untitled

Korean J Clin Microbiol Vol. 12, No. 1, March, 2009 Characterization of Class 1 Integrons in Metallo-βlactamase-producing Pseudomonas aeruginosa Ji Youn Sung, Sun Hoe Koo, Kye Chul Kwon, Jong Woo Park, Chi Seon Ko, So Youn Shin, Jeong Hoon Song Department of Laboratory Medicine, College of Medicine, Chungnam National University, Daejeon, Korea Background: The genes of metallo-β-lactamase (MBL), a powerful carbapenemase, are carried as a part of the mobile gene cassettes inserted into integrons playing an important role in rapid dissemination of antibiotic resistance genes among bacterial isolates. In this study, we investigated carbapenemase genes and class 1 integrons integrated into the gene cassettes in imipenem-non susceptible P. aeruginosa. Methods: From July 2006 to March 2008, 81 consecutive, non-duplicate, imipenem-non susceptible P. aeruginosa were isolated at Chungnam National University Hospital in Chungcheong province of Korea. The modified Hodge and double disk synergy tests were conducted for the screening of carbapenemase and MBL production, respectively, and PCR and DNA sequencing were performed for the detection of carbapenemase genes and class 1 integron gene cassettes. We also employed the repetitive element sequence-based (Rep)-PCR method for an epidemiologic study. Results: MBLs were detected in 13.6% (11/81) of imipenem-non susceptible P. aeruginosa. Ten isolates were found to carry bla IMP-1, whereas 1 isolate was found to carry a bla VIM-2. All of the IMP-1-producing strains harbored 4.0 kb class 1 integron containing chloramphenicol, aminoglycoside, and β-lactamresistant genes. However, bla IMP-1 was not detected at class 1 integron. A 2.5 kb class 1 integron harboring bla VIM-2 was detected in a VIIM-2- producing strain. One identical pattern was observed in ten IMP-1 producing strains. Conclusion: IMP-1 producing P. aeruginosa strains are currently distributed throughout Chungcheong province of Korea. In particular, all of the strains harbored class 1 integrons containing variant antibiotic resistance gene cassettes. (Korean J Clin Microbiol 2009;12:17-23) Key Words: Metallo-β-lactamase (MBL), Class 1 integron, Multidrug resistance Pseudomonas aeruginosa 서 녹농균 (Pseudomonas aeruginosa) 은호기성포도당비발효그람음성간균으로병원감염의주요원인균이다. 녹농균에의한감염은대부분기회감염이며, 외이도염, 골수염, 뇌수막염, 심내막염, 폐렴, 요로감염, 균혈증등다양한유형의감염증을유발한다 [1]. 녹농균에의한감염증치료에는 carbapenem계항균제가많이사용되어왔는데이는이항균제가작용범위가넓고, extended spectrum β-lactamase (ESBL) 을포함한대부분의 β-lactamase에의한가수분해에저항성을보여그람음성균의치료에매우효과적이기때문이다 [2]. 그러나최근 carbapenem에내성을보이는녹농균의감염이 Received 3 July, 2008, Revised 13 August, 2008 Accepted 20 October, 2008 Correspondence: Sun Hoe Koo, Department of Laboratory Medicine, College of Medicine, Chungnam National University, 640, Daesadong, Jung-gu, Daejeon 301-721, Korea. (Tel) 82-42-280-7798, (Fax) 82-42-257-5365, (E-mail) shkoo@cnu.ac.kr 론 증가하고있어심각한문제가되고있다 [3]. 녹농균은 carbapenemase의생성, 염색체성 AmpC cephalosporinase의과량생성및 porin 변이, penicillin-binding protein의변화등에의해 carbapenem에대한내성을보인다 [4,5]. 특히획득성 carbapenemase에의한내성은다른균에그내성유전자를전달할수있다는점에서내성확산의우려를낳고있다 [6]. 녹농균이생성하는대표적인 carbapenemase로는 class A의 GES형 β-lactamase[7], class B의 VIM, IMP, SIM, GIM 및 SPM형 metallo-β-lactamase (MBL)[8-12], class D의 OXA-23, OXA-24, OXA-25, OXA-26, OXA-27, OXA-40, OXA-51 및 OXA-58형 β-lactamase[13,14] 등이있다. 이중 MBL은가수분해범위가가장넓으며 bla IMP 및 bla VIM 과같은내성유전자의경우대개 integron 내에위치하는특징이있다 [15,16]. Integron은장소-특이적인재조합기전에의해유전자카세트를인지하고포획하여이동시킬수있는구성요소를가진효율적인유전적기구로많은항균제내성유전자카세트들을종합적으로축적할수있다. 특히 integron에위치한내성유전자 17

18 Korean J Clin Microbiol 2009;12(1):17-23 들은발현되거나전파되기가쉬우므로 integron을가지고있는감염균들은항균제에더욱강한내성을보이게된다 [17,18]. 이러한 integron 은 integrase 단백질의상동성에근거를두어최소한 6종류의클래스로분류된다. 그중 class 1은가장흔한구조로 2개의보존적분절인 5 -보존영역 (5 -CS) 과 3 -보존영역 (3 -CS) 을가지고있다 [19]. 본연구에서는충청지역의한대학병원에서분리된 imipenem 비감수성녹농균을대상으로이들이생성하는 carbapenemase의유전형을분석하였다. 또한이유전자들이 class 1 integron에위치하는지를확인하여내성세균의확산방지책을마련하는데필요한기초자료를제공하고자하였다. 재료및방법 1. 균주의수집 2006년 7월부터 2008년 3월까지충남대학교병원진단검사의학과에의뢰된임상검체로부터분리된녹농균중 imipenem 에비감수성을보인 81주를대상으로하였다. 항균제내성에상관없이분리된순서대로균주를수집하였으며, 동일환자에서반복분리된균주는수집대상에서제외하였다. 분리된균주의균종은전통적인생화학적방법및 Vitek II GNI card (biomerieux Vitek Inc., Hazelwood, MO, USA) 로확인하였다. 2. 항균제감수성시험 Clinical and Laboratory Standards Institute (CLSI) 지침에따라 [20] amikacin, gentamicin, netilmicin, tobramycin, ceftazidime, imipenem, piperacillin, ticarcillin 및 ciprofloxacin (BBL Microbiology Systems, Cockeysville, MD, USA) 과 aztreonam, cefepime 및 meropenem (Oxoid, Cambridge, UK) 에대한감수성을 Mueller-Hinton 한천 (Difco, Cockeysville, MD, USA) 을사용하여디스크확산법으로확인하였다. 정도관리를위해서 Escherichia coli ATCC 25922와 P. aeruginosa ATCC 27853을동시에시험하여허용범위에드는지를확인하였다. 3. β-lactamase 생성검사 1) Carbapenemase 생성선별검사 : Hodge 변법을이용하여 carbapenemase 생성균주를선별하였다 [21]. E. coli ATCC 25922의탁도를 0.5 McFarland로맞춘후멸균된면봉을이용하여 Mueller-Hinton 한천 (Difco) 에고르게접종하였다. 그위에시험균주를백금이로평판의가운데로부터가장자리로향하여한줄로굵게접종한다음배지의중앙에 imipenem 디스크 (10μg, BBL) 를놓고 35 o C에서 18시간배양하였다. 시험균주를접종한선의중앙쪽말단부에생기는억제영역이다른부위에비해서더넓게생기면양성으로판정하였다. 2) Metallo-β-lactamase 생성선별검사 : Carbapenemase 생성균주를대상으로 double disk synergy시험 [21] 을이용하여 MBL 생성균주를선별하였다. 먼저대상균주의탁도를 0.5 McFarland 로맞춘후멸균된면봉을이용하여 Mueller-Hinton 한천 (Difco) 에고르게접종하였다. Imipenem 디스크 (10μg, BBL) 와 EDTA (750μg, Sigma Chemical Co., St. Louis, MO. USA) 및 sodium mercaptoacetic acid (2 mg, Sigma Chemical Co.) 가포함되어있는디스크를간격이 10 mm가되도록하여놓은후 35 o C 항온기에 18시간배양하였다. 두디스크사이에서상승효과에의한억제대의확장현상이관찰되면양성으로판정하였다. 4. β-lactamase 유전형확인 β-lactamase의유전형을분석하기위해이미보고된바있는기존의시발체를사용하여중합효소연쇄반응 (Polymerase Chain Reaction, PCR) 을시행하였다 (Table 1). 대상균주를 brain heart infusion broth (Difco) 에접종하여 37 o C에서하룻밤진탕배양한후 DNA purification kit (Promega, Madison, WI, USA) 을사용하여배양액으로부터 DNA를추출하였다. DNA 추출액 (5μL), 10 Taq buffer (2.5μL), 10 mm dntp mix (0.5 μl), primer 각 10 pmol, 0.7 U Taq DNA polymerase ( 바이오니아, 대전, 한국 ) 및증류수를혼합하여 25μL 의반응용액을만들었다. Gene Amp PCR System 9600 (Perkin-Elmer Cetus Corp., Norwalk, CT, USA) 으로 95 o C에서 5분간반응시킨후, 95 o C에서 20초, 59 o C에서 40초, 72 o C에서 30초씩 30회증폭반응시키고, 72 o C에서 5분간연장반응시켰다. 각각의 PCR 생산물을 ethidium bromide가포함된 1% agarose gel에서 40분간전기영동하여밴드를확인하였다. 증폭산물을 DNA extraction kit (Qiagen, Hilden, Germany) 로분리후, BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Foster City, CA, USA) 와 ABI PRISM 3730xl DNA analyzer (PE Applied Biosystems) 를이용하여염기서열을분석하였다. 5. Class 1 integron 의검출과유전자카세트의유전형확인 Class 1 integron을검출하기위해이미보고된바있는기존의 5 보존영역 (GGCATCCAAGCAGCAAG) 과 3 보존영역 (A- AGCAGACTTGACCTGA) 의분절을시발체로하여 PCR을수행하였다 [30]. β-lactamase 유전형을분석할때와같은조성의반응용액 25μL 를 95 o C에서 5분간반응시킨후, 94 o C에서 1분, 55 o C에서 1분, 72 o C에서 4분씩 30회증폭반응시키고, 72 o C에서 10분간연장반응시켰다. Class 1 integron 내에존재하는유전자카세트의유전형은 primer walking 방법으로확인하였다. 5 보존영역과 3 보존영역의분절을시발체로하여얻어진각각의 PCR 산물을염기서열분석한뒤, 말단부분에서다시새로운시발체를디자인하

Ji Youn Sung, et al. : Class 1 Integrons in MBL-producing Pseudomonas aeruginosa 19 여 PCR을수행하고염기서열분석을하는일련의과정을되풀이하여전체염기서열을분석하였다. 6. Repetitive element sequence-based (Rep)-PCR 에의한역학적연관성조사 DNA purification kit (Promega) 로대상균주의염색체 DNA 를추출하여주형 DNA로사용하였다. Primer 로는 ERIC2 (5'- AAGTAAGTGACTGGGGTGAGCG-3') 와 REP2-Dt (5'-NCGN- CTTATCNGGCCTAC-3') 로명명된장내세균의반복서열을이용하였다 [31]. 증폭반응은 DNA 추출액 (5.0μL), 10 Taq buffer (5.0μL), 10 mm dntp mix (1.0μL), primer 각 20 pmol, 1.4 U Taq DNA polymerase ( 바이오니아 ) 및증류수를혼합하 Table 1. Oligonucleotide primers for amplification and sequencing Enzyme Primer Amplicon Target Sequence (5-3 ) Reference class pairs size (bp) Class A PER1 F bla PER1 GTTAATTTGGGCTTAGGGCAGA 855 22 PER1 R CAGCGCAATCCCCACTGT PSE F bla PSE AATGGCAATCAGCGCTTC 700 23 PSE R GCGCGACTGTGATGTATA VEB F bla VEB CGACTTCCATTTCCCGATGC 650 24 VEB R GGACTCTGCAACAAATACGC GES F bla GES, bla IBC GTTAGACGGGCGTACAAAGATAAT 903 25 GES R TGTCCGTGCTCAGGATGAGT Class B IMP F bla IMP CATGGTTTGGTGGTTCTTGT 488 26 IMP R ATAATTTGGCGGACTTTGGC VIM F bla VIM ATTGGTCTATTTGACCGCGTC 780 26 VIM R TGCTACTCAACGACTGAGCG SIM F bla SIM GTACAAGGGATTCGGCATCG 569 27 SIM R TGGCCTGTTCCCATGTGAG SPM F bla SPM CTAAATCGAGAGCCCTGCTTG 798 27 SPM R CCTTTTCCGCGACCTTGATC GIM F bla GIM TCAATTAGCTCTTGGGCTGAC 72 27 GIM R CGGAACGACCATTTGAATGG Class D OXA-23F bla OXA-23, 27, 49 GATGTGTCATAGTATTCGTCG 1,058 26 OXA-23R TCACAACAACTAAAAGCACTG OXA-24F bla OXA-24, 25, 26, 40, 72 GTACTAATCAAA GTTGTGAA 825 26 OXA-24R TTCCCCTAACATGAATTTGT OXA-51F bla OXA-51like TGAACATTAAAICACTCTT 825 28 OXA-51R CTATAAAATACCTAATTGTT OXA-58F bla OXA-58 CGATCAGAATGTTCAAGCGC 528 29 OXA-58R ACGATTCTCCCCTCTGCGC Abbreviations: F, forward; R, reverse. Table 2. Antimicrobial susceptibilities of Pseudomonas aeruginosa isolates % susceptibility Antimicrobial agents Total isolated P. aeruginosa (n=81) IMP-1 producing P. aeruginosa (n=10) Intermediate Resistant Intermediate Resistant Amikacin 3.7 56.8 0.0 100.0 Gentamicin 14.8 70.4 0.0 100.0 Netilmicin 12.3 65.4 0.0 100.0 Tobramycin 0.0 60.5 0.0 100.0 Aztreonam 28.4 42.0 70.0 30.0 Ceftazidime 12.3 54.3 0.0 100.0 Cefepime 19.8 51.9 0.0 100.0 Imipenem 23.5 76.5 0.0 100.0 Meropenem 30.9 48.1 0.0 100.0 Piperacillin 0.0 43.2 0.0 60.0 Ticarcillin 0.0 69.1 0.0 100.0 Ciprofloxacin 2.5 76.5 0.0 100.0

20 Korean J Clin Microbiol 2009;12(1):17-23 여 50μL 의혼합액으로시행하였다. 95 o C에서 5분간반응시킨후, 90 o C에서 40초, 42 o C에서 1분, 68 o C에서 7분씩 35회증폭반응시키고, 70 o C에서 15분간연장반응시켰다. 증폭산물 (10 μl) 은 ethidium bromide 가포함된 2% agarose gels에전기영동한후 BioDoc-14 TM Imaging system (UVP, Cambridge, UK) 을이용하여분석하였다. 결과 1. 항균제감수성양상시험기간중총 81주의 imipenem 비감수성녹농균이의뢰된임상검체에서분리되었다. 이균주들을대상으로항균제감수성시험을한결과 imipenem과 ciprofloxacin에대한내성률이각각 76.5% 로가장높았으며그다음으로 gentamicin (70.4%) 이높았다. 반면에 aztreonam은 42.0% 로가장낮은내성률을보였다 (Table 2). 2. β-lactamase 생성검사대상균주 81주중 11주 (13.6%) 가 carbapenemase 생성선별검사 (cloverleaf test) 에서양성반응을보였으며이균주들을대상으로 double disk synergy 시험을수행한결과 11주모두에서상승효과가관찰되었다. 따라서대상균주가생성하는 carbapenemase 는모두 MBL인것으로확인되었다. 3. β-lactamase 유전형확인 MBL 생성선별검사에서양성반응을나타낸 11주를대상으로 β-lactamase 유전자검출을위한 PCR을수행한결과 1주만이 VIM형이었고그외 10주는모두 IMP형이었다. 이들을대상으로염기서열을분석한결과 bla VIM 에대한증폭산물은 bla VIM-2 의염기서열과일치하였으며 bla IMP 에대한증폭산물은 bla IMP-1 의염기서열과일치하였다. 한편 81주의 imipenem 비감수성녹농균에서 Ambler class A 와 D에속하는 carbapenemase 유전자는검출되지않았다. 4. Class 1 integron 의검출과유전자카세트의유전형확인 MBL을생성하는 11주모두에서 2.5 kb 또는 4.0 kb 크기의 class 1 integron이검출되었다. VIM-2 생성균주는 2.5 kb 크기의 integron을, IMP-1 생성균주는 4.0 kb 크기의 integron을각각가지고있었다. 검출된 integron의염기서열분석결과 VIM-2 생성균주에서검출된 2.5 kb 크기의 integron 내에는 VIM-2 유전자가위치해있었으나 IMP-1 생성균주에서검출된 4.0 kb 크기의 integron 내에는 IMP-1 유전자가위치해있지않았다 (Fig. 1). 5. Repetitive element sequence-based PCR (Rep-PCR) 에의한역학적연관성조사 11주의 MBL 생성균주를대상으로 Rep-PCR을수행한결과 10주의 IMP-1 생성균주는모두동일한밴드패턴을보였으나 VIM-2 생성균주는 (P28) IMP-1 생성균주와는다른밴드패턴을보였다 (Fig. 2). 고찰최근 carbapenem에도내성을보이는다제내성녹농균의감염이증가하고있어임상적으로많은문제가되고있다. 2003 년 KONSAR surveillance 조사에의하면 imipenem 내성인녹농균의비율이 20% 로높았고그중대부분은다제내성이었다 [32]. 이와같이 carbapenem 내성녹농균의분리율이점차증가하고있으나, carbapenem 내성에관여하는유전자의국내보유현황에대한정보는아직많이부족하다. 본연구에서는 imipenem 비감수성녹농균을대상으로 carbapenem 내성획득에중요한역할을하는 carbapenemase의유전형을조사하였다. 대상균주 81주중총 11주 (13.6%) 가 carbapenemase 유전자를가지고있었고그중 10주가 IMP-1을생성하였다. 반면, VIM-2 를생성하는균주는한주뿐이었다. VIM-2 생성녹농균은 1998년국내에처음으로보고되었으며 [33] 2003년국내에서분리된 carbapenem 비감수성녹농균중 Fig. 1. Schematic representation of gene cassette structure located in the class 1 integron isolated from Pseudomonas aeruginosa. The horizontal arrows indicate the translation orientation of the genes. Fig. 2. Repetitive element sequence-based (Rep)-PCR patterns of genomic DNA from eleven MBL producing Pseudomonas aeruginosa. Lane M is 1 kb DNA size marker.

Ji Youn Sung, et al. : Class 1 Integrons in MBL-producing Pseudomonas aeruginosa 21 11.4% 를차지하였다 [34]. 2005년의보고에서도 [35] 18.1% 에해당하는 carbapenem 비감수성녹농균이 VIM-2를생성하는것으로나타나국내에는 VIM-2가흔한것임이밝혀졌다. 이에반해 IMP-1 생성균주의분리는드물었다. 그러나 2005년 Yoon 등에의해 IMP-1형이 imipenem내성녹농균사이에서확산되고있음이보여졌다 [14]. 본연구에서도 IMP-1형의검출률이 12.3% 로나타나전체검출된 MBL 중 90.9% 를차지한반면 VIM-2를생성하는균주는단한주뿐이었다. 이는국내에서 IMP-1형 MBL을생성하는녹농균이빠르게확산되고있음을시사한다. IMP-1 및 VIM-2 등의 MBL 유전자는대부분은 class 1 integron에유전자카세트로존재하는데이런특징은이들내성유전자가다른균종으로쉽게전달될수있음을뜻한다. 특히 MBL 유전자카세트를가진 integron은 aminoglycoside 내성유전자등다양한내성유전자카세트도함께가진것이많아 integron 보유가다제내성의원인이된다 [36]. 본연구에서도 MBL 생성균주모두가 class 1 integron을가지고있는것으로나타나 integron이녹농균사이에광범위하게확산되어있음을확인할수있었다. VIM-2 를생성하는균주는 2.5 kb 크기의 class 1 integron을가지고있었는데이 integron은 VIM-2 유전자외에도 aminoglycoside 내성유전자인 aada1을가지고있었다. 이러한 integron의구조는 2006년러시아에서분리된녹농균에서처음보고되었으며국내에서도유사한구조가 Enterobacter cloacae에서보고된바있다 [37,38]. 한편 IMP-1을생성하는균주는모두동일한 4.0 kb 크기의 class 1 integron을가지고있었는데이 integron에는 IMP-1 유전자가위치해있지않았다. 지금까지보고된 IMP-1 생성녹농균에서 IMP-1 유전자는대부분 class 1 integron에위치해있었으나 [39] 본연구에서는 IMP-1 유전자를증폭된 class 1 integron에서찾을수없었다. 반면 OXA형 β-lactamase 유전자인 bla oxa-10, aminoglycoside 내성유전자인 aaca2 및 aadb, 그리고 chloramphenicol 내성유전자인 cmla1 등이 integron에위치해있었다. 이러한내성유전자들은녹농균이다양한항균제에대해내성을갖게하는요인이된다. 본연구에서도 IMP-1 을생성하는녹농균의항균제내성률이 aztreonam과 piperacillin을제외한모든시험대상항균제에대해 100% 인것으로나타나이를뒷받침하였다 (Table 2). MBL 생성균주를대상으로 Rep-PCR을시행한결과, IMP-1 을생성하는 10개의균주가유사한패턴을보였다. 이는 IMP-1 생성균주들이유전적으로매우유사하며이균주들에의해돌발감염이일어났음을의미한다. 본연구에서 imipenem 비감수성녹농균을대상으로 carbapenemase 유전형을분석하였으나실제로 carbapenemase를가지고있었던균주는총 81주중 11주 (13.6%) 뿐이었다. 이는 carbapenem내성원인이 MBL 생성에이외의다른요인들, 즉염 색체성 cephalosporinase를과량생성또는항균제의유출, 세포막의투과성감소등에의한것임을추측하게한다 [4,5]. 따라서내성기전을정확히밝히려면이들에관한추가적인연구가필요하다하겠다. 이상의결과에서충청지역의한대학병원에서분리된 imipenem 비감수성녹농균에확산되어있는 carbapenemase 는주로 IMP-1형 MBL로과거에비하여분리율이증가되고있는것으로나타났다. 또한 IMP-1 생성녹농균은다양한항균제내성유전자카세트가포함된 integron의보유를통해많은항균제에대해내성을나타낼수있음이확인되었다. 감사의글 본연구는 2007 충남대학교학술연구비지원에의하여수행되었음. 참고문헌 1. Bergogne-Berezin E. Pseudomonas and miscellaneous gram-negative bacilli. In: Cohen J and Powerly WG, eds. Infectious Diseases. New York; Mosby, 2004:2203-26. 2. Jacoby GA and Medeiros AA. More extended-spectrum β-lactamases. Antimicrob Agents Chemother 1991;35:1697-704. 3. Song W, Woo HJ, Kim JS, Lee KM. In vitro activity of β-lactams in combination with other antimicrobial agents against resistant strains of Pseudomonas aeruginosa. Int J Antimicrob Agents 2003; 21:8-12. 4. Fernańdez-Cuenca F, Martinez-Martinez L, Conejo MC, Ayala JA, Perea EJ, Pascual A. Relationship between β-lactamase production, outer membrane protein and penicillin-binding protein profiles on the activity of carbapenems against clinical isolates of Acinetobacter baumannii. J Antimicrob Chemother 2003;51:565-74. 5. Clark RB. Imipenem resistance among Acinetobacter baumannii: association with reduced expression of a 33-36 kda outer membrane protein. J Antimicrob Chemother 1996;38:245-51. 6. Yu YS, Yang Q, Xu XW, Kong HS, Xu GY, Zhong BY. Typing and characterization of carbapenem-resistant Acinetobacter calcoaceticus-baumannii complex in a Chinese hospital. J Med Microbiol 2004;53:653-6. 7. Poirel L, Weldhagen GF, Naas T, De Champs C, Dove MG, Nordmann P. GES-2, a class A β-lactamase from Pseudomonas aeruginosa with increased hydrolysis of imipenem. Antimicrob Agents Chemother 2001;45:2598-603. 8. Watanabe M, Iyobe S, Inoue M, Mitsuhashi S. Transferable imipenem resistance in Pseudomonas aeruginosa. Antimicrob Agents Chemother 1991;35:147-51. 9. Lee K, Lim JB, Yum JH, Yong D, Chong Y, Kim JM, et al. bla VIM-2 cassette-containing novel integrons in metallo-β-lactamase-producing Pseudomonas aeruginosa and Pseudomonas putida isolates disseminated in a Korean hospital. Antimicrob Agents Chemother 2002;46:1053-8. 10. Toleman MA, Simm AM, Murphy TA, Gales AC, Biedenbach DJ, Jones RN, et al. Molecular characterization of SPM-1, a novel metallo-β-lactamase isolated in Latin America: report from the

22 Korean J Clin Microbiol 2009;12(1):17-23 SENTRY antimicrobial surveillance programme. J Antimicrob Chemother 2002;50:673-9. 11. Castanheira M, Toleman MA, Jones RN, Schmidt FJ, Walsh TR. Molecular characterization of a β-lactamase gene, bla GIM-1, encoding a new subclass of metallo-β-lactamase. Antimicrob Agents Chemother 2004;48:4654-61. 12. Lee K, Yum JH, Yong D, Lee HM, Kim HD, Docquier JD, et al. Novel acquired metallo-β-lactamase gene, bla SIM-1, in a class 1 integron from Acinetobacter baumannii clinical isolates from Korea. Antimicrob Agents Chemother 2005;49:4485-91. 13. Bou G, Oliver A, Martinez-Beltrań J. OXA-24, a novel class D β- lactamase with carbapenemase activity in an Acinetobacter baumannii clinical strain. Antimicrob Agents Chemother 2000;44: 1556-61. 14. Yoon WS, Lee BY, Bae IK, Kwon SB, Jeong SH, Jeong TJ, et al. Prevalence of imipenem-resistant Pseudomonas aeruginosa isolates and mechanisms of resistance. Korean J Clin Microbiol 2005; 8:26-33. 15. Kim IS, Oh WI, Song JH, Lee NY. Screening and identification of metallo-β-lactamase gene in clinical isolates of imipenem-resistant Pseudomonas aeruginosa. Korean J Lab Med 2004;24:177-82. 16. Poirel L, Naas T, Nicolas D, Collet L, Bellais S, Cavallo JD, et al. Characterization of VIM-2, a carbapenem-hydrolyzing metallo-βlactamase and its plasmid- and integron-borne gene from a Pseudomonas aeruginosa clinical isolate in France. Antimicrob Agents Chemother 2000;44:891-7. 17. Recchia GD and Hall RM. Gene cassettes: a new class of mobile element. Microbiology 1995;141:3015-27. 18. Richet HM, Mohammed J, McDonald LC, Jarvis WR. Building communication networks: international network for the study and prevention of emerging antimicrobial resistance. Emerg Infect Dis 2001;7:319-22. 19. Ploy MC, Lambert T, Couty JP, Denis F. Integrons: an antibiotic resistance gene capture and expression system. Clin Chem Lab Med 2000;38:483-7. 20. Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; sixteenth informational supplement. M100-S10(M2). Wayne, Pensylvania: CLSI, 2006. 21. Lee K, Lim YS, Yong D, Yum JH, Chong Y. Evaluation of the Hodge test and the imipenem-edta double-disk synergy test for differentiating metallo-β-lactamase-producing isolates of Pseudomonas spp. and Acinetobacter spp. J Clin Microbiol 2003;41: 4623-9. 22. Kim JM, Kang HK, Jeong SH, Bae IK, Kwon SB, Cho BK, et al. Prevalence of PER-1 extended-spectrum β-lactamase-clinical isolates of Acinetobacter baumannii in a university hospital, Busan, Korea. Korean J Clin Microbiol 2004;7:20-6. 23. De Champs C, Poirel L, Bonnet R, Sirot D, Chanal C, Sirot J, et al. Prospective survey of β-lactamases produced by ceftazidimeresistant Pseudomonas aeruginosa isolated in a French hospital in 2000. Antimicrob Agents Chemother 2002;46:3031-4. 24. Naas T, Benaoudia F, Massuard S, Nordmann P. Integron-located VEB-1 extended-spectrum β-lactamase gene in a Proteus mirabilis clinical isolate from Vietnam. J Antimicrob Chemother 2000;46: 703-11. 25. Park JH, Lee SH, Jeong SH, Kim BN, Kim KB, Yoon JD, et al. Characterization and prevalence of Escherichia coli and Klebsiella pneumoniae isolates producing an extended spectrum β-lactamase from Korean hospitals. Korean J Lab Med 2003;23:18-24. 26. Jeon BC, Jeong SH, Bae IK, Kwon SB, Lee K, Young D, et al. Investigation of a nosocomial outbreak of imipenem-resistant Acinetobacter baumannii producing the OXA-23-β-lactamase in Korea. J Clin Microbiol 2005;43:2241-5. 27. Mendes RE, Kiyota KA, Monteiro J, Castanheira M, Andrade SS, Gales AC, et al. Rapid detection and identification of metallo-βlactamase-encoding genes by multiplex real-time PCR assay and melt curve analysis. J Clin Microbiol 2007;45:544-7. 28. Pournaras S, Markogiannakis A, Ikonomidis A, Kondyli L, Bethimouti K, Maniatis AN, et al. Outbreak of multiple clones of imipenem-resistant Acinetobacter baumannii isolates expressing OXA-58 carbapenemase in an intensive care unit. J Antimicrob Chemother 2006;57:557-61. 29. Heritier C, Dubouix A, Poirel L, Marty N, Nordmann P. A nosocomial outbreak of Acinetobacter baumannii isolates expressing the carbapenem-hydrolysing oxacillinase OXA-58. J Antimicrob Chemother 2005;55:115-8. 30. Le vesque C, Piche L, Larose C, Roy PH. PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob Agents Chemother 1995;39:185-91. 31. Shannon KP and French GL. Increasing resistance to antimicrobial agents of Gram-negative organisms isolated at a London teaching hospital, 1995-2000. J Antimicrob Chemother 2004;53:818-25. 32. Lee K, Park KH, Jeong SH, Lim HS, Shin JH, Yong D, et al. KONSAR group. Further increase of vancomycin-resistant Enterococcus faecium, amikacin- and fluroquinolone-resistant Klebsiella pneumoniae, and imipenem-resistant Acinetobacter spp. in Korea: 2003 KONSAR surveillance. Yonsei Med J 2006;47:43-54. 33. Lee K, Chong Y, Shin HB, Yong D. Rapid increase of imipenemhydrolyzing Pseudomonas aeruginosa in a Korean hospital. Abstr E-85, 38th ICAAC, 1998. 34. Lee K, Lee WG, Uh Y, Ha GY, Cho J, Chong Y, et al. VIM- and IMP-type metallo-β-lactamase-producing Pseudomonas spp. and Acinetobacter spp. in Korean hospitals. Emerg Infect Dis 2003; 9:868-71. 35. Kim IS, Lee NY, Ki CS, Oh WS, Peck KR, Song JH. Increasing prevalence of imipenem-resistant Pseudomonas aeruginosa and molecular typing of metallo-β-lactamase producers in a Korean hospital. Microb Drug Resist 2005;11:355-9. 36. Jang SJ. The role of integrons in the spread of multi-drug resistance. Korean J Clin Microbiol 2005;8:1-9. 37. Shevchenko O, Edelstein M, Kretchikov V, Stratchounski L. Characterization of class 1 integrons carrying the genes for VIMand IMP-type metallo-β-lactamases in Pseudomonas aeruginosa strains from Russia. Abstr P-1407, 16th ESCMID, 2006. 38. Jeong SH, Lee K, Chong Y, Yum JH, Lee SH, Choi HJ, et al. Characterization of a new integron containing VIM-2, a metallobeta-lactamase gene cassette, in a clinical isolate of Enterobacter cloacae. J Antimicrob Chemother 2003;51:397-400. 39. Ozgumus OB, Caylan R, Tosun I, Sandalli C, Aydin K, Koksal I. Molecular epidemiology of clinical Pseudomonas aeruginosa isolates carrying IMP-1 metallo-β-lactamase gene in a University Hospital in Turkey. Microb Drug Resist 2007;13:191-8.

Ji Youn Sung, et al. : Class 1 Integrons in MBL-producing Pseudomonas aeruginosa 23 = 국문초록 = Metallo-β-lactamase 생성녹농균에서 Class 1 Integron 의유전형분석 충남대학교의과대학진단검사의학교실성지연, 구선회, 권계철, 박종우, 고지선, 신소연, 송정훈 배경 : 강력한 carbapenemase인 metallo-β-lactamase (MBL) 유전자는세균간의내성유전자확산에중요한역할을하는 integron에존재하는경우가많다. 본연구에서는 imipenem 비감수성녹농균을대상으로 carbaepenmase의유전형을분석하고이유전자들이 class 1 integron에위치하는지를확인하였다. 방법 : 2006년 7월부터 2008년 3월까지충남대학교병원에서분리된 imipenem 비감수성녹농균 81주를대상으로하였다. Hodge 변법과 double disk synergy 시험을이용하여각각 carbapenemase와 MBL의생성여부를결정하였고 PCR과염기서열분석을통하여 carbapenemase 유전자와 class 1 integron의유전형을분석하였다. 역학연구는 repetitive element sequence-based (Rep)-PCR로하였다. 결과 : Imipenem 비감수성녹농균 81주중 13.6% 에해당하는 11주가 MBL을생성하는것으로나타났다. 이들중 10주가 bla IMP-1 을가지고있던반면 bla VIM-2 를가지고있던균주는단한주뿐이었다. IMP-1 생성주의경우모두 4.0 kb의 integron을가지고있는것으로나타났으며이 integron에는 chloramphenicol, aminoglycoside 및 β-lactam 항균제내성유전자가위치해있었다. 그러나 bla IMP-1 은 integron 상에위치해있지않았다. 반면 VIM-2 생성균주에서는 bla VIM-2 가 2.5 kb의 integron 상에위치해있었다. 10주의 IMP-1 생성균주는 Rep-PCR에서한가지의동일한밴드패턴을보였다. 결론 : IMP-1 β-lactamase를생성하는녹농균이충청지역에확산되어있으며특히이균주들은모두다양한항균제내성유전자카세트가포함된 class 1 integron을가지고있었다. [ 대한임상미생물학회지 2009;12:17-23] 교신저자 : 구선회, 301-721, 대전시중구대사동 640 충남대학교병원진단검사의학과 Tel: 042-280-7798, Fax: 042-257-5365 E-mail: shkoo@cnu.ac.kr