Journal of Bacteriology and Virology 2006. Vol. 36, No. 2 p.73 78 닭분변유래 Enterococcus spp. 의 Fluoroquinolone 계내성관련 gyra 및 parc Gene 의변이 대구광역시보건환경연구원 1, 경북대학교수의과대학 2, 국립수의과학검역원 3 조재근 1 김기석 2 이영주 2* 박청규 2 곽동미 2 김애란 3 강민수 3 김종완 3 김병한 3 구복경 3 Alteration in gyra and parc Gene Associated with Fluoroquinolone Resistance of Enterococcus spp. Isolated from Feces of Chicken Jae-Keun Cho 1, Ki-Seuk Kim 2, Young-Ju Lee 2*, Cheong-Kyu Park 2, Dong-Mi Kwak 2, Ae-Ran Kim 3, Min-Su Kang 3, Jong-Wan Kim 3, Byoung-Han Kim 3 and Bok-Kyung Ku 3 1 Daegu Metropolitan City Research Institute of Health & Environment, Daegu, 706-732, Korea, 2 College of Veterinary Medicine, Kyungpook National University, Daegu, 702-701, Korea, 3 National Veterinary Research and Quarantine Service, Anyang, 430-824, Korea Received : May 4, 2006 Accepted : June 15, 2006 The purpose of this study was to investigate the fluoroquinolone resistance frequency of Enterococcus spp. from normal chicken feces and to analyse mutations of the gyra and parc gene associated with fluoroquinolone resistance. Among 52 Enterococcus faecalis and 25 E. faecium isolates, 23 (44.2%) E. faecalis and 7 (28.0%) E. faecium were resistant to ciprofloxacin (CIP) by disc diffusion method. Genetic exchange in gyra and parc gene among 2 CIP intermediate isolates and 15 CIP resistant isolates were found in the amino acid codon of Ser-83 and Asp-87, and Ser-80 and Glu-84, respectively. These mutants contained a change from Ser to Phe, Val, Tyr, Ile, Thr or Pro at codon 83 and from Glu to Gly or Leu at codon 87 in gyra gene, and a change from Ser to Ile or Thr at codon 80 and from Glu to Asp or Lys at codon 84 in parc gene. The isolates with mutation in gyra regardless of a mutation in parc showed high resistance (MIC 32 µg/ml) to CIP, enrofloxacin, norfloxacin and ofloxacin. These results suggested that gyra gene is the primary target for 4 fluoroquinolones resistance in Enterococcus spp. Key Words: Enterococcus, fluoroquinolone, gyra, parc 서 Fluoroquinolone계항균제는 1980년대말이후의학및수의학분야에도입되어현재까지널리사용되고있는광범위합성항균제이다. 이들약제는경구투여가가능하고 Escherichia coli를포함한그람음성균뿐만아니라 Staphylococcus * 교신저자 : 이영주. 702-701, 대구광역시북구산격동 1370번지, 경북대학교수의과대학 Phone: 82-53-950-7793, Fax: 82-505-950-7793, e-mail: youngju@mail.knu.ac.kr 론 aureus 등의그람양성균에대해서도강력한항균력을가지는장점때문에여러세균감염증의치료를위해널리사용하고있다 (13). 국내에서도닭대장균증및소설사병치료를위하여 1990년대에도입되었으며, 최근에는가축유래 E. coli, Campylobacter jejuni 및 Salmonella spp. 등에서 fluoroquinolone 내성균출현이증가하고있음이보고된바있다 (3,4, 8,11). Quinolone은주로세균의 DNA 합성에필요한효소인 DNA gyrase (topoisomerase II) 또는 topoisomerase IV의작용을억제하여 DNA 복제를저해함으로항균작용을나타내며, DNA gyrase는 gyra 및 gyrb subunit로, topoisomerase IV는 73
74 조재근, 김기석, 이영주, 박청규, 곽동미, 김애란, 강민수, 김종완, 김병한, 구복경 parc 및 pare subunit로구성되어있다 (12,15). 특히, fluoroquinolone계항균제에대한내성은 gyra 또는 parc 유전자의돌연변이와관련된다고알려져있으며, gyra 유전자의 67번부터 106번은 E. coli와동일하게 quinolone resistance determining region (QRDR) 으로알려져 fluoroquinolone의내성형성에중요한역할을하고있다 (9,10,19,21,26). Enterococcus spp. 는사람과동물의장관내에서식하는정상세균총으로식품위생상분변오염의지표세균으로간주되고있으며, 사람에서는심내막염, 균혈증, 요로감염및수막염과같은원내감염의중요한병원체로알려져있다 (17,18). 또한최근들어서는 vancomycin에내성을형성한 Enterococcus spp. 가사회적문제로대두되고있는등, 이들균종에대한항생제내성획득에대한우려가커지고있는실정이다. 본연구의목적은국내양계분야에서최근많이사용되고있는 fluoroquinolone계항균제에대한내성경향을파악하기위하여닭의정상분변으로부터분리한 Enterococcus spp. 의 fluoruqiononloen계항균제에대한내성과 gyra 및 parc 유전자의 QRDR에서의돌연변이양상을분석함으로그특성을알아보고자하였다. 재료및방법 1. 공시재료및균분리 2003년 3월부터 11월까지국내 6개육계농장및 4개종계농장을대상으로균분리를실시하였다. 각각의농장별로계사바닥에떨어져있는신선한분변 5 g을하나의시료로하여멸균시험관에담았으며, 각농장별로 10개의시료를채취하여즉시실험실로냉장운반하여 Enterococcus spp. 의분리를실시하였다. Enterococcus spp. 의동정은 Enterocossel agar상에나타난검은색집락에대하여 Lleo 등 (6) 및 Cheng 등 (5) 이보고한 PCR법을이용하여 E. faecalis와 E. faecium 로최종확인하였다. 2. 항균제감수성검사 Enterococcus spp. 분리주 77주에대하여 ciprofloxacin (CIP) 의 sensi disk (BBL, Becton-Dickinson, USA) 을이용한디스크 확산법을실시하였으며, 또한 CIP, enrofloxacin (ENO), norfloxacin (NOR) 및 ofloxacin (OF) 에대한 minimal inhibitory concentration (MIC) 측정을 E test (AB Biodisk, Solna, Sweden) 를이용하여실시하였다. 즉, Mueller hinton broth 에 35 에서 2~6시간배양한균액을 McFarland No. 0.5로조정하여멸균된면봉으로 mueller hinton agar에도말하고 gradient strip을항균제의저농도표시가있는쪽부터배지표면위에올려놓은후, 35 에서 16~18시간배양하였다. 타원형억제대의경계가 E test strip의눈금과만나는교차점을 MIC로판정하였다. 3. DNA 추출 Chromosomal DNA의추출은 Pitout 등 (23) 의방법에준하여 boiling법으로실시하였다. 즉, 공시균을 5 ml LB broth (Difco, Detroit, USA) 에접종하고 37 에서 20시간진탕배양한후, 배양액 1.5 ml을 eppendorf tube에취하여 13,000 rpm 에서 5분간원심분리하였으며상층액을제거후 500 µl 멸균증류수로재부유시켰다. 이를 95 에서 10분간열처리하고 13,000 rpm에서 5분간재원심분리하였으며상층액을 -4 에서보관하면서 PCR에사용하였다. 4. gyra 및 parc 유전자의증폭및염기서열분석 Enterococcus spp. 의 gyra 및 parc 유전자의증폭을위한 primer는 Amin 등 (7) 이보고한방법에따라합성하였다 (Table 1). Enterococcus spp. 의 gyra 및 parc 유전자의증폭을위하여 2.5 U Taq polymerase, 25 mm dntp, 10 mm Tris-Hcl, 40 mm Kcl 및 1.5 mm MgCl 2 를포함하는 AccuPower PCR Premix (Bioneer Co., Korea) 에 primer 각각 1 µl씩과 DNA 5 µl를첨가하고최종량이 50 µl가되도록멸균증류수를넣은후, thermal cycler (Biometra, Germany) 를이용하여 PCR을수행하였다. PCR 조건은 94 에서 5분간 predenaturation시킨후, denaturation (94, 1분 ), annealing (55, 1분 ), extention (72, 1분 ) 의과정을총 30회반복실시하였으며최종 extention은 72 에서 10분간실시하였다. PCR 산물은 1.2% agarose 에서전기영동을실시한후, ethidium bromide (0.5 µg/ml) 로염색하여 UV transilluminator (Biometra, Germany) 에서특이 Table 1. Primers sequences used for the amplification of gyra and parc gene Target genes F/R Primer sequence (5' 3') Fragment size (bp) gyra Forward CGGGATGAACGAATTGGGTGTGA Reverse AATTTTACTCATACGTGCTTCGG 241 parc Forward AATGAATAAAGATGGCAATA Reverse CGCCATCCATACTTCCGTTG 191
닭분변유래 Enterococcus spp. 의 Fluoroquinolone 계내성관련 gyra 및 parc Gene 의변이 75 band를확인하였으며, 증폭산물에대한염기서열분석은 ( 주 )Takara사에의뢰하였다. 결과및고찰 E. faecalis 52주및 E. faecium 25주의 CIP에대한디스크확산시험결과는 Table 2와같다. E. faecalis 및 E. faecium 각각 44.2% 및 28.0% 가 CIP에내성을나타내었으며, 44.2% 및 44.2% 는부분내성을나타내었다. Fluoroquinolone계항균제에대한국내분리병원성세균의내성율은최근에많이보고되고있으며, 특히 Enterococcus spp. 처럼분변지표세균인 E. coli에대하여많이알려진바, 송등 (1) 은 2003년국내도축장에서분리한 E. coli의항균제감수성결과소도체유래분리주는모두감수성을나타내었으나돼지도체유래 E.coil의 8.1% 및닭도체유래 E. coli의 42.3~44.7% 가내성을보여특히닭에서의내성이크게높은것으로보고하였다. 이등 (2) 또한닭분변유래 E. coli의 57.1~59.2% 가 fluoroquinolone 계에내성을나타냄을보고한바있다. 가축유래 Enterococcus spp. 에대한 fluoroquinolone계내성율은현재까지국내에서는보고된바가없어본성적과비교할수는없었지만, 동일한분변지표세균의하나인 E. coli와비교시본성적에서나타난 Enterococcus spp. 의내성정도는타당한것으로판단되며, 이러한내성균의출현은 fluoroquinolone계가양계분야 Table 2. Ciprofloxacin resistance frequency of 52 E. faecalis and 25 E. faecium isolates from chicken Isolates No. (%) of isolates Resistant Intermediate Susceptible Total E. faecalis 23 (44.2) 23 (44.2) 6 (11.6) 52 (100) E. faecium 7 (28.0) 12 (44.2) 6 (24.0) 25 (100) 에서치료및예방목적으로광범위하게사용되었기때문인것으로사료된다. 77주의 Enterococcus spp. 중감수성, 부분내성또는내성을나타내는 17주의 E. faecalis 및 7주의 E. faecium에대하여 gyra 및 parc 유전자의염기서열을분석한결과는 Table 3 과같다. gyra QRDR 유전자의염기서열 67번부터 106번사이중 Ser83과 Glu87번위치에서변이가관찰되었으며, parc 유전자에서는염기서열 67번부터 103번사이중 Ser80 및 Glu84번위치에서변이가관찰되었다. CIP에대한디스크확산시험에서중간내성을보인 2주의 Enterococcus spp. 는모두 parc 유전자에서만변이가관찰되었으며, 그중 1주는 Ser80 및 Glu84 유전자모두에서이중변이를보였다. 또한 CIP에내성을보인 15주중 6주는 gyra 유전자에서만변이를보였고, 2주는 parc 유전자에서만, 나머지 7주는 gyra 와 parc 유전자모두에서이중변이를보였다. CIP에감수성을보인 1주에서도 gyra의 Ser83 유전자에서변이가관찰되었다. Enterococcus spp. 의 fluoroquinolone에대한내성유무는 gyra 유전자의변이와밀접한관련이있다는보고도있으나 (16), Kanematsu 등 (14) 은 E. faecalis와같은그람양성균에서는 parc 유전자의변이가 gyra 유전자의변이에앞서일어나며, 아울러 topoisomerase IV가 fluoroquinolone에대한내성형성의주표적임을보고하기도하였다. 그러나본연구에서는내성을보인 15주중 6주가 parc 유전자의변이와무관하게 gyra 유전자에서만변이만을보여 Kanematus 등 (14) 의보고와는일치하지않는것으로나타났다. Pan과 Fisher (22) 는 Streptococcus pneumoniae의 fluoroquinolone계에대한내성형성은제제의종류에따라달라짐을보고하였던바, 즉 CIP에대한주표적은 parc 유전자이나 sarafloxacin의주표적은 gyra 유전자라고밝혔고, Onodera 등 (20) 은 E. faecalis의 levofloxacin에대한내성형성의주표적또한 gyra Pattern against ciprofloxacin Table 3. Prevalence of mutations within gyra and parc genes of 24 Enterococcus spp. isolates No. of isolates Susceptible 7 1 (14.3) No. (%) of mutants in amino acid position gyra parc gyra/parc Ser83 Glu87 Ser80 Ser80 & Glu84 a Intermediate 2 1 (50.0) 1 (50.0) Ser83/ Ser80 b Ser83/ Glu84 c Ser83 & Glu87/Ser80 d Resistant 15 5 (33.3) 1 (6.7) 2 (13.3) 5 (33.3) 1 (6.7) 1 (6.7) Total 24 6 (25.0) 1 (4.2) 3 (12.5) 1 ( 4.2) 5 (20.8) 1 (4.2) 1 (4.2) a Mutation at Ser80 and Glu84 of parc gene. c Mutation at Ser83 of gyra and Glu84 of parc gene. b Mutation at Ser83 of gyra and Ser80 of parc gene. d Mutation at Ser83 and Glu87 of gyra, and Ser80 of parc gene
76 조재근, 김기석, 이영주, 박청규, 곽동미, 김애란, 강민수, 김종완, 김병한, 구복경 유전자라고보고하였다. 본연구결과에서도내성이형성된 15주중 2주는 parc 유전자에서만변이가일어났으나 13주는 gyra 유전자의변이를보여본시험에사용된 4종의 fluoroquinolone 제제에대한내성형성의주표적은 gyra 유전자가더밀접한것으로보였다. 24주의 Enterococcus spp. 에대하여 fluoroquinolone에대한 MIC와 gyra 및 parc 유전자의돌연변이양상을비교한결과는 Table 4와같다. CIP에대한디스크확산시험결과에서감수성이있는것으로나타난 7주의 Enterococcus spp. 중 1주 에서 Ser83이 Cys로변이되었으나, CIP, ENO, NOR 및 OFL 에대한 MIC가 0.75~2 µg/ml로나타나본돌연변이양상은 fluoroquinolone계의내성형성과는무관한것으로판단된다. 또한부분내성을보인 2주는 parc 유전자의 Ser80이모두 Ile로변이되었으며, 그중 1주는 Ser80의변이와함께 Glu- 84가 Asp로변이되어이중변이가관찰되었다. CIP에대한디스크확산시험에서내성을보인 15주의 Enterococcus spp. 모두 CIP, ENO, NOR 및 OFL에대하여 12~ 32 µg/ml의 MIC를나타내었으며, gyra 유전자의 Ser83은 Phe, Val, Tyr, Table 4. Minimal inhibitory concentration for fluoroquinolones and mutations in the gyra and parc genes of 24 Enterococcus spp. isolates MIC (µg/ml) c Isolates a CIP disc b CIP ENO NOR OFL Efs 26 S 0.5 0.38 2 1.5 Efs 31 S 0.5 0.5 1.5 1.5 Efs 54 S 0.75 0.75 2 1.5 Efs 9 S 0.75 0.75 2 2 Cys Efm 18 S 0.5 0.38 2 2 Efm 24 S 0.5 1 1.5 3 Efm 38 S 0.5 0.38 1.5 1.5 gyra Amino acid at position d parc 83 (Ser) 87 (Glu) 80 (Ser) 84 (Glu) Efs 20 I 3 3 16 4 Ile Efm 36 I 2 4 3 6 Ile Asp Efs 47 R 32 32 32 32 Phe Efs 51 R 32 32 32 32 Phe Efs 33 R 32 32 32 32 Val Efs 38 R 32 32 32 32 Tyr Efs 39 R 32 32 32 32 Ile Efs 40 R 32 32 32 32 Gly Efs 4 R 32 32 32 32 Ile Efs 6 R 32 12 32 32 Ile Efs 18 R 32 32 32 32 Phe Ile Efs 16 R 32 32 32 32 Ile Ile Efs 30 R 32 32 32 32 Val Ile Efs 56 R 32 32 32 32 Tyr Lys Efm 29 R 32 32 32 32 Phe Thr Efm 10 R 32 32 32 32 Thr Ile Efm 28 R 32 32 32 32 Pro Leu Ile a Efs, E. faecalis; Efm, E. faecium. b S, susceptible; I, intermediate; R, resistant. c CIP, ciprofloxacin; ENO, enrofloxacin; NOR, norfloxacin; OFL, ofloxacin. d For those isolates with no amino acid shown, the codon is identical to that of the wild type isolates
닭분변유래 Enterococcus spp. 의 Fluoroquinolone 계내성관련 gyra 및 parc Gene 의변이 77 Ile, Pro 및 Thr로변이가확인되었고, Glu87은 Gly 또는 Leu 로변이가나타났다. 또한 parc 유전자의 Ser80은 Ile 또는 Thr로변이되었고, Glu84는 Lys로변이가관찰되었다. CIP에대한디스크확산시험에서내성을보인 2주의경우 parc 유전자의 Ser80에서만변이를보여부분내성을보인분리주와동일한양상을나타내었으나, MIC에서는 12~ 32 µg/ml 로부분내성주분리주의 2~16 µg/ml와는큰차이를나타내었다. Sylvain 등 (24) 은 fluoroquinolone에내성인 E. faecium의 gyra 유전자의 Ser83은 Arg 또는 Leu로, Glu87은 Leu 및 Gly로변이되었고, parc 유전자의 Ser80은 Ile 또는 Arg로, Gly84는 Lys 또는 Thr로변이됨을보고하였다. 또한 Amin 등 (12) 은 Sylvain 등이보고한변이이외에 gyra의 Ser83이 Ile 또는 Tyr로변이됨을보고한바있다. 본조사에서는 gyra의 Ser83이지금까지보고된변이양상이외에 Phe, Val, Thr 또는 Pro로도변이됨을확인하였으며, 이러한양상을나타내는분리주모두감수성균의 MIC인 0.38~3 µg/ml와비교시모두 32 µg/ml을보여내성형성과관련이있는것을알수있었다. 본연구에서는 MIC 최대희석배율이 32배인관계로단일돌연변이와이중돌연변이사이의 MIC 차이에대한비교분석을실시할수없었으며, 따라서이에대한연구가추후추가적으로실시되어야할것으로판단됨과아울러 gyra 및 parc 유전자이외에 fluoroquinolone계열의내성형성에관련이있는여러유전자에대한실험도이루어져야할것으로사료된다. Kanematsu 등 (14) 은 E. faecalis의고도내성은 parc 유전자의단일돌연변이또는 parc 유전자와 gyra 유전자의이중돌연변이와관련된다고보고한바있으며, Korten 등 (16) 및 Tankovic 등 (25) 은 gyra 유전자의단일돌연변이만으로도고도내성이나타남을보고한바있다. 본연구에서도 parc 유전자의변이와무관하게 gyra 유전자의단일변이로도고도내성이출현함을알수있었으며, 또한 gyra 유전자가시험에사용된 4종의 fluoroquinolone계항균제의내성유발에일차적인표적이됨을추측할수있었다. 결론 E. faecalis 52주및 E. faecium 25주의 CIP에대한디스크확산시험결과, 각각 44.2% 및 28.0% 가 CIP에내성을나타내었으며, 44.2% 및 44.2% 는부분내성을나타내었다. 77주의 Enterococcus spp. 중감수성, 부분내성또는내성을나타내는 E. faecalis 17주및 E. faecium 7주에대하여 gyra 및 parc 유전자의염기서열을분석하였을때, gyra 유전자의 Ser83과 Glu87번위치에서, parc 유전자의 Ser80 및 Glu84 번위치에서변이가관찰되었다. 이들분리주의 MIC와 gyra 및 parc 유전자의돌연변이양상을비교한결과, gyra 유전자의 Ser83의 Cys로변이는 fluoroquinolone계항생제에대한내성유발에관여하지않는것으로판단되며, Ser83의 Phe, Val, Tyr, Ile, Pro 및 Thr로변이및 Glu87의 Gly 또는 Leu로변이, parc 유전자 Ser80의 Ile 또는 Thr로변이및 Glu84의 Lys로의변이는 fluoroquinolone계열에대한내성유발과밀접한관련이있는것으로나타났다. CIP 디스크확산시험에서부분내성을보인 2주는 parc 유전자의변이만관찰된반면, 내성을보인 15주중 2주는 parc 유전자에서만, 6주는 gyra 유전자에서만변이를보였고 7주는 gyra와 parc 유전자모두에서이중돌연변이가관찰되었다. 본연구결과, 국내닭의정상세균총의하나인 Enterococcus spp. 가 fluoroquinolone계열항생제에대하여이미높은내성을형성하고있는것을확인할수있었으며, 또한 parc 유전자의변이와무관하게 gyra 유전자의단일변이로도고도내성이나타남과아울러 gyra 유전자가 CIP, ENO, NOR 및 OFL 항균제의내성유발에일차적인표적이됨을추측할수있었다. 참고문헌 1) 송시욱, 정석찬, 김성일, 정명은, 김계희, 이지연, 임숙경, 이영주, 조남인, 박종명, 박용호 : 2003년도국내도축장에서분리한세균의항생제감수성조사 1. 도축장의식육으로부터분리한 E. coli의항생제감수성. 한국수의공중보건학회지 28: 215-221, 2004. 2) 이영주, 김애란, 정석찬, 송시욱, 김재홍 : 닭분변유래 E. coli 및 Salmonella spp. 의항생제내성패턴. 대한수의학회지 45: 75-83, 2005. 3) Bazile-Pham-Khac S, Truong QC, Lafont JP, Gutmann L, Zhou XY, Osman M, Moreau NJ: Resistance to fluoroquinolones in Escherichia coli isolated from poultry. Antimicrob Agents Chemother 40: 1504-1507, 1996. 4) Chaslus-Dancla E, Martel JL, Carlier C, Lafont JP, Courvalin P: Emergence of aminoglycoside 3-N-acetyltransferase IV in Escherichia coli and Salmonella typhimurium isolated from animals in France. Antimicrob Agents Chemother 29: 239-243, 1986. 5) Cheng S, McCleskey FK, Gress MJ, Petroziello JM, Liu R, Namdari H, Beninga K, Salmen A, DelVecchio VG: A PCR assay for identification of Enterococcus faecium. J Clin Microbiol 35: 1248-1250, 1997. 6) del Mar Lleo M, Tafi MC, Signoretto C, Dal Cero C, Canepari P: Competitive polymerase chain reaction for quan-
78 조재근, 김기석, 이영주, 박청규, 곽동미, 김애란, 강민수, 김종완, 김병한, 구복경 tification of nonculturable Enterococcus faecalis cells in lake water. FEMS Microbiol Ecol 30: 345-353, 1999. 7) el Amin NA, Jalal S, Wretlind B. Alterations in gyra and parc associated with fluoroquinolone resistance in Enterococcus faecium. Antimicrob Agents Chemother 43: 947-949, 1999. 8) Endtz HP, Ruijs GJ, van Klingeren B, Jansen WH, van der Reyden T, Mouton RP: Quinolone resistance in Campylobacter isolated from man and poultry following the introduction of fluoroquinolones in veterinary medicine. J Antimcirob Chemother 27: 199-208, 1991. 9) Ferrero L, Cameron B, Crouzet J: Analysis of gyra and grla mutations in stepwise-selected ciprofloxacin-resistant mutants of Staphylococcus aureus. Antimicrob Agents Chemother 39: 1554-1558, 1995. 10) Ferrero L, Cameron B, Manse B, Lagneaux D, Crouzet J, Famechon A, Blanche F: Cloning and primary structure of Staphylococcus aureus DNA topoisomerase IV: a primary target of fluoroquinolones. Mol Microbiol 13: 641-653, 1994. 11) Garau J, Xercavins M, Rodriguez-Carballeira M, Gomez- Vera JR, Coll I, Vidal D, Llovet T, Ruiz-Bremon A: Emergence and dissemination of quinolone-resistant Escherichia coli in the community. Antimicrob Agents Chemother 43: 2736-2741, 1999. 12) Gellert M, Mizuuchi K, O'Dea MH, Nash HA: DNA gyrase: an enzyme that introduces superhelical turns into DNA. Proc Natl Acad Sci USA 73: 3872-3876, 1976. 13) Hooper DC, Wolfson JS: Fluoroquinolone antimicrobial agents. N Engl J Med 324: 384-394, 1991. 14) Kanematsu E, Deguchi T, Yasuda M, Kawamura T, Nishino Y, Kawada Y: Alterations in the gyra subunit of DNA gyrase and the parc subunit of DNA topoisomerase IV associated with quinolone resistance in Enterococcus faecalis. Antimicrob Agents Chemother 42: 433-435, 1998. 15) Kato J, Nishimura Y, Imamura R, Niki H, Hiraga S, Suzuki H: New topoisomerase essential for chromosome segregation in Escherichia coli. Cell 63: 393-404, 1990. 16) Korten V, Huang WM, Murray BE: Analysis by PCR and direct DNA sequencing of gyra mutations associated with fluoroquinolone resistance in Enterococcus faecalis. Antimicrob Agents Chemother 38: 2091-2094, 1994. 17) Morrison AJ Jr, Wenzel RP: Nosocomial urinary tract in- fections due to Enterococcus Ten years experience at a university hospital. Arch Intern Med 146: 1549-1551, 1986. 18) Murray BE: The life and times of the Enterococcus. Clin Microbiol Rev 3: 46-65, 1990. 19) Na EY, Trucksis M, Hopper DC: Quinolone resistance mutations in topoisomerase IV: relationship to the flqa locus and genetic evidence that topoisomerase IV is the primary target and DNA gyrase is the secondary target of fluoroquinolones in Staphylococcus aureus. Antimicrob Agents Chemother 40: 1881-1888, 1996. 20) Onodera Y, Okuda J, Tanaka M, Sato K: Inhibitory activities of quinolones against DNA gyrase and topoisomerase IV of Enterococcus faecalis. Antimicrob Agents Chemother 46: 1800-1804, 2002. 21) Pan XS, Ambler J, Mehtar S, Fisher LM: Involvement of topoisomerase IV and DNA gyrase as ciprofloxacin targets in Streptococcus pneumoniase. Antimicrob Agents Chemother 40: 2321-2326, 1994. 22) Pan XS, Fisher LM: Targeting of DNA gyrase in Streptococcus pneumoniae by sparfloxacin: selective targeting of gyrase or topoisomerase IV by quinolones. Antimicrob Agents Chemother 41: 471-474, 1997. 23) Pitout JD, Thomson KS, Hanson ND, Ehrhardt AF, Coudron P, Sanders CC: Plasmid-mediated resistance to expandedspectrum cephalosporins among Enterobacter aerogenes strains. Antimicrob Agents Chemother 42: 596-600, 1998. 24) Sylvain B, Fluit AC, Wagner U, Heisig P, Milatovic D, Verhoef J, Scheuring S, Kohrer K, Schmitz FJ: Association of alteration in parc and gyra proteins with resistance of clinical isolates of Enterococcus faecium to nine different fluoroquinolones. Antimicrob Agents Chemother 43: 2513-2516, 1999. 25) Tankovic J, Mahjoubi F, Courvalin P, Duval J, Leclercq R: Development of fluoroquinolone resistance in Enterococcus faecalis and role of mutations in the DNA gyrase gyra gene. Antimicrob Agents Chemother 40: 2558-2561, 1996. 26) Tankovic J, Perichon B, Duval J, Courvalin P: Contribution of mutations in gyra and parc genes to fluoroquinolone resistance of mutants of Streptococcus pneumoniae obtained in vivo and in vitro. Antimicrob Agents Chemother 40: 2505-2510, 1996.