이용한 gel staining (general protocol) Coomassie

More information

Chapter 14 유전정보 (Genetic Information) A + G = C + T 일정 ( 샤가프룰 ] - Watson & Crick(1953년 ) : double helix model of DNA( 이중나선구조 ) 제시 1. 유전정보의전달경로 DNA 상의정

Chapter 14 유전정보 (Genetic Information) A + G = C + T 일정 ( 샤가프룰 ] - Watson & Crick(1953년 ) : double helix model of DNA( 이중나선구조 ) 제시 1. 유전정보의전달경로 DNA 상의정 Chapter 14 유전정보 (Genetic Information) A + G = C + T 일정 ( 샤가프룰 ] - Watson & Crick(1953년 ) : double helix model of DNA( 이중나선구조 ) 제시 1. 유전정보의전달경로 DNA 상의정보를 RNA로옮겨주는과정 ex) retrovirus 2. DNA Replication ( 유전자복제

More information

1

1 β β Tm = 81.5 + 16.6 (log10[na+]) + 0.41 (%G+C) 675/n [Na+] monovalent cations ( [Na+] = [K+] ) n =primer base Tm = 81.5 + 16.6 (log10[0.05]) + 0.41 (60) 675/22 = 81.5 + 16.6 ( 1.30) + 24.60

More information

3월 온라인 교육

3월 온라인 교육 2013 년 2 분기대리점집체교육 - Protein - Takara Korea Biomedical Protein Workflow Chapter 1: 샘플준비 Chapter 2: Electrophoresis -Precast gel (Lonza/NuSep) -ProSieve EX running buffer -Protein marker Chapter 3: Staining

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun

More information

고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn

고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna

More information

DNA/RNA Amplification Overview AccuPower PreMix series 는세계적으로기술력을인정받은특허기술로보다경제적인가격과편리한방법으로실험할수있는제품입니다. Conventional PCR, Real-Time PCR 수행을위한 DNA ampli

DNA/RNA Amplification Overview AccuPower PreMix series 는세계적으로기술력을인정받은특허기술로보다경제적인가격과편리한방법으로실험할수있는제품입니다. Conventional PCR, Real-Time PCR 수행을위한 DNA ampli DNA Amplification RNA Amplification Real-Time PCR Customized PCR DNA/RNA Amplification Phone: 1588-9788 (ext.4->2) Email: accupower-support @bioneer.co.kr DNA/RNA Amplification Overview AccuPower PreMix

More information

에이4도-1~16.qxd

에이4도-1~16.qxd TaKaRa Catalog 2011/2012 Catalog 사용에대해서 / 총목차 Instrument PCR Real Time PCR cdna 합성 Cloning RNA DNA 추출 / 정제 각종효소 Primer Library RNA interference (RNAi) 유전자도입 Stem Cell 연구 Epigenetics 관련 전기영동관련제품 단백질발현 분석

More information

Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No ) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터

Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No ) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터 Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No. 50004) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터 (학술/제품문의) 02-2081 - 2510 www.takara.co.kr support@takara.co.kr

More information

슬라이드 1

슬라이드 1 DNA technology (DNA 조작기술 ) 유전자 cloning Cloning & Plasmid Joshua Ledergerg & Edward Tatum, 1946 두종류의다른유전자를가진대장균사이에유전자의재조합이일어나새로운대장균이만들어지는것을발견했다. 이원리를바탕으로 1970 년대에 DNA 재조합기술이발전하게되었다. 원핵생물에서 DNA 의이동방법 플라스미드를이용한

More information

Selection chart of Bioneer s cdna synthesis products Categories Application Product cdna Synthesis Kits One step RT-PCR Kits One step RT-qPCR Kits RTa

Selection chart of Bioneer s cdna synthesis products Categories Application Product cdna Synthesis Kits One step RT-PCR Kits One step RT-qPCR Kits RTa Selection chart of Bioneer s cdna synthesis products Categories Application Product cdna Synthesis Kits One step RT-PCR Kits One step RT-qPCR Kits RTase 표준 cdna 합성 높은효율의 cdna 합성 복잡한 2 차구조 RNA 의 cdna 합성

More information

1 1 10-0767050 2 10-1166045 3 10-0895586 4- - 10 4 10-1616887 11 5 10-1358259 12 6 10-0775080 7 10-0973839 8 10-1165269 15 9 10-1056952 16 10 10-1551559 11 10-1179175 12 10-1179177 19 13 10-1136822 20

More information

05052유식안101.hwp

05052유식안101.hwp 제 출 문 식품의약품안전청장 귀 하 이 보고서를 유전자재조합식품 모니터링(부산광역시보건환경연구원/정구영) 과제의 연구 결과보고서로 제출합니다. 2005. 11. 30 주관연구기관명 : 부산광역시보건환경연구원 주관연구책임자 : 정구영 목 차 Ⅰ. 연구개발결과 요약문----------------------------------- 1 (한글)------------------------------------------

More information

ITEM 1 PCR Enzyme 20% DNA Polymerase Enzyme Quick Selection Guide for Effective PCR DNA Polymerase General PCR / Colony PCR Long PCR (Max. 23 kb) Hot

ITEM 1 PCR Enzyme 20% DNA Polymerase Enzyme Quick Selection Guide for Effective PCR DNA Polymerase General PCR / Colony PCR Long PCR (Max. 23 kb) Hot 2017 Summer BIG SALE 2017.7.3 ~ 9.8 ITEM 1 P C R Enzyme cpcr Enzyme 20% High Quality Enzyme ITEM 2 cdna Synthesis cdna Synthesis Kit 최대 33 % off ITEM 3 q P C R Enzyme Two-Step / One-Step Kit NGS Library

More information

슬라이드 1

슬라이드 1 식물생명공학유전자분석의 Tool Lab of Plant Resources & Biotechnology 조준형교수 Dept. of Biological & Environmental Science 상영바이오관 4 층 403 생물의기본단위인세포는다양한종류의 biomolecule 로이루어져있다. 식물세포의경우아래물질로구성. 세포벽 : 다당류셀룰로스등세포막 ( 세포소기관막

More information

System Biology Core

System Biology Core System Biology Core 연세의생명연구원연구지원부 _ 연세유전체센터 The RNAi Consortium (TRC) shrna 안내 Ⅰ. MISSION shrna 의설계 MIT 와 Harvard 의 Broad Institute 의 The RNAi Consortium (TRC) 에서설계하고개발한 MISSION shrna clones 는 21 base

More information

1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus

More information

Surpass the limit of Polymerase Chain Reaction (PCR) PCR Enzyme Guide High Fidelity PCR 효소 범용적인 PCR 효소 특수목적을위한 PCR 효소 - Epigenetics - Multiplex PCR -

Surpass the limit of Polymerase Chain Reaction (PCR) PCR Enzyme Guide High Fidelity PCR 효소 범용적인 PCR 효소 특수목적을위한 PCR 효소 - Epigenetics - Multiplex PCR - Surpass the limit of Polymerase Chain Reaction (PCR) PCR Enzyme Guide High Fidelity PCR 효소 범용적인 PCR 효소 특수목적을위한 PCR 효소 - Epigenetics - Multiplex PCR - Direct PCR High Fidelity PCR 효소 - NGS targeted sequencing,

More information

DNA Polymerase Enzyme Quick Selection Guide for Effective PCR DNA Polymerase High Quality Polymerase General PCR / Colony PCR High Fidelity PCR (80-fo

DNA Polymerase Enzyme Quick Selection Guide for Effective PCR DNA Polymerase High Quality Polymerase General PCR / Colony PCR High Fidelity PCR (80-fo 2018 TOYOBO BIG SALE 기간 : 2018년 7월 16일 ~ 9월 21일까지 TOYOBO 전제품 최대 33% SALE PCR Enzyme cpcr Enzyme cdna Synthesis cdna Synthesis Kit qpcr Enzyme One-Step / Two-Step Kit Immuno Enhancer High Quality Enzyme

More information

α α α α α

α α α α α α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를

More information

김도희_HT protein expression 표준 보고서_v1.5

김도희_HT protein expression 표준 보고서_v1.5 Production of Recombinant Proteins For Further Information, Please Contact Neurogenex Co., Ltd. Biotechnology Incubating Center "Golden Helix" Seoul Natl' Univ. Seoul 151-744, Korea TEL 82-2-875-8998 FAX

More information

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF. 1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -

More information

Chapter 11

Chapter 11 Chapter 15 RNA Polymerase II: Basal Transcription 1 Eukaryotic and bacterial RNA polymerases differ in some aspects 1. eukaryotes have three RNA polymerases, with one each specifically dedicated to rrna,

More information

PowerPoint 프레젠테이션

PowerPoint 프레젠테이션 mrna (messenger RNA) : 양이가장적다 ( 전체 RNA 중 5-10% 이하 ) : mrna의염기서열은단백질의아미노산순서를지정 : 성장하는세포는수많은다른단백질을필요로함으로 mrna가만들어져단백질이합성되게한후 nucleotide가재생될수있도록분해된다 (trna, rrna도재생 ) : 5 말단의끝이 7-methyl guanosine triphosphate

More information

2019 TOYOBO BIG SALE 기간 : 2019년 7월 1일 ~ 9월 11일까지 최대 33% SALE qpcr Enzyme PCR Enzyme 20% 2+1 cpcr Enzyme cdna Synthesis 2+1 cdna Synthesis kit High Qua

2019 TOYOBO BIG SALE 기간 : 2019년 7월 1일 ~ 9월 11일까지 최대 33% SALE qpcr Enzyme PCR Enzyme 20% 2+1 cpcr Enzyme cdna Synthesis 2+1 cdna Synthesis kit High Qua 2019 TOYOBO BIG SALE 기간 : 2019년 7월 1일 ~ 9월 11일까지 최대 33% SALE qpcr Enzyme PCR Enzyme cpcr Enzyme cdna Synthesis cdna Synthesis kit High Quality Enzyme Immuno Enhancer Cloning One-Step kit Can Get Signal

More information

,,,,,,,, (), BOD,,,,,,,,,

,,,,,,,, (), BOD,,,,,,,,, - 1 - ,,,,,,,, (), BOD,,,,,,,,, - 2 - - 3 - 3) 4) 5) 6) 7) - 4 - - 5 - (Analytical Spectrum) 1 Biosensors 2 Electro Analysis 3 Environmental 4 Drug Discovery 5 Food Quality and Safety 6 Gas and Liquid-phase

More information

PowerPoint 프레젠테이션

PowerPoint 프레젠테이션 Glutathione Excellose handbook - Purification of GST fusion proteins - Looking for more detail Purification protocol? - Glutathione Excellose Spin Kit - Glutathione MiniExcellose - Glutathione Excellose

More information

歯20010629-003-1-동아일보(2-1).PDF

歯20010629-003-1-동아일보(2-1).PDF 6. 29 ( ) 11:00 20 0 1. 6. 29 2 3 ( ).( 397-0781) 1. 2. 3. 4. 5. 1. ( : 2 ) 2 8607, 306 19, 7 6 28, 95 3 - (5 ) (,,,,,, ) - 1 - 2. -, - -, - 2 - 3.,, 1,700, 827 ( ) 1,700 8 27 803 469 560 227 289 117 48

More information

16-15(3)-07(최장경).fm

16-15(3)-07(최장경).fm Res. Plant Dis. 15(3) : 254-258 (2009) Research in Plant Disease The Korean Society of Plant Pathology t (Lagenaria leucantha var. gourda) w IB m Cucumber mosaic virus Áy 1 Á»x 1 Á t 2 Á * w w, 1 w y w,

More information

ReverTra Ace cdna Synthesis Kit d ReverTra Ace M-MLV RTase의 RNase H domain 부위에유전자조작을시켜, Rnase H activity를낮추어 mrna의 degradation을방지하여 cdna 합성효율을높임 Long

ReverTra Ace cdna Synthesis Kit d ReverTra Ace M-MLV RTase의 RNase H domain 부위에유전자조작을시켜, Rnase H activity를낮추어 mrna의 degradation을방지하여 cdna 합성효율을높임 Long 2016 TOYOBO SUMMER SALE 2016.7.4 ~ 9.9 cdna Synthesis Kit qpcr Master Mix KOD Polymerase Enzyme DNA Polymerase Enzyme Immuno Enhancer ReverTra Ace cdna Synthesis Kit d ReverTra Ace M-MLV RTase의 RNase H

More information

슬라이드 1

슬라이드 1 유전공학 DNA 변형과조작 유전자클로닝 제한효소 (Restriction enzyme) 와연결효소 (DNA ligase) 역전사효소, 벡터 DNA 증폭 중합효소연쇄반응 (PCR) DNA 분리및분석 젤전기영동법 (Gel electrophoresis) DNA footprinting (DNA 지문 ) DNA 염기서열분석 Sanger method DNA 재조합기술 (Recombinant

More information

DNA 와그역할 (DNA and Its Role in Heredity) 박영홍 인제대학교의과대학생화학교실 11.1 유전자가 DNA라는증거 11.2 DNA의구조 11.3 DNA 복제 11.4 DNA 손상 (error) 의복구 11.5 DNA 구조와

DNA 와그역할 (DNA and Its Role in Heredity) 박영홍 인제대학교의과대학생화학교실 11.1 유전자가 DNA라는증거 11.2 DNA의구조 11.3 DNA 복제 11.4 DNA 손상 (error) 의복구 11.5 DNA 구조와 DNA 와그역할 (DNA and Its Roe in Heredity) 2017. 05. 18 박영홍 인제대학교의과대학생화학교실 11.1 유전자가 DNA라는증거 11.2 DNA의구조 11.3 DNA 복제 11.4 DNA 손상 (error) 의복구 11.5 DNA 구조와복제지식의활용 1 11.1 유전자가 DNA 라는증거 1869 년 Miescher 의실험 : Nucein

More information

Chapter 26

Chapter 26 11 주 RNA 합성 11.1 DNA-dependent synthesis of RNA: Bacteria에서의 transcription l RNA polymerase (5 subunits로구성 : 2α, β, β, σ) l 효소에의한 RNA 합성의특징 - Complementary sequence to template DNA - RNA chain의합성방향 : 5

More information

01 Automated Protein Expression and Purification Using ExiProgen Selection Guide 267 ExiProgen EC Protein Synthesis Kit 268 ExiProgen EC-Maxi Protein

01 Automated Protein Expression and Purification Using ExiProgen Selection Guide 267 ExiProgen EC Protein Synthesis Kit 268 ExiProgen EC-Maxi Protein Automated Protein Expression and Purification Using ExiProgenTM Manual Protein Expression and Purification Preparation of Template DNA for Protein Expression Protein Service Protein Expression and Purification

More information

Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot

Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot EZ-LDH Cell Cytotoxicity Assay Kit Cat. No. DG-LDH500 DG-LDH1000 FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. 1 ( 주 ) 대일랩서비스부설두젠생명공학연구소 Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는

More information

<4E C6AFC2A120B1B8BCBA20BBE7BFEBB9E6B9FD20C1D6C0C7BBE7C7D72E687770>

<4E C6AFC2A120B1B8BCBA20BBE7BFEBB9E6B9FD20C1D6C0C7BBE7C7D72E687770> NA 100 R Multi-Functional Electrophoresis Device for Analysis of Nucleic Acid 2007 년산업자원부한국기술거래소의지원으로개발된 다기능일체형전기영동기기 NA 100 R 은 전기영동기능 UV transilluminator 기능암실기능 DNA purification 기능사진촬영기능을모두갖추었습니다. NA

More information

316 Research in Plant Disease Vol. 21 No. 4, (Seo, 2009). Enzyme-Linked Immuno Sorbent Assay(ELISA) Reverse Transcription- Polymerase Chain Reaction(R

316 Research in Plant Disease Vol. 21 No. 4, (Seo, 2009). Enzyme-Linked Immuno Sorbent Assay(ELISA) Reverse Transcription- Polymerase Chain Reaction(R 식물병연구 Research Article Open Access Res. Plant Dis. 21(4) : 315-320(2015) http://dx.doi.org/10.5423/rpd.2015.21.4.315 Reverse transcription Loop-mediated isothermal amplification Soybean mosaic virus Detection

More information

Introduction 신뢰성 있는 결과 높은 품질의 제품을 생산하기 위해서는 제품의 공정 시스템이 중요 품질관리실험실은 품질보증과정에서 매우 중요한 역할 분석시스템은 품질관리실험실의 매우 중요한 요소 분석시스템의 결과를 기본으로 하여 제품의 품질을 결정 R&D 실험실

Introduction 신뢰성 있는 결과 높은 품질의 제품을 생산하기 위해서는 제품의 공정 시스템이 중요 품질관리실험실은 품질보증과정에서 매우 중요한 역할 분석시스템은 품질관리실험실의 매우 중요한 요소 분석시스템의 결과를 기본으로 하여 제품의 품질을 결정 R&D 실험실 적정의 올바른 분석방법 Kopack Seminar May 2012 Agenda Introduction Risks and Measures Summary 1 1 Introduction 신뢰성 있는 결과 높은 품질의 제품을 생산하기 위해서는 제품의 공정 시스템이 중요 품질관리실험실은 품질보증과정에서 매우 중요한 역할 분석시스템은 품질관리실험실의 매우 중요한 요소

More information

Nuclease (핵산 분해 효소)

Nuclease (핵산 분해 효소) 7. Nuclease ( 핵산분해효소 ) Nuclease Nuclease 란? DNA 를중합하는 DNA polymerase 와는달리핵산을분해하는효소 Nuclease 의중요성 생체내에서는항상핵산을분해하는일이일어나고있으므로생명현상을공부한다는점에서중요 실제의분자생물학실험에서 polymerase 보다더자주쓰이고있기때문에중요 Nuclease Nuclease 를실험에이용할때염두해두어야할내용

More information

01 Automated Protein Expression and Purification: ExiProgen Selection Guide 3 Protein Synthesis Kit ExiProgen EC Protein Synthesis Kit 4 ExiProgen EC-

01 Automated Protein Expression and Purification: ExiProgen Selection Guide 3 Protein Synthesis Kit ExiProgen EC Protein Synthesis Kit 4 ExiProgen EC- Automated Protein Expression and Purification: ExiProgen TM Manual Protein Expression and Purification: AccuRapid TM & MagListo TM Preparation of Template DNA for Protein Expression Protein Service Protein

More information

l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related

More information

PowerPoint 프레젠테이션

PowerPoint 프레젠테이션 Product News Letter 4 호 User s Guide for Ligation Independent Cloning Inspect into "Overlap Cloner" Cloning 의일반적인방법 미래기술 Recombineering "Overlap Cloner" 의원리와응용분야 자주하는질문 Trouble Shooting 은단백질전문기술기업입니다기술혁신형중소기업입니다고객상담전화

More information

- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol

More information

Ver.4 (KR) All about RT (cdna Synthesis) 8-11 Munpyeongseo-ro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea) (Internatio

Ver.4 (KR) All about RT (cdna Synthesis) 8-11 Munpyeongseo-ro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea) (Internatio 20170619 Ver.4 (KR) All about RT (cdna Synthesis) 8-11 Munpyeongseo-ro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea)1588-9788 (International) +82-42 - 930-8777 Email: sales@bioneer.com Selection

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Original Article Journal of Apiculture 31(1) : 41~50 (2016) Rapid Detection of Black Queen Cell Virus from Honeybee using Reverse Transcription Real-Time Recombinase Polymerase Amplification (RT/RT RPA)

More information

sirna 실험은잘됐는데... 그러면이제유전자의기능을완전히억제하고싶은데... 1 화 : CRISPR 은손쉽다 CRISPR 에게맡겨봐! 내게염기서열만알려주면 knock out 을시켜버릴게! Gene editing( 게놈편집 ) 을이용하면특정유전자의기능을완전히 knock-

sirna 실험은잘됐는데... 그러면이제유전자의기능을완전히억제하고싶은데... 1 화 : CRISPR 은손쉽다 CRISPR 에게맡겨봐! 내게염기서열만알려주면 knock out 을시켜버릴게! Gene editing( 게놈편집 ) 을이용하면특정유전자의기능을완전히 knock- Cover title Subhead GeneArt CRISPR GeneArt Precision TALENs 게놈편집이펼치는과학원더랜드 만화로만나는게놈편집의원리 sirna 실험은잘됐는데... 그러면이제유전자의기능을완전히억제하고싶은데... 1 화 : CRISPR 은손쉽다 CRISPR 에게맡겨봐! 내게염기서열만알려주면 knock out 을시켜버릴게! Gene editing(

More information

A

A 2009 4 A270412 < 차례> 1 요약 1 2 심사경위 2 3 심사경과 2 4 심사방법 3 5 심사신청자료검토 3 51 심사신청된식품의개요 3 52 식품으로의적합성검토 3 53 유전자재조합체의안전성 3 가 유전자재조합체의개발목적및이용방법에관한자료 3 나 숙주에관한자료 4 (1) 분류학적특성( 일반명 학명 계통분류등) 4 (2) 재배및품종개량의역사 4

More information

Invitrogen GeneArt Platinum Cas9 Nuclease character design & illustration: ryuji nouguchi Invitrogen GeneArt Genomic Cleavage Detection Kit

Invitrogen GeneArt Platinum Cas9 Nuclease character design & illustration: ryuji nouguchi Invitrogen GeneArt Genomic Cleavage Detection Kit Invitrogen GeneArt Platinum Cas9 Nuclease character design & illustration: ryuji nouguchi Invitrogen GeneArt Genomic Cleavage Detection Kit 이봐, 난 CRISPR 인데 나를 한번 단백질 형태로 세포에 넣어볼래? 교수님께서 게놈 편집이 어려운 ips

More information

Microsoft PowerPoint - ch4note

Microsoft PowerPoint - ch4note 강의개요 Chapter 4 Reactions in Aqueous Solution ( 수용액중의반응 ) 농도의종류와계산 수용액중의반응 Pb(NO 3 (aq) + 2KI (aq) HCl (aq) + NaOH (aq) Alka-Selter/Water Cu wire/ag(no 3 ) (aq) 침전반응산 - 염기중화반응기체생성반응산화환원반응 용액 (Solution)

More information

Transcription ( 전사 ) and Translation ( 번역 )

Transcription ( 전사 ) and Translation ( 번역 ) Transcription ( 전사 ) and Translation ( 번역 ) Transcription of DNA into RNA Basics of Transcription Transcription of eukaryotes Role of cap: To sign this is mrna to the cell Poly A tail: long string of adenine:

More information

이 발명을 지원한 국가연구개발사업 과제고유번호 G1111700300320000000000000 부처명 한국환경산업기술원 연구사업명 토양지하수오염방지기술개발사업 연구과제명 시데로포아(Siderophore)의 대량생산을 통한 토양 및 지하수의 친환경 중금속 제거기술 개 발

이 발명을 지원한 국가연구개발사업 과제고유번호 G1111700300320000000000000 부처명 한국환경산업기술원 연구사업명 토양지하수오염방지기술개발사업 연구과제명 시데로포아(Siderophore)의 대량생산을 통한 토양 및 지하수의 친환경 중금속 제거기술 개 발 (19) 대한민국특허청(KR) (12) 공개특허공보(A) (11) 공개번호 10-2013-0029213 (43) 공개일자 2013년03월22일 (51) 국제특허분류(Int. Cl.) C12N 1/15 (2006.01) C12P 21/00 (2006.01) C12R 1/77 (2006.01) (21) 출원번호 10-2011-0092470 (22) 출원일자 2011년09월14일

More information

MHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State

More information

Subject : 귀사의 일익번창하심을 진심으로 기원합니다.

Subject : 귀사의 일익번창하심을 진심으로 기원합니다. 1. 18 D-303 Tel : () 031-711-1560 Fax : 031-711-1563 www.iontec.co.kr e-mail : ion@iontec.co.kr (organic reaction). (esterification) (hydrolysis of ester). Porous type (alkylation) system. ( gel type ).

More information

(KPU-300 \(TDS, \307\321\261\333\).hwp)

(KPU-300 \(TDS, \307\321\261\333\).hwp) 기 술 자 료 초속경 폴리우레아 수지 (POLYDO KPU-300A/B) 국도화학주식회사 http://www.kukdo.com polydo@kukdo.com Tel:02)3282-1566 Fax:02-3282-1588 초속경 폴리우레아 수지 1. 폴리우레아 스프레이 탄성체란 무엇인가? (1) 말단에 1 급 아민을 갖고 있는 폴리에테르와 이소시아네이트와의 반응생성물이다.

More information

뉴스레터6호F?2??訝

뉴스레터6호F?2??訝 February 2009 No.06 Roche Diagnostics Korea Co., Ltd. Focus Tech EDITORIAL February 2009 No.06 Contents Editorial 03 Focus 04 Product 10 Talk 12 Tech 14 Activity 19 Style 22 February 2009 No.06 02 03 FOCUS

More information

Western Blot Consumable Best Seller Protein Standards Dual Color All Blue Kaleidoscope TM Dual Xtra Prestained Ch

Western Blot Consumable Best Seller Protein Standards Dual Color All Blue Kaleidoscope TM Dual Xtra Prestained Ch 2018 년 4 월 16 일 ~ 6 월 15 일까지 2018 비엠에스할 인 행 사 AbD Serotec 이 Bio-Rad 와하나가되었습니다. 10,000 여종의 Primary Antibody 를검색해보세요! Western Blot 장비 & 시약 5+2 증정 Western Blot Consumable Best Seller - Protein Standards -

More information

21세기 바이오 혁명

21세기 바이오 혁명 1865, 1990, HGP 1953, & DNA 1977, & DNA 2001, 99% 1983, PCR 2003, How many genes in the human genome? cdna sequencing Genomic sequencing Structural Genomics What is the role of each gene? Tissue distribution

More information

슬라이드 1

슬라이드 1 Week 1. The Post-genome Era 1. Post-genome era ( 후게놈시대 ) - Genome project 의완성으로생명체의 DNA 정보가모두밝혀진시대 - 인간을비롯한수많은 organism 들의 genome project 가완성되어 post-genome era 에접어들게됨 Genome ( 유전체 ): The entire collection

More information

°íµî1´Ü¿ø

°íµî1´Ü¿ø 흔히 건강을 잃고 난 후에 건강의 중요성을 새삼 느끼는 사람들이 많다. 특 히 신체적으로 발육이 왕성한 청소년 시기에는 건강을 더 쉽게 잊고 지내기 쉽 다. 일상생활에서 적당한 영양 섭취, 운동과 휴식, 스트레스 관리를 하는 것은 건강의 잠재력을 키우는 활동이다. 청소년 시기에 건강의 의미를 되새겨 보고 긍정적이고 적극적인 건강 생활을 실천하여 보자. 01

More information

(72) 발명자 박용우 경상남도 진주시 이현동 이현웰가 114동 1503호 구본동 경기도 양주시 백석읍 방성리 78-5 - 2 -

(72) 발명자 박용우 경상남도 진주시 이현동 이현웰가 114동 1503호 구본동 경기도 양주시 백석읍 방성리 78-5 - 2 - (51) Int. Cl. (19) 대한민국특허청(KR) (12) 등록특허공보(B1) C12Q 1/68 (2006.01) (21) 출원번호 10-2008-0117508 (22) 출원일자 2008년11월25일 심사청구일자 2008년12월15일 (65) 공개번호 10-2010-0058919 (43) 공개일자 2010년06월04일 (56) 선행기술조사문헌 KR100619189

More information

특허청구의 범위 청구항 1 구제역이나 에이아이(AI) 감염에 의해 살 처분된 가축 매몰지의 붕괴나 침출수 유출에 의한 제2차 오염을 방 지하기 위한 방제방법에 있어서, 매몰지 내부에 고화제(Firming agent) 및 첨가물질이 주입되도록 통로를 형성하기 위한 천공단

특허청구의 범위 청구항 1 구제역이나 에이아이(AI) 감염에 의해 살 처분된 가축 매몰지의 붕괴나 침출수 유출에 의한 제2차 오염을 방 지하기 위한 방제방법에 있어서, 매몰지 내부에 고화제(Firming agent) 및 첨가물질이 주입되도록 통로를 형성하기 위한 천공단 (19) 대한민국특허청(KR) (12) 공개특허공보(A) (51) 국제특허분류(Int. Cl.) B09B 1/00 (2006.01) C09K 17/00 (2006.01) E02D 31/00 (2006.01) (21) 출원번호 10-2011-0016170 (22) 출원일자 2011년02월23일 심사청구일자 전체 청구항 수 : 총 9 항 2011년02월23일 (11)

More information

Title: Biacore getting started kit 를이용한 KD 값도출방법 목차 1. 실험목적 2. 실험개요와필요한시약및소모품 2.1 실험개요 2.2 필요한시약및소모품 3. 실험방법과결과 3.1 ph-scouting for pre-concentration

Title: Biacore getting started kit 를이용한 KD 값도출방법 목차 1. 실험목적 2. 실험개요와필요한시약및소모품 2.1 실험개요 2.2 필요한시약및소모품 3. 실험방법과결과 3.1 ph-scouting for pre-concentration Title: Biacore getting started kit 를이용한 KD 값도출방법 목차 1. 실험목적 2. 실험개요와필요한시약및소모품 2.1 실험개요 2.2 필요한시약및소모품 3. 실험방법과결과 3.1 ph-scouting for pre-concentration 3.2 Immobilization 3.3 Regeneration scouting 3.4 Interaction

More information

2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.

2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2. 2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.8.1. OIE 2012 ver. - EU ASF reference lab CISA-INIA(Spain)

More information

............

............ 제2장 1. 모월곶, 석곶, 서곶, 개건너 검단지역이 편입되기 전, 인천의 서구 전체는 지난날 서곶으로 불리던 지역이었다. 1914년 4월 1일 부평군 모월곶면과 석곶면을 통합되어 서곶 면이 되었다. 서곶이라는 지명은 군 소재지인 부평에서 서쪽 해안에 길 게 뻗어있으므로 그렇게 지어졌다. 이 지명은 반세기 이상 사용되었다. 그래서 인천시가 구제( 區 制 )를

More information

2월 강습회원의 수영장 이용기간은 매월 1일부터 말일까지로 한다.다만,월 자유수영회 원,자유수영 후 강습회원은 접수일 다음달 전일에 유효기간이 종료된다.<개정 2006.11. 20,2009.6.15> 제10조(회원증 재발급)1회원증을 교부받은 자가 분실,망실,훼손 및

2월 강습회원의 수영장 이용기간은 매월 1일부터 말일까지로 한다.다만,월 자유수영회 원,자유수영 후 강습회원은 접수일 다음달 전일에 유효기간이 종료된다.<개정 2006.11. 20,2009.6.15> 제10조(회원증 재발급)1회원증을 교부받은 자가 분실,망실,훼손 및 실 내 수 영 장 운 영 내 규 1999.6.1. 내규 제50호 개정 2001. 3.19 내규 제 82호 개정 2005.12.29 내규 제135호 2002. 3.25 내규 제 92호 2006.11.20 내규 제155호 2002. 8.28 내규 제 94호 2009. 6.15 내규 제194호 2005. 5.20 내규 제129호 2011.11.10 내규 제236호

More information

사진 24 _ 종루지 전경(서북에서) 사진 25 _ 종루지 남측기단(동에서) 사진 26 _ 종루지 북측기단(서에서) 사진 27 _ 종루지 1차 건물지 초석 적심석 사진 28 _ 종루지 중심 방형적심 유 사진 29 _ 종루지 동측 계단석 <경루지> 위 치 탑지의 남북중심

사진 24 _ 종루지 전경(서북에서) 사진 25 _ 종루지 남측기단(동에서) 사진 26 _ 종루지 북측기단(서에서) 사진 27 _ 종루지 1차 건물지 초석 적심석 사진 28 _ 종루지 중심 방형적심 유 사진 29 _ 종루지 동측 계단석 <경루지> 위 치 탑지의 남북중심 하 출 입 시 설 형태 및 특징 제2차 시기 : 건물 4면 중앙에 각각 1개소씩 존재 - 남, 서, 북면의 기단 중앙에서는 계단지의 흔적이 뚜렷이 나타났으며 전면과 측면의 중앙칸에 위치 - 동서 기단 중앙에서는 계단 유인 계단우석( 階 段 隅 石 ) 받침지대석이 발견 - 계단너비는 동측면에서 발견된 계단우석 지대석의 크기와 위치를 근거로 약 2.06m - 면석과

More information

노인복지법 시행규칙

노인복지법 시행규칙 노인복지법 시행규칙 [시행 2012.2.5] [보건복지부령 제106호, 2012.2.3, 타법개정] 제1조(목적) 이 규칙은 노인복지법 및 동법시행령에서 위임된 사항과 그 시행에 관하여 필요한 사항을 규정 함을 목적으로 한다. 제1조의2(노인실태조사) 1 노인복지법 (이하 "법"이라 한다) 제5조에 따른 노인실태조사의 내용은 다음 각

More information

2008.3.3> 1. 법 제34조제1항제3호에 따른 노인전문병원 2. 국민건강보험법 제40조제1항의 규정에 의한 요양기관(약국을 제외한다) 3. 삭제<2001.2.10> 4. 의료급여법 제2조제2호의 규정에 의한 의료급여기관 제9조 (건강진단) 영 제20조제1항의 규

2008.3.3> 1. 법 제34조제1항제3호에 따른 노인전문병원 2. 국민건강보험법 제40조제1항의 규정에 의한 요양기관(약국을 제외한다) 3. 삭제<2001.2.10> 4. 의료급여법 제2조제2호의 규정에 의한 의료급여기관 제9조 (건강진단) 영 제20조제1항의 규 노인복지법 시행규칙 [시행 2010. 3. 1] [보건복지가족부령 제161호, 2010. 2.24, 일 보건복지가족부 (노인정책과) 02-2023-85 제1조 (목적) 이 규칙은 노인복지법 및 동법시행령에서 위임된 사항과 그 시행에 관하여 필요한 함을 목적으로 한다. 제1조의2 (노인실태조사) 1 노인복지법 (이하 "법"이라 한다)

More information

Glutathione Excellose handbook - Purification of GST fusion proteins - Looking for more detail Purification protocol? - Glutathione Excellose Spin Kit

Glutathione Excellose handbook - Purification of GST fusion proteins - Looking for more detail Purification protocol? - Glutathione Excellose Spin Kit Glutathione Excellose handbook - Purification of GST fusion proteins - Looking for more detail Purification protocol? - Glutathione Excellose Spin Kit - Glutathione MiniExcellose - Glutathione Excellose

More information

기구명 ph meter volumetric flask Erlenmeyer flask mass cylinder 뷰렛비이커 pipet 저울스탠드 & 클램프 isotonicity 측정기 필요량 500ml짜리 1개, 50ml짜리 5개, 100ml짜리 1개, 250ml짜리 6개

기구명 ph meter volumetric flask Erlenmeyer flask mass cylinder 뷰렛비이커 pipet 저울스탠드 & 클램프 isotonicity 측정기 필요량 500ml짜리 1개, 50ml짜리 5개, 100ml짜리 1개, 250ml짜리 6개 7. 완충용액 Introduction 일반적으로약산과그짝염기또는약염기와그짝산의혼합물로이루어진용액은외부에서산이나염기를첨가하여도 ph가크게변하지않는다. 이처럼 ph의변화에저항하는용액을완충용액이라한다. 이번실험에서는완충용액을직접제조하여그성질을파악하고완충방정식및완충용액을구해보고자한다. 또한산-염기중화적정곡선을 ph로부터그려보고이로부터산의해리상수도구하여보고자한다. Materials

More information

2힉년미술

2힉년미술 제 회 Final Test 문항 수 배점 시간 개 00 점 분 다음 밑줄 친 부분의 금속 공예 가공 기법이 바르게 연결된 것은? 금, 은, 동, 알루미늄 등의 금속을 ᄀ불에 녹여 틀에 붓거나 금속판을 ᄂ구부리거나 망치로 ᄃ두들겨서 여러 가지 형태의 쓸모 있는 물건을 만들 수 있다. ᄀ ᄂ ᄃ ᄀ ᄂ ᄃ 조금 단금 주금 주금 판금 단금 단금 판금 주금 판금 단금

More information

Chapter 3

Chapter 3 Chapter 8 Viruses in Molecular Biology 1 8.1 Introduction to Viruses A virus particle (virion) 은 living cell 내에있지않으면자라지도않고 replicate 를하지도않는다. Virion 의크기는 10 200nm 이며전자현미경상에서관찰이가능하다 ( 옆의그림참조 ) 일부 virus

More information